>emb|AL662793.10| Mouse DNA sequence from clone RP23-186D6 on chromosome 11 Contains two
              novel genes, the Cpeb4 gene for cytoplasmic polyadenylation
              element binding protein 4, the 5' end of a novel gene and
              two CpG islands, complete sequence
          Length = 215152

 Score = 44.1 bits (22), Expect = 0.009
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 2      gagagaggacaagggttaacttgcag 27
              |||||||| |||||||||||||||||
Sbjct: 173933 gagagaggtcaagggttaacttgcag 173908

>emb|CR932968.2| Medicago truncatula chromosome 5 clone mth2-8e17, COMPLETE SEQUENCE
          Length = 128179

 Score = 42.1 bits (21), Expect = 0.036
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 9     gacaagggttaacttgcagtg 29
             |||||||||||||||||||||
Sbjct: 91129 gacaagggttaacttgcagtg 91109

>emb|AL591165.17| Mouse DNA sequence from clone RP23-336D20 on chromosome 11, complete
             sequence
          Length = 123050

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 2     gagagaggacaagggtta 19
             ||||||||||||||||||
Sbjct: 65375 gagagaggacaagggtta 65392

>ref|NM_118125.1| Arabidopsis thaliana EMB1895 AT4G20060 (EMB1895) mRNA, complete cds
          Length = 3405

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2    gagagaggacaagggtt 18
            |||||||||||||||||
Sbjct: 3241 gagagaggacaagggtt 3257

>gb|AE017138.1| Yersinia pestis biovar Medievalis str. 91001 section 12 of 16 of the
              complete genome
          Length = 290924

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                       
Query: 5      agaggacaagggttaacttgcagtg 29
              |||| ||||| ||||||||||||||
Sbjct: 156005 agagaacaagagttaacttgcagtg 155981

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 245889 ggagagaggacaagggt 245905

>gb|AY735645.1| Arabidopsis thaliana hypothetical protein AT4G20060 mRNA, complete
            cds
          Length = 3686

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2    gagagaggacaagggtt 18
            |||||||||||||||||
Sbjct: 3165 gagagaggacaagggtt 3181

>gb|AC147887.2| Xenopus tropicalis clone CH216-147L5, complete sequence
          Length = 176251

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 12     aagggttaacttgcagt 28
              |||||||||||||||||
Sbjct: 127299 aagggttaacttgcagt 127315

>gb|AC118640.8| Mus musculus chromosome 15, clone RP24-112A20, complete sequence
          Length = 179510

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 116181 ggagagaggacaagggt 116165

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                        
Query: 5       agaggacaagggttaacttgcagtg 29
               |||| ||||| ||||||||||||||
Sbjct: 3861440 agagaacaagagttaacttgcagtg 3861464

>gb|AC139029.10| Mus musculus chromosome 14, clone RP23-393A18, complete sequence
          Length = 204943

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 179470 ggagagaggacaagggt 179486

>emb|AL590714.27| Human DNA sequence from clone RP11-297K8 on chromosome 1 Contains a
             novel gene, the gene for a novel protein (HSPC155), the
             USP21 gene for ubiquitin specific protease 21, the PPOX
             gene for protoporphyrinogen oxidase, the B4GALT3 gene for
             UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase
             polypeptide 3, the ADAMTS4 gene for a disintegrin-like and
             metalloprotease (reprolysin type) with thrombospondin type
             1 motif 4, the NDUFS2 gene for NADH dehydrogenase
             (ubiquinone) Fe-S protein 2 (49kDa (NADH-coenzyme Q
             reductase)), the FCER1G gene for Fc fragment of IgE high
             affinity I  receptor for gamma polypeptide, the APOA2 gene
             for apolipoprotein A-II, the gene for a novel protein
             (FLJ12770), the NR1I3 gene for nuclear receptor subfamily
             1 group I member 3 and the 5' end of a novel gene,
             complete sequence
          Length = 133512

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 1     ggagagaggacaagggt 17
             |||||||||||||||||
Sbjct: 81425 ggagagaggacaagggt 81441

>gb|AC055753.21| Homo sapiens 3 BAC RP11-503I22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167662

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 164090 ggagagaggacaagggt 164074

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                        
Query: 5       agaggacaagggttaacttgcagtg 29
               |||| ||||| ||||||||||||||
Sbjct: 3993794 agagaacaagagttaacttgcagtg 3993818

>emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 52
          Length = 198427

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     gagagaggacaagggtt 18
             |||||||||||||||||
Sbjct: 52524 gagagaggacaagggtt 52508

>emb|AL021637.2|ATF18F4 Arabidopsis thaliana DNA chromosome 4, BAC clone F18F4 (ESSA project)
          Length = 99725

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     gagagaggacaagggtt 18
             |||||||||||||||||
Sbjct: 69545 gagagaggacaagggtt 69529

>emb|AJ414144.1| Yersinia pestis strain CO92 complete genome; segment 4/20
          Length = 208050

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                      
Query: 5     agaggacaagggttaacttgcagtg 29
             |||| ||||| ||||||||||||||
Sbjct: 58802 agagaacaagagttaacttgcagtg 58778

>gb|AC009652.14| Homo sapiens chromosome 11, clone RP11-428C19, complete sequence
          Length = 200823

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 110067 ggagagaggacaagggt 110051

>dbj|AK147618.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
            full-length enriched library, clone:M5C1092K24
            product:hypothetical protein, full insert sequence
          Length = 7304

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 1    ggagagaggacaagggt 17
            |||||||||||||||||
Sbjct: 1258 ggagagaggacaagggt 1274

>emb|AL929568.12| Zebrafish DNA sequence from clone CH211-59K8, complete sequence
          Length = 185257

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                  
Query: 10    acaagggttaacttgcagtga 30
             |||||||| ||||||||||||
Sbjct: 64254 acaagggtaaacttgcagtga 64274

>emb|AL731778.12| Mouse DNA sequence from clone RP23-475B13 on chromosome 2, complete
              sequence
          Length = 211430

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 1      ggagagaggacaagggt 17
              |||||||||||||||||
Sbjct: 177717 ggagagaggacaagggt 177733


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 162,721
Number of Sequences: 3902068
Number of extensions: 162721
Number of successful extensions: 52613
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52573
Number of HSP's gapped (non-prelim): 40
length of query: 30
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 10
effective length of database: 17,155,003,908
effective search space: 171550039080
effective search space used: 171550039080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)