ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart35a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_476143.1| Oryza sativa (japonica cultivar-group), predic... 50 0.007
2gb|AC135914.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.007
3gb|AC104705.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.007
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 48 0.026
6gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic ... 48 0.026
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
8gb|AY188663.1| Oryza malampuzhaensis clone 5 internal transcribe... 44 0.40
9gb|AY188662.1| Oryza malampuzhaensis clone 4 internal transcribe... 44 0.40
10gb|AY188661.1| Oryza malampuzhaensis clone 3 internal transcribe... 44 0.40
11gb|AY188660.1| Oryza malampuzhaensis clone 2 internal transcribe... 44 0.40
12gb|AY188659.1| Oryza malampuzhaensis clone 1 internal transcribe... 44 0.40
13gb|AY188658.1| Oryza malampuzhaensis clone 10 internal transcrib... 44 0.40
14gb|AY188657.1| Oryza malampuzhaensis clone 9 internal transcribe... 44 0.40
15gb|AY188655.1| Oryza malampuzhaensis clone 7 internal transcribe... 44 0.40
16gb|AY188654.1| Oryza malampuzhaensis clone 6 internal transcribe... 44 0.40
17gb|AY188653.1| Oryza malampuzhaensis clone 5 internal transcribe... 44 0.40
18gb|AY188652.1| Oryza malampuzhaensis clone 4 internal transcribe... 44 0.40
19gb|AY188650.1| Oryza malampuzhaensis clone 2 internal transcribe... 44 0.40
20gb|AY188648.1| Oryza malampuzhaensis clone 12 internal transcrib... 44 0.40
21gb|AY188646.1| Oryza malampuzhaensis clone 10 internal transcrib... 44 0.40
22gb|AY188645.1| Oryza malampuzhaensis clone 9 internal transcribe... 44 0.40
23gb|AY188644.1| Oryza malampuzhaensis clone 8 internal transcribe... 44 0.40
24gb|AY188643.1| Oryza malampuzhaensis clone 7 internal transcribe... 44 0.40
25gb|AY188642.1| Oryza malampuzhaensis clone 6 internal transcribe... 44 0.40
26gb|AY188641.1| Oryza malampuzhaensis clone 5 internal transcribe... 44 0.40
27gb|AY188640.1| Oryza malampuzhaensis clone 4 internal transcribe... 44 0.40
28gb|AY188639.1| Oryza malampuzhaensis clone 3 internal transcribe... 44 0.40
29gb|AY188638.1| Oryza malampuzhaensis clone 2 internal transcribe... 44 0.40
30gb|AY188637.1| Oryza malampuzhaensis clone 1 internal transcribe... 44 0.40
31gb|AY188636.1| Oryza minuta clone 23 internal transcribed spacer... 44 0.40
32gb|AY188635.1| Oryza minuta clone 22 internal transcribed spacer... 44 0.40
33gb|AY188634.1| Oryza minuta clone 21 internal transcribed spacer... 44 0.40
34gb|AY188633.1| Oryza minuta clone 20 internal transcribed spacer... 44 0.40
35gb|AY188632.1| Oryza minuta clone 19 internal transcribed spacer... 44 0.40
36gb|AY188631.1| Oryza minuta clone 18 internal transcribed spacer... 44 0.40
37gb|AY188630.1| Oryza minuta clone 17 internal transcribed spacer... 44 0.40
38gb|AY188629.1| Oryza minuta clone 16 internal transcribed spacer... 44 0.40
39gb|AY188628.1| Oryza minuta clone 15 internal transcribed spacer... 44 0.40
40gb|AY188627.1| Oryza minuta clone 14 internal transcribed spacer... 44 0.40
41gb|AY188626.1| Oryza minuta clone 13 internal transcribed spacer... 44 0.40
42gb|AY188625.1| Oryza minuta clone 12 internal transcribed spacer... 44 0.40
43gb|AY188624.1| Oryza minuta clone 11 internal transcribed spacer... 44 0.40
44gb|AY188623.1| Oryza minuta clone 10 internal transcribed spacer... 44 0.40
45gb|AY188622.1| Oryza minuta clone 9 internal transcribed spacer ... 44 0.40
46gb|AY188621.1| Oryza minuta clone 8 internal transcribed spacer ... 44 0.40
47gb|AY188620.1| Oryza minuta clone 7 internal transcribed spacer ... 44 0.40
48gb|AY188619.1| Oryza minuta clone 6 internal transcribed spacer ... 44 0.40
49gb|AY188618.1| Oryza minuta clone 5 internal transcribed spacer ... 44 0.40
50gb|AY188617.1| Oryza minuta clone 4 internal transcribed spacer ... 44 0.40
51gb|AY188616.1| Oryza minuta clone 3 internal transcribed spacer ... 44 0.40
52gb|AY188615.1| Oryza minuta clone 2 internal transcribed spacer ... 44 0.40
53gb|AY188614.1| Oryza minuta clone 1 internal transcribed spacer ... 44 0.40
54gb|AY188613.1| Oryza minuta clone 8 internal transcribed spacer ... 44 0.40
55gb|AY188612.1| Oryza minuta clone 7 internal transcribed spacer ... 44 0.40
56gb|AY188611.1| Oryza minuta clone 6 internal transcribed spacer ... 44 0.40
57gb|AY188610.1| Oryza minuta clone 5 internal transcribed spacer ... 44 0.40
58gb|AY188609.1| Oryza minuta clone 4 internal transcribed spacer ... 44 0.40
59gb|AY188608.1| Oryza minuta clone 3 internal transcribed spacer ... 44 0.40
60gb|AY188607.1| Oryza minuta clone 2 internal transcribed spacer ... 44 0.40
61gb|AY188606.1| Oryza minuta clone 1 internal transcribed spacer ... 44 0.40
62gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
63gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
64gb|AC133008.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
65gb|AC008060.5| Homo sapiens PAC clone RP5-912I13 from 7, complet... 42 1.6
66emb|AL449403.11| Human DNA sequence from clone RP11-569G13 on ch... 42 1.6
67dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
68dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
69dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
70gb|AC069145.5|AC069145 Oryza sativa chromosome 10 BAC OSJNBb0094... 42 1.6
71ref|NM_001427.2| Homo sapiens engrailed homolog 2 (EN2), mRNA 42 1.6
72dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
73gb|L12700.1|HUMEN2A01 Homo sapiens engrailed protein (EN2) gene,... 42 1.6
74dbj|AP003761.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
75dbj|AP006055.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
76dbj|AK109610.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
77dbj|AK102712.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
78dbj|AK060681.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
79gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 1.6
80gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.6
81gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
82gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.6
83dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone... 42 1.6
84gb|AY789641.1| Capsicum annuum WRKY family transcription factor ... 40 6.3
85gb|AY188682.1| Oryza eichingeri clone 1 internal transcribed spa... 40 6.3
86gb|AY188680.1| Oryza eichingeri clone 7 internal transcribed spa... 40 6.3
87gb|AY188679.1| Oryza eichingeri clone 6 internal transcribed spa... 40 6.3
88gb|AY188678.1| Oryza eichingeri clone 5 internal transcribed spa... 40 6.3
89gb|AY188677.1| Oryza eichingeri clone 4 internal transcribed spa... 40 6.3
90gb|AY188676.1| Oryza eichingeri clone 3 internal transcribed spa... 40 6.3
91gb|AY188675.1| Oryza eichingeri clone 2 internal transcribed spa... 40 6.3
92gb|AY188674.1| Oryza eichingeri clone 1 internal transcribed spa... 40 6.3
93gb|AY188672.1| Oryza eichingeri clone 9 internal transcribed spa... 40 6.3
94gb|AY188671.1| Oryza eichingeri clone 8 internal transcribed spa... 40 6.3
95gb|AY188670.1| Oryza eichingeri clone 7 internal transcribed spa... 40 6.3
96gb|AY188669.1| Oryza eichingeri clone 6 internal transcribed spa... 40 6.3
97gb|AY188668.1| Oryza eichingeri clone 5 internal transcribed spa... 40 6.3
98gb|AY188667.1| Oryza eichingeri clone 4 internal transcribed spa... 40 6.3
99gb|AY188666.1| Oryza eichingeri clone 3 internal transcribed spa... 40 6.3
100gb|AY188665.1| Oryza eichingeri clone 2 internal transcribed spa... 40 6.3
101gb|AY188664.1| Oryza eichingeri clone 1 internal transcribed spa... 40 6.3
102gb|AY188605.1| Oryza punctata clone 8 internal transcribed space... 40 6.3
103gb|AY188599.1| Oryza punctata clone 2 internal transcribed space... 40 6.3
104gb|AY188598.1| Oryza punctata clone 1 internal transcribed space... 40 6.3
105ref|XM_482866.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.3
106gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
107gb|AC121146.8| Mus musculus chromosome 3, clone RP24-297G3, comp... 40 6.3
108gb|AC133004.4| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
109gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.3
110ref|XM_981931.1| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
111ref|XM_981895.1| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
112ref|XM_981971.1| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
113ref|XM_895668.2| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
114ref|XM_895689.2| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
115ref|XM_895702.2| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
116ref|XM_919039.2| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
117ref|XM_919056.2| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
118ref|XM_982599.1| PREDICTED: Mus musculus G protein-coupled recep... 40 6.3
119emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 6.3
120gb|AC124448.4| Mus musculus BAC clone RP24-211A8 from chromosome... 40 6.3
121gb|AC140551.8| Medicago truncatula clone mth2-80i8, complete seq... 40 6.3
122gb|AC146548.11| Medicago truncatula clone mth2-2p3, complete seq... 40 6.3
123gb|AC148097.7| Medicago truncatula clone mth2-15a20, complete se... 40 6.3
124gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.3
125emb|AL353613.10| Human DNA sequence from clone RP11-395D3 on chr... 40 6.3
126emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chro... 40 6.3
127gb|AY342401.1| Homo sapiens vitamin D (1,25-dihydroxyvitamin D3)... 40 6.3
128emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 6.3
129gb|AC147879.2| Xenopus tropicalis clone CH216-108K9, complete se... 40 6.3
130gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell... 40 6.3
131gb|AC147774.3| Medicago truncatula chromosome 2 BAC clone mth2-1... 40 6.3
132dbj|AK045935.1| Mus musculus adult male corpora quadrigemina cDN... 40 6.3
133dbj|AK042723.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 6.3
134dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
135dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
136dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
137dbj|AP003142.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
138gb|AF479075.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
139gb|AF479074.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
140gb|AF479073.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
141gb|AF479072.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
142gb|AF479071.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
143gb|AF479070.1| Oryza punctata internal transcribed spacer 1, 5.8... 40 6.3
144gb|AF479067.1| Oryza officinalis internal transcribed spacer 1, ... 40 6.3
145gb|AF479066.1| Oryza rhizomatis internal transcribed spacer 1, 5... 40 6.3
146gb|AF479065.1| Oryza rhizomatis internal transcribed spacer 1, 5... 40 6.3
147gb|AF479064.1| Oryza officinalis internal transcribed spacer 1, ... 40 6.3
148gb|AF479063.1| Oryza officinalis internal transcribed spacer 1, ... 40 6.3
149gb|AC004466.1| Homo sapiens 12 PAC RPCI5-1057I20 (Roswell Park C... 40 6.3
150gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.3
151dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
152dbj|AP007253.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
153dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
154dbj|AK105369.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
155dbj|AK070733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
156gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, comple... 40 6.3
157dbj|AK060497.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
158gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 ... 40 6.3
159gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.3
160gb|AC148012.5| Mus musculus BAC clone RP23-174D18 from 18, compl... 40 6.3
161emb|AL672095.6| Mouse DNA sequence from clone RP23-387N22 on chr... 40 6.3
162dbj|AB025356.1| Anguilla japonica mRNA for activin B, complete cds 40 6.3
163gb|M80463.1|MUSCTHB1A Mus musculus caudal type homeobox-1 (Cdx-1... 40 6.3
164dbj|AP005137.2| Homo sapiens genomic DNA, chromosome 18p clone:R... 40 6.3

>ref|XM_476143.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1029

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 435 ccctcctcgcggccgccgccgcgcc 459
           |||||||||||||||||||||||||
Sbjct: 61  ccctcctcgcggccgccgccgcgcc 37



to top

>gb|AC135914.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0074P11, complete sequence
          Length = 148753

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 435   ccctcctcgcggccgccgccgcgcc 459
             |||||||||||||||||||||||||
Sbjct: 19916 ccctcctcgcggccgccgccgcgcc 19892



to top

>gb|AC104705.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1008_D08,
             complete sequence
          Length = 94286

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 435   ccctcctcgcggccgccgccgcgcc 459
             |||||||||||||||||||||||||
Sbjct: 93223 ccctcctcgcggccgccgccgcgcc 93199



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                        
Query: 435     ccctcctcgcggccgccgccgcgcc 459
               |||||||||||||||||||||||||
Sbjct: 6788962 ccctcctcgcggccgccgccgcgcc 6788938



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 439      cctcgcggccgccgccgcgcccgtc 463
                |||||| ||||||||||||||||||
Sbjct: 15980557 cctcgctgccgccgccgcgcccgtc 15980533



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 124      gttgcatgagttcaccggag 143
                ||||||||||||||||||||
Sbjct: 16096241 gttgcatgagttcaccggag 16096260



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 316      ggggatcgatccaaggctggctggctgg 343
                ||||||||||||| ||||||||||||||
Sbjct: 30194713 ggggatcgatccatggctggctggctgg 30194686



to top

>gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic sequence, complete
             sequence
          Length = 163972

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 316   ggggatcgatccaaggctggctggctgg 343
             ||||||||||||| ||||||||||||||
Sbjct: 29182 ggggatcgatccatggctggctggctgg 29209



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 316      ggggatcgatccaaggctggctggctgg 343
                ||||||||||||| ||||||||||||||
Sbjct: 30286135 ggggatcgatccatggctggctggctgg 30286108



to top

>gb|AY188663.1| Oryza malampuzhaensis clone 5 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188662.1| Oryza malampuzhaensis clone 4 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 581

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188661.1| Oryza malampuzhaensis clone 3 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188660.1| Oryza malampuzhaensis clone 2 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188659.1| Oryza malampuzhaensis clone 1 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 581

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188658.1| Oryza malampuzhaensis clone 10 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188657.1| Oryza malampuzhaensis clone 9 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188655.1| Oryza malampuzhaensis clone 7 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188654.1| Oryza malampuzhaensis clone 6 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188653.1| Oryza malampuzhaensis clone 5 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188652.1| Oryza malampuzhaensis clone 4 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188650.1| Oryza malampuzhaensis clone 2 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188648.1| Oryza malampuzhaensis clone 12 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188646.1| Oryza malampuzhaensis clone 10 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188645.1| Oryza malampuzhaensis clone 9 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188644.1| Oryza malampuzhaensis clone 8 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188643.1| Oryza malampuzhaensis clone 7 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188642.1| Oryza malampuzhaensis clone 6 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 578

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188641.1| Oryza malampuzhaensis clone 5 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188640.1| Oryza malampuzhaensis clone 4 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188639.1| Oryza malampuzhaensis clone 3 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188638.1| Oryza malampuzhaensis clone 2 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188637.1| Oryza malampuzhaensis clone 1 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 578

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188636.1| Oryza minuta clone 23 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188635.1| Oryza minuta clone 22 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188634.1| Oryza minuta clone 21 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188633.1| Oryza minuta clone 20 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188632.1| Oryza minuta clone 19 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188631.1| Oryza minuta clone 18 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188630.1| Oryza minuta clone 17 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188629.1| Oryza minuta clone 16 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188628.1| Oryza minuta clone 15 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188627.1| Oryza minuta clone 14 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188626.1| Oryza minuta clone 13 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188625.1| Oryza minuta clone 12 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188624.1| Oryza minuta clone 11 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188623.1| Oryza minuta clone 10 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188622.1| Oryza minuta clone 9 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188621.1| Oryza minuta clone 8 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188620.1| Oryza minuta clone 7 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188619.1| Oryza minuta clone 6 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188618.1| Oryza minuta clone 5 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188617.1| Oryza minuta clone 4 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188616.1| Oryza minuta clone 3 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188615.1| Oryza minuta clone 2 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188614.1| Oryza minuta clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188613.1| Oryza minuta clone 8 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188612.1| Oryza minuta clone 7 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188611.1| Oryza minuta clone 6 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188610.1| Oryza minuta clone 5 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188609.1| Oryza minuta clone 4 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188608.1| Oryza minuta clone 3 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188607.1| Oryza minuta clone 2 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AY188606.1| Oryza minuta clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 cgcggccgccgccgcgcccgtc 463
           ||||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccgtc 72



to top

>gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1314_A05,
             complete sequence
          Length = 109853

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 439   cctcgcggccgccgccgcgcccgtc 463
             |||||| ||||||||||||||||||
Sbjct: 94222 cctcgctgccgccgccgcgcccgtc 94198



to top

>gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015F11,
             complete sequence
          Length = 177574

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 439   cctcgcggccgccgccgcgcccgtc 463
             |||||| ||||||||||||||||||
Sbjct: 66308 cctcgctgccgccgccgcgcccgtc 66284



to top

>gb|AC133008.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026K20 map S10559, complete sequence
          Length = 115996

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 430   gccgcccctcctcgcggccgccgcc 454
             ||||||||||||||| |||||||||
Sbjct: 48677 gccgcccctcctcgccgccgccgcc 48701



to top

>gb|AC008060.5| Homo sapiens PAC clone RP5-912I13 from 7, complete sequence
          Length = 161566

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 434   cccctcctcgcggccgccgcc 454
             |||||||||||||||||||||
Sbjct: 88649 cccctcctcgcggccgccgcc 88629



to top

>emb|AL449403.11| Human DNA sequence from clone RP11-569G13 on chromosome 9 Contains a
              eukaryotic translation initiation factor 4B (EIF4B)
              pseudogene and part of a novel gene, complete sequence
          Length = 173916

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 326    ccaaggctggctggctggctg 346
              |||||||||||||||||||||
Sbjct: 164891 ccaaggctggctggctggctg 164871



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 430      gccgcccctcctcgcggccgccgcc 454
                ||||||||||||||| |||||||||
Sbjct: 28321939 gccgcccctcctcgccgccgccgcc 28321963



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 433      gcccctcctcgcggccgccgccgc 456
                |||||||||||| |||||||||||
Sbjct: 11112764 gcccctcctcgccgccgccgccgc 11112741



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 439      cctcgcggccgccgccgcgcccgtc 463
                |||||| ||||||||||||||||||
Sbjct: 17019505 cctcgccgccgccgccgcgcccgtc 17019529



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 439      cctcgcggccgccgccgcgcccgtc 463
                |||||| ||||||||||||||||||
Sbjct: 29337712 cctcgccgccgccgccgcgcccgtc 29337688



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 430      gccgcccctcctcgcggccgccgccgcgc 458
                ||||||||||| ||| |||||||||||||
Sbjct: 27635145 gccgcccctccccgccgccgccgccgcgc 27635117



to top

>gb|AC069145.5|AC069145 Oryza sativa chromosome 10 BAC OSJNBb0094K03 genomic sequence, complete
             sequence
          Length = 135216

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 439   cctcgcggccgccgccgcgcccgtc 463
             |||||| ||||||||||||||||||
Sbjct: 59997 cctcgccgccgccgccgcgcccgtc 60021



to top

>ref|NM_001427.2| Homo sapiens engrailed homolog 2 (EN2), mRNA
          Length = 4793

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 434  cccctcctcgcggccgccgcc 454
            |||||||||||||||||||||
Sbjct: 1096 cccctcctcgcggccgccgcc 1076



to top

>dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0621D05
          Length = 180250

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 439   cctcgcggccgccgccgcgcccgtc 463
             |||||| ||||||||||||||||||
Sbjct: 48593 cctcgccgccgccgccgcgcccgtc 48569



to top

>gb|L12700.1|HUMEN2A01 Homo sapiens engrailed protein (EN2) gene, exon 1
          Length = 2353

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 434  cccctcctcgcggccgccgcc 454
            |||||||||||||||||||||
Sbjct: 1096 cccctcctcgcggccgccgcc 1076



to top

>dbj|AP003761.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0018H04
          Length = 142053

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 439    cctcgcggccgccgccgcgcccgtc 463
              |||||| ||||||||||||||||||
Sbjct: 100510 cctcgccgccgccgccgcgcccgtc 100486



to top

>dbj|AP006055.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0778G11
          Length = 59211

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 430   gccgcccctcctcgcggccgccgccgcgc 458
             ||||||||||| ||| |||||||||||||
Sbjct: 39328 gccgcccctccccgccgccgccgccgcgc 39300



to top

>dbj|AK109610.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-137-G02, full
           insert sequence
          Length = 1936

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 430 gccgcccctcctcgcggccgccgccgcgc 458
           ||||||||||| ||| |||||||||||||
Sbjct: 342 gccgcccctccccgccgccgccgccgcgc 314



to top

>dbj|AK102712.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033104O20, full
            insert sequence
          Length = 1562

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 430  gccgcccctcctcgcggccgccgccgcgc 458
            ||||||||||| ||| |||||||||||||
Sbjct: 1019 gccgcccctccccgccgccgccgccgcgc 1047



to top

>dbj|AK060681.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-D12, full
            insert sequence
          Length = 1645

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 430  gccgcccctcctcgcggccgccgccgcgc 458
            ||||||||||| ||| |||||||||||||
Sbjct: 1018 gccgcccctccccgccgccgccgccgcgc 1046



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 441     tcgcggccgccgccgcgcccg 461
               |||||||||||||||||||||
Sbjct: 1978803 tcgcggccgccgccgcgcccg 1978783



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 442     cgcggccgccgccgcgcccg 461
               ||||||||||||||||||||
Sbjct: 1952063 cgcggccgccgccgcgcccg 1952082



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 444     cggccgccgccgcgcccgtct 464
               |||||||||||||||||||||
Sbjct: 1343453 cggccgccgccgcgcccgtct 1343433



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 440     ctcgcggccgccgccgcgcccgtc 463
               |||| |||||||||||||||||||
Sbjct: 2896302 ctcgaggccgccgccgcgcccgtc 2896325



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 439      cctcgcggccgccgccgcgcccgtc 463
                |||||| ||||||||||||||||||
Sbjct: 17028545 cctcgccgccgccgccgcgcccgtc 17028569



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 430      gccgcccctcctcgcggccgccgcc 454
                ||||||||||||||| |||||||||
Sbjct: 28304388 gccgcccctcctcgccgccgccgcc 28304412



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 433      gcccctcctcgcggccgccgccgc 456
                |||||||||||| |||||||||||
Sbjct: 11191953 gcccctcctcgccgccgccgccgc 11191930



to top

>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340,
             complete sequence
          Length = 120480

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 100   gttcatcattagttaatgatg 120
             |||||||||||||||||||||
Sbjct: 49900 gttcatcattagttaatgatg 49880



to top

>gb|AY789641.1| Capsicum annuum WRKY family transcription factor mRNA, complete cds
          Length = 1646

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    gcaaatcaaattggatatat 21
            ||||||||||||||||||||
Sbjct: 1641 gcaaatcaaattggatatat 1622



to top

>gb|AY188682.1| Oryza eichingeri clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188680.1| Oryza eichingeri clone 7 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188679.1| Oryza eichingeri clone 6 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188678.1| Oryza eichingeri clone 5 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188677.1| Oryza eichingeri clone 4 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188676.1| Oryza eichingeri clone 3 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188675.1| Oryza eichingeri clone 2 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188674.1| Oryza eichingeri clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188672.1| Oryza eichingeri clone 9 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188671.1| Oryza eichingeri clone 8 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 577

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188670.1| Oryza eichingeri clone 7 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188669.1| Oryza eichingeri clone 6 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188668.1| Oryza eichingeri clone 5 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 577

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188667.1| Oryza eichingeri clone 4 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188666.1| Oryza eichingeri clone 3 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188665.1| Oryza eichingeri clone 2 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188664.1| Oryza eichingeri clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188605.1| Oryza punctata clone 8 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188599.1| Oryza punctata clone 2 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 581

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AY188598.1| Oryza punctata clone 1 internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 581

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>ref|XM_482866.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 439 cctcgcggccgccgccgcgcccgt 462
           |||||| |||||||||||||||||
Sbjct: 97  cctcgccgccgccgccgcgcccgt 74



to top

>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05,
             complete sequence
          Length = 143400

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   gttgcatgagttcaccggag 143
             ||||||||||||||||||||
Sbjct: 47411 gttgcatgagttcaccggag 47430



to top

>gb|AC121146.8| Mus musculus chromosome 3, clone RP24-297G3, complete sequence
          Length = 157105

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   cacttacttatgtatataat 273
             ||||||||||||||||||||
Sbjct: 91921 cacttacttatgtatataat 91940



to top

>gb|AC133004.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0046F10, complete sequence
          Length = 184041

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 433   gcccctcctcgcggccgccgccgc 456
             |||||||||||| |||||||||||
Sbjct: 64846 gcccctcctcgccgccgccgccgc 64869



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 442     cgcggccgccgccgcgcccg 461
               ||||||||||||||||||||
Sbjct: 2642036 cgcggccgccgccgcgcccg 2642017



to top

>ref|XM_981931.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 2 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>ref|XM_981895.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 1 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79



to top

>ref|XM_981971.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 3 (Gpr165), mRNA
          Length = 3799

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>ref|XM_895668.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 2 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>ref|XM_895689.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 3 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79



to top

>ref|XM_895702.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 4 (Gpr165), mRNA
          Length = 3799

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>ref|XM_919039.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 6 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>ref|XM_919056.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 7 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79



to top

>ref|XM_982599.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 8 (Gpr165), mRNA
          Length = 3694

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52



to top

>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12
          Length = 294800

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 430   gccgcccctcctcgcggccgccgc 453
             ||||||| ||||||||||||||||
Sbjct: 12665 gccgcccgtcctcgcggccgccgc 12688



to top

>gb|AC124448.4| Mus musculus BAC clone RP24-211A8 from chromosome 18, complete sequence
          Length = 159308

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    cgcggccgccgccgcgcccg 461
              ||||||||||||||||||||
Sbjct: 100589 cgcggccgccgccgcgcccg 100570



to top

>gb|AC140551.8| Medicago truncatula clone mth2-80i8, complete sequence
          Length = 135244

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     atcaaattggatatatgttt 25
             ||||||||||||||||||||
Sbjct: 79673 atcaaattggatatatgttt 79692



to top

>gb|AC146548.11| Medicago truncatula clone mth2-2p3, complete sequence
          Length = 129327

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 6    atcaaattggatatatgttt 25
            ||||||||||||||||||||
Sbjct: 6535 atcaaattggatatatgttt 6516



to top

>gb|AC148097.7| Medicago truncatula clone mth2-15a20, complete sequence
          Length = 125098

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     atcaaattggatatatgttt 25
             ||||||||||||||||||||
Sbjct: 79466 atcaaattggatatatgttt 79485



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 413     ctcggcgacctgaagctgcc 432
               ||||||||||||||||||||
Sbjct: 4286015 ctcggcgacctgaagctgcc 4285996



to top

>emb|AL353613.10| Human DNA sequence from clone RP11-395D3 on chromosome 9 Contains the
             5' end of a novel gene, complete sequence
          Length = 97898

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 326   ccaaggctggctggctggct 345
             ||||||||||||||||||||
Sbjct: 46138 ccaaggctggctggctggct 46157



to top

>emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chromosome 1 Contains the CTH
              gene for cystathionase (cystathionine gamma-lyase) and a
              cysteine and histidine-rich domain (CHORD)-containing zinc
              binding protein 1 (CHORDC1) pseudogene, complete sequence
          Length = 151777

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     agtactaactaatcttatct 91
              ||||||||||||||||||||
Sbjct: 121011 agtactaactaatcttatct 120992



to top

>gb|AY342401.1| Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR) gene,
             complete cds
          Length = 67076

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 330   ggctggctggctggctgcga 349
             ||||||||||||||||||||
Sbjct: 29674 ggctggctggctggctgcga 29655



to top

>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 444   cggccgccgccgcgcccgtc 463
             ||||||||||||||||||||
Sbjct: 63028 cggccgccgccgcgcccgtc 63047



to top

>gb|AC147879.2| Xenopus tropicalis clone CH216-108K9, complete sequence
          Length = 183182

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     attggatatatgtttgtaca 30
              ||||||||||||||||||||
Sbjct: 133344 attggatatatgtttgtaca 133325



to top

>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 327   caaggctggctggctggctg 346
             ||||||||||||||||||||
Sbjct: 89987 caaggctggctggctggctg 89968



to top

>gb|AC147774.3| Medicago truncatula chromosome 2 BAC clone mth2-10c8, complete sequence
          Length = 110758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     atcaaattggatatatgttt 25
             ||||||||||||||||||||
Sbjct: 60629 atcaaattggatatatgttt 60610



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     atcaaattggatatatgttt 25
             ||||||||||||||||||||
Sbjct: 53374 atcaaattggatatatgttt 53355



to top

>dbj|AK045935.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230324O03
           product:hypothetical Rhodopsin-like GPCR
           superfamily/G-protein coupled receptors family 1 profile
           containing protein, full insert sequence
          Length = 1656

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 27  tccaaggctggctggctggc 8



to top

>dbj|AK042723.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730018P10 product:hypothetical
           Rhodopsin-like GPCR superfamily/G-protein coupled
           receptors family 1 profile containing protein, full
           insert sequence
          Length = 2558

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 325 tccaaggctggctggctggc 344
           ||||||||||||||||||||
Sbjct: 48  tccaaggctggctggctggc 29



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 439      cctcgcggccgccgccgcgcccgt 462
                |||||| |||||||||||||||||
Sbjct: 23043008 cctcgccgccgccgccgcgcccgt 23043031



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 437      ctcctcgcggccgccgccgc 456
                ||||||||||||||||||||
Sbjct: 22333292 ctcctcgcggccgccgccgc 22333273



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 434      cccctcctcgcggccgccgccgcg 457
                ||||||||||| ||||||||||||
Sbjct: 30481482 cccctcctcgccgccgccgccgcg 30481505



to top

>dbj|AP003142.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0435H01
          Length = 160141

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 434    cccctcctcgcggccgccgccgcg 457
              ||||||||||| ||||||||||||
Sbjct: 109745 cccctcctcgccgccgccgccgcg 109768



to top

>gb|AF479075.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479074.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479073.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479072.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479071.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479070.1| Oryza punctata internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479067.1| Oryza officinalis internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 591

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479066.1| Oryza rhizomatis internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 591

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479065.1| Oryza rhizomatis internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 591

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479064.1| Oryza officinalis internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 590

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AF479063.1| Oryza officinalis internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 590

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 442 cgcggccgccgccgcgcccg 461
           ||||||||||||||||||||
Sbjct: 51  cgcggccgccgccgcgcccg 70



to top

>gb|AC004466.1| Homo sapiens 12 PAC RPCI5-1057I20 (Roswell Park Cancer Institute Human
             PAC library) complete sequence
          Length = 122186

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 330   ggctggctggctggctgcga 349
             ||||||||||||||||||||
Sbjct: 13873 ggctggctggctggctgcga 13854



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 431     ccgcccctcctcgcggccgccgccgcgc 458
               |||||||||| ||| |||||||||||||
Sbjct: 4209581 ccgcccctccccgccgccgccgccgcgc 4209608



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 442     cgcggccgccgccgcgcccg 461
               ||||||||||||||||||||
Sbjct: 2777316 cgcggccgccgccgcgcccg 2777335



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 436     cctcctcgcggccgccgccg 455
               ||||||||||||||||||||
Sbjct: 1055107 cctcctcgcggccgccgccg 1055088



to top

>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0567H04
          Length = 181420

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 437    ctcctcgcggccgccgccgc 456
              ||||||||||||||||||||
Sbjct: 138538 ctcctcgcggccgccgccgc 138519



to top

>dbj|AP007253.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0004O05
          Length = 140513

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    gttgcatgagttcaccggag 143
              ||||||||||||||||||||
Sbjct: 126158 gttgcatgagttcaccggag 126139



to top

>dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0470B03
          Length = 163371

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 439    cctcgcggccgccgccgcgcccgt 462
              |||||| |||||||||||||||||
Sbjct: 102736 cctcgccgccgccgccgcgcccgt 102759



to top

>dbj|AK105369.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-B08, full
           insert sequence
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 437 ctcctcgcggccgccgccgc 456
           ||||||||||||||||||||
Sbjct: 55  ctcctcgcggccgccgccgc 74



to top

>dbj|AK070733.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063A20, full
           insert sequence
          Length = 1154

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 434 cccctcctcgcggccgccgccgcg 457
           ||||||||||| ||||||||||||
Sbjct: 36  cccctcctcgccgccgccgccgcg 59



to top

>gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, complete genome
          Length = 156487

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 433    gcccctcctcgcggccgccg 452
              ||||||||||||||||||||
Sbjct: 155149 gcccctcctcgcggccgccg 155168



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 433    gcccctcctcgcggccgccg 452
              ||||||||||||||||||||
Sbjct: 128154 gcccctcctcgcggccgccg 128135



to top

>dbj|AK060497.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-G05, full
            insert sequence
          Length = 1719

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 433  gcccctcctcgcggccgccgccgc 456
            |||||||||||| |||||||||||
Sbjct: 1273 gcccctcctcgccgccgccgccgc 1250



to top

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 327    caaggctggctggctggctg 346
              ||||||||||||||||||||
Sbjct: 235978 caaggctggctggctggctg 235959



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 442     cgcggccgccgccgcgcccg 461
               ||||||||||||||||||||
Sbjct: 4708128 cgcggccgccgccgcgcccg 4708147



to top

>gb|AC148012.5| Mus musculus BAC clone RP23-174D18 from 18, complete sequence
          Length = 226568

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    cgcggccgccgccgcgcccg 461
              ||||||||||||||||||||
Sbjct: 217018 cgcggccgccgccgcgcccg 216999



to top

>emb|AL672095.6| Mouse DNA sequence from clone RP23-387N22 on chromosome X, complete
              sequence
          Length = 165970

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 325    tccaaggctggctggctggc 344
              ||||||||||||||||||||
Sbjct: 113744 tccaaggctggctggctggc 113725



to top

>dbj|AB025356.1| Anguilla japonica mRNA for activin B, complete cds
          Length = 3346

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 446  gccgccgccgcgcccgtctg 465
            ||||||||||||||||||||
Sbjct: 2143 gccgccgccgcgcccgtctg 2124



to top

>gb|M80463.1|MUSCTHB1A Mus musculus caudal type homeobox-1 (Cdx-1) gene, complete cds
          Length = 7045

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 442  cgcggccgccgccgcgcccg 461
            ||||||||||||||||||||
Sbjct: 1046 cgcggccgccgccgcgcccg 1027



to top

>dbj|AP005137.2| Homo sapiens genomic DNA, chromosome 18p clone:RP11-78A19, complete
             sequences
          Length = 80992

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 327   caaggctggctggctggctg 346
             ||||||||||||||||||||
Sbjct: 74613 caaggctggctggctggctg 74594


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,766,554
Number of Sequences: 3902068
Number of extensions: 3766554
Number of successful extensions: 103615
Number of sequences better than 10.0: 164
Number of HSP's better than 10.0 without gapping: 167
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100820
Number of HSP's gapped (non-prelim): 2795
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top