ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart34f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_642217.1| Dictyostelium discoideum hypothetical protein (... 42 1.0
2gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, comp... 42 1.0
3emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 b... 42 1.0
4gb|AF312225.1|AF312225 Homo sapiens chromosome 2 map 2q37.1, com... 42 1.0
5gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, com... 42 1.0
6gb|AE008394.1|AE008394 Streptococcus pneumoniae R6 section 10 of... 42 1.0
7gb|AC068134.5| Homo sapiens BAC clone RP11-762N20 from 2, comple... 42 1.0
8emb|AL391315.22| Human DNA sequence from clone RP11-150F24 on ch... 40 4.1
9emb|AL772364.20| Mouse DNA sequence from clone RP23-242C19 on ch... 40 4.1
10gb|AC025871.8| Homo sapiens chromosome 8, clone RP11-181B11, com... 40 4.1
11gb|AC084261.5| Homo sapiens chromosome 8, clone RP3-335L1, compl... 40 4.1
12gb|AC109614.9| Mus musculus chromosome 5, clone RP23-107M21, com... 40 4.1
13emb|AL354805.23| Mouse DNA sequence from clone RP21-544J17 on ch... 40 4.1

>ref|XM_642217.1| Dictyostelium discoideum hypothetical protein (DDB0189547), partial
           mRNA
          Length = 840

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 178 aaaactacaatcggaaaagcaaacc 202
           ||||||||||||| |||||||||||
Sbjct: 781 aaaactacaatcgcaaaagcaaacc 805



to top

>gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, complete sequence
          Length = 203141

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    aaaactacaatcggaaaagca 198
              |||||||||||||||||||||
Sbjct: 165881 aaaactacaatcggaaaagca 165901



to top

>emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 bp, chromosome 7
          Length = 281000

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   aaaactacaatcggaaaagca 198
             |||||||||||||||||||||
Sbjct: 57007 aaaactacaatcggaaaagca 56987



to top

>gb|AF312225.1|AF312225 Homo sapiens chromosome 2 map 2q37.1, complete sequence
          Length = 345102

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 279    tagggagctgggtgctgttgccctc 303
              ||||| |||||||||||||||||||
Sbjct: 334444 tagggtgctgggtgctgttgccctc 334420



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 280    agggagctgggtgctgttgccctc 303
              |||| |||||||||||||||||||
Sbjct: 333864 agggtgctgggtgctgttgccctc 333887



to top

>gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, complete sequence
          Length = 185347

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   aaaactacaatcggaaaagca 198
             |||||||||||||||||||||
Sbjct: 34770 aaaactacaatcggaaaagca 34790



to top

>gb|AE008394.1|AE008394 Streptococcus pneumoniae R6 section 10 of 184 of the complete genome
          Length = 10029

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 6    gggaaaatttatataggagcaaatg 30
            |||||||||| ||||||||||||||
Sbjct: 6794 gggaaaatttgtataggagcaaatg 6818



to top

>gb|AC068134.5| Homo sapiens BAC clone RP11-762N20 from 2, complete sequence
          Length = 181068

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 279   tagggagctgggtgctgttgccctc 303
             ||||| |||||||||||||||||||
Sbjct: 27343 tagggtgctgggtgctgttgccctc 27319



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 280   agggagctgggtgctgttgccctc 303
             |||| |||||||||||||||||||
Sbjct: 26763 agggtgctgggtgctgttgccctc 26786



to top

>emb|AL391315.22| Human DNA sequence from clone RP11-150F24 on chromosome X Contains the
              RNF128 gene for ring finger protein 128, the 5' end of a
              novel gene and a CpG island, complete sequence
          Length = 169812

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    ttgcagtcaaaactcatgca 238
              ||||||||||||||||||||
Sbjct: 114665 ttgcagtcaaaactcatgca 114684



to top

>emb|AL772364.20| Mouse DNA sequence from clone RP23-242C19 on chromosome 11 Contains a
             ribosomal protein S16 (Rps16) pseudogene, the B3gnt1 gene
             for beta-1,3-N-acetylglucosaminyltransferase 1, the Murr1
             gene for U2af1-rs1 region 1, the U2af1-rs1 gene for U2
             small nuclear ribonucleoprotein auxiliary factor (U2AF) 1
             (related sequence 1) and two CpG islands, complete
             sequence
          Length = 210863

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    taggagcaaatgtgtatgta 38
             ||||||||||||||||||||
Sbjct: 83411 taggagcaaatgtgtatgta 83430



to top

>gb|AC025871.8| Homo sapiens chromosome 8, clone RP11-181B11, complete sequence
          Length = 172748

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    acaatcggaaaagcaaacca 203
              ||||||||||||||||||||
Sbjct: 129361 acaatcggaaaagcaaacca 129342



to top

>gb|AC084261.5| Homo sapiens chromosome 8, clone RP3-335L1, complete sequence
          Length = 159212

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   acaatcggaaaagcaaacca 203
             ||||||||||||||||||||
Sbjct: 46368 acaatcggaaaagcaaacca 46349



to top

>gb|AC109614.9| Mus musculus chromosome 5, clone RP23-107M21, complete sequence
          Length = 194308

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   aactggagctacagaactacaatg 144
             |||||||| |||||||||||||||
Sbjct: 63855 aactggagttacagaactacaatg 63832



to top

>emb|AL354805.23| Mouse DNA sequence from clone RP21-544J17 on chromosome 5, complete
              sequence
          Length = 103922

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 121    aactggagctacagaactacaatg 144
              |||||||| |||||||||||||||
Sbjct: 103617 aactggagttacagaactacaatg 103594



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 121    aactggagctacagaactacaatg 144
              |||||||| |||||||||||||||
Sbjct: 101222 aactggagttacagaactacaatg 101199



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   aactggagctacagaactacaatg 144
             |||||||| |||||||||||||||
Sbjct: 98827 aactggagttacagaactacaatg 98804



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   aactggagctacagaactacaatg 144
             |||||||| |||||||||||||||
Sbjct: 96430 aactggagttacagaactacaatg 96407


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,854,188
Number of Sequences: 3902068
Number of extensions: 2854188
Number of successful extensions: 52851
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52819
Number of HSP's gapped (non-prelim): 32
length of query: 310
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 288
effective length of database: 17,147,199,772
effective search space: 4938393534336
effective search space used: 4938393534336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top