>ref|XM_650608.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (24.t00002)
           partial mRNA
          Length = 1695

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 146 aaataaagttttacaatggt 165
           ||||||||||||||||||||
Sbjct: 858 aaataaagttttacaatggt 877

>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the
             5' end of the RORB gene for RAR-related orphan receptor B
             protein (RZRB, ROR-BETA), two novel genes and two CpG
             islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    tatattcaaaactacaatag 64
             ||||||||||||||||||||
Sbjct: 99126 tatattcaaaactacaatag 99107

>gb|DQ399842.2| Bos taurus telomerase reverse transcriptase (TERT) gene, complete cds
          Length = 19252

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 198  ccgccacatgggggagggac 217
            ||||||||||||||||||||
Sbjct: 3246 ccgccacatgggggagggac 3227

>gb|AC154706.2| Mus musculus BAC clone RP23-132D23 from chromosome 14, complete
             sequence
          Length = 215330

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 239   gctaaagctaaagcccttgg 258
             ||||||||||||||||||||
Sbjct: 30713 gctaaagctaaagcccttgg 30732

>emb|CT025563.11| Mouse DNA sequence from clone RP23-472D20 on chromosome 14, complete
              sequence
          Length = 174286

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 239    gctaaagctaaagcccttgg 258
              ||||||||||||||||||||
Sbjct: 165123 gctaaagctaaagcccttgg 165142


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,041,764
Number of Sequences: 3902068
Number of extensions: 2041764
Number of successful extensions: 41101
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41095
Number of HSP's gapped (non-prelim): 6
length of query: 277
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 255
effective length of database: 17,147,199,772
effective search space: 4372535941860
effective search space used: 4372535941860
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)