ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart34d10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full... 549 e-153
2ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA 289 4e-75
3ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group... 289 4e-75
4ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group... 289 4e-75
5gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 289 4e-75
6dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for ... 289 4e-75
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 289 4e-75
8dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic D... 289 4e-75
9dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 4e-75
10dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 4e-75
11dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 4e-75
12gb|AY108449.1| Zea mays PCO131734 mRNA sequence 174 2e-40
13gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full... 127 4e-26
14dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffe... 127 4e-26
15ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group... 96 1e-16
16ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA 96 1e-16
17ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA 96 1e-16
18dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
19dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
20dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
21dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
22dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
23dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
24gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full ... 76 1e-10
25emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyl... 74 5e-10
26gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full ... 74 5e-10
27gb|AY104406.1| Zea mays PCO108855 mRNA sequence 74 5e-10
28gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase m... 74 5e-10
29gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methy... 74 5e-10
30gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-met... 74 5e-10
31gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-meth... 74 5e-10
32gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-m... 74 5e-10
33gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3... 74 5e-10
34gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3... 74 5e-10
35gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltr... 74 5e-10
36gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltra... 74 5e-10
37gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) ... 74 5e-10
38gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line)... 74 5e-10
39gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltran... 74 5e-10
40gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltra... 74 5e-10
41gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltran... 74 5e-10
42gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltran... 74 5e-10
43gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-met... 74 5e-10
44gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltrans... 74 5e-10
45gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-meth... 74 5e-10
46gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltrans... 74 5e-10
47gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltra... 74 5e-10
48gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltr... 74 5e-10
49gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltran... 74 5e-10
50gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltra... 74 5e-10
51gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methylt... 74 5e-10
52gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methylt... 74 5e-10
53gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltrans... 74 5e-10
54gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltrans... 74 5e-10
55gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltra... 74 5e-10
56gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltr... 74 5e-10
57gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltr... 74 5e-10
58gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltra... 74 5e-10
59gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltra... 74 5e-10
60gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltran... 74 5e-10
61gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltra... 74 5e-10
62gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltra... 74 5e-10
63gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 72 2e-09
64dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
65dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
66dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
67dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
68emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyl... 66 1e-07
69gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
70gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
71gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (... 66 1e-07
72gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferas... 66 1e-07
73gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (c... 66 1e-07
74gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransfera... 66 1e-07
75gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransf... 66 1e-07
76gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransfe... 66 1e-07
77gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
78gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase... 66 1e-07
79gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase... 66 1e-07
80gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (... 66 1e-07
81gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (... 66 1e-07
82gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (... 66 1e-07
83gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferas... 66 1e-07
84gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
85gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
86gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferas... 66 1e-07
87gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase... 66 1e-07
88gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase... 66 1e-07
89gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
90gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (c... 66 1e-07
91gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
92gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase ... 66 1e-07
93gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (... 66 1e-07
94gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransfer... 66 1e-07
95gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransf... 66 1e-07
96gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransfe... 66 1e-07
97gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltran... 66 1e-07
98gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyl... 66 1e-07
99gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransfe... 66 1e-07
100gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransfe... 66 1e-07
101gb|AY104670.1| Zea mays PCO117754 mRNA sequence 62 2e-06
102gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 54 5e-04
103dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
104dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O... 52 0.002
105gb|L22203.1|SLASADEN Stellaria longipes S-adenosyl-L-methionine:... 52 0.002
106dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 48 0.028
107gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.44
108gb|AF053553.1|AF053553 Mesembryanthemum crystallinum caffeoyl-Co... 44 0.44
109gb|AC113055.9| Mus musculus chromosome 5, clone RP23-251M20, com... 42 1.7
110ref|XM_520859.1| PREDICTED: Pan troglodytes similar to voltage-g... 42 1.7
111ref|NM_173092.1| Homo sapiens potassium voltage-gated channel, s... 42 1.7
112gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 1.7
113gb|AY706752.1| Oryctolagus cuniculus voltage-gated potassium cha... 42 1.7
114gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, comp... 42 1.7
115ref|NM_000238.2| Homo sapiens potassium voltage-gated channel, s... 42 1.7
116ref|NM_172057.1| Homo sapiens potassium voltage-gated channel, s... 42 1.7
117ref|NM_172056.1| Homo sapiens potassium voltage-gated channel, s... 42 1.7
118ref|NM_030779.2| Homo sapiens potassium voltage-gated channel, s... 42 1.7
119gb|BC001914.1| Homo sapiens potassium voltage-gated channel, sub... 42 1.7
120gb|AY520838.1| Homo sapiens KCNH2 gene, partial sequence 42 1.7
121gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, com... 42 1.7
122ref|NM_013569.1| Mus musculus potassium voltage-gated channel, s... 42 1.7
123gb|BC006334.2| Homo sapiens potassium voltage-gated channel, sub... 42 1.7
124gb|AY380055.1| Homo sapiens clone 3829 potassium channel HERG (K... 42 1.7
125gb|AY380054.1| Homo sapiens clone 3584 potassium channel HERG (K... 42 1.7
126gb|AY380053.1| Homo sapiens clone 2845 potassium channel HERG (K... 42 1.7
127gb|AY380052.1| Homo sapiens clone 2353 potassium channel HERG (K... 42 1.7
128gb|AY380051.1| Homo sapiens clone 1509 potassium channel HERG (K... 42 1.7
129gb|AY380050.1| Homo sapiens clone 1245 potassium channel HERG (K... 42 1.7
130gb|AY380044.1| Homo sapiens clone 3873 potassium channel HERG (K... 42 1.7
131gb|AY374424.1| Mus musculus potassium channel erg1a (Kcnh2) mRNA... 42 1.7
132gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543... 42 1.7
133gb|BC051016.1| Mus musculus potassium voltage-gated channel, sub... 42 1.7
134gb|BC080563.1| Homo sapiens cDNA clone IMAGE:6340663, **** WARNI... 42 1.7
135gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 42 1.7
136emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chr... 42 1.7
137emb|AJ632270.1| Actinoplanes teichomyceticus teicoplanin gene cl... 42 1.7
138emb|AJ605139.1| Actinoplanes teichomyceticus gene cluster for bi... 42 1.7
139gb|BT007336.1| Homo sapiens potassium voltage-gated channel, sub... 42 1.7
140emb|CR616390.1| full-length cDNA clone CS0DC025YD01 of Neuroblas... 42 1.7
141dbj|AK091877.1| Homo sapiens cDNA FLJ34558 fis, clone KIDNE20016... 42 1.7
142dbj|AK145127.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 42 1.7
143gb|AF363636.1|AF363636 Homo sapiens ether-a-go-go-related K+ cha... 42 1.7
144dbj|AB009071.2| Homo sapiens HERG gene, complete cds 42 1.7
145gb|AF311913.1|AF311913 Homo sapiens Eag-related gene member 2 (E... 42 1.7
146dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.7
147gb|AE004669.1| Pseudomonas aeruginosa PAO1, section 230 of 529 o... 42 1.7
148gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.7
149gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, ... 42 1.7
150emb|AJ609614.1| Homo sapiens mRNA for potassium voltage-gated ch... 42 1.7
151gb|AY889518.1| Synthetic construct Homo sapiens clone FLH015592.... 42 1.7
152emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in... 42 1.7
153emb|AJ010543.1|HSA010543 Homo sapiens herg gene, exon 7 42 1.7
154gb|AF012869.1|AF012869 Mus musculus potassium channel Merg1b (Me... 42 1.7
155gb|AF012868.1|AF012868 Mus musculus ether-a-go-go-related protei... 42 1.7
156gb|U75211.1|CPU75211 Cavia porcellus potassium channel protein E... 42 1.7
157emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 42 1.7
158gb|AF034762.1|AF034762 Mus musculus ERG B K+ channel isoform (ME... 42 1.7
159gb|U87513.1|OCU87513 Oryctolagus cuniculus ventricular ERG K+ ch... 42 1.7
160gb|U12891.1|PAU12891 Pseudomonas aeruginosa PAO substrain OT684 ... 42 1.7
161gb|U04270.1|HSU04270 Human putative potassium channel subunit (h... 42 1.7
162emb|AJ512214.1|HSA512214 Homo sapiens mRNA for potassium channel... 42 1.7
163dbj|AB044806.1| Homo sapiens HERG mRNA for HERG-USO, alternative... 42 1.7
164gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.8
165gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 6.8
166gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, co... 40 6.8
167gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome 40 6.8
168gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydro... 40 6.8
169gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide h... 40 6.8
170gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide h... 40 6.8
171gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide h... 40 6.8
172gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide h... 40 6.8
173gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide ... 40 6.8
174gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pestici... 40 6.8
175gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome ... 40 6.8
176gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone F... 40 6.8
177gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase... 40 6.8
178gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase... 40 6.8
179gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete... 40 6.8
180gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 6.8
181emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete ch... 40 6.8
182gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion se... 40 6.8
183gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.8
184gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 6.8
185emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin hea... 40 6.8
186emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 6.8
187emb|AL606608.3|OSJN00056 Oryza sativa genomic DNA, chromosome 4,... 40 6.8
188emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRN... 40 6.8
189gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence 40 6.8
190gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds 40 6.8
191gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds 40 6.8
192gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds 40 6.8
193gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.8
194gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, comp... 40 6.8
195gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydro... 40 6.8
196gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 6.8
197gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence 40 6.8
198dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
199gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds 40 6.8
200gb|AC132938.9| Homo sapiens chromosome 17, clone RP13-20L14, com... 40 6.8
201gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 o... 40 6.8
202gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical... 40 6.8
203gb|AC124287.10| Homo sapiens chromosome 17, clone RP13-991F5, co... 40 6.8
204dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 6.8
205dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.8
206dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
207emb|Y19223.3|TAQ19223 Thermus aquaticus rpoB gene for RNA polyme... 40 6.8
208ref|NM_207905.1| Eremothecium gossypii AAR011Cp (AAR011C), mRNA 40 6.8
209gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insectici... 40 6.8
210gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.8
211gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 6.8
212gb|U78289.1|SFU78289 Streptomyces fradiae tylactone synthase, st... 40 6.8
213gb|J01917.1|ADRCG Adenovirus type 2, complete genome 40 6.8
214gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete seq... 40 6.8
215gb|AY029773.1| Pseudomonas putida methyl parathion-degrading pro... 40 6.8
216dbj|AB070936.1| Streptomyces avermitilis siderophore biosyntheti... 40 6.8
217dbj|AB083789.1| Thermus thermophilus rpoB gene for DNA-directed ... 40 6.8 
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA
           sequence
          Length = 953

 Score =  549 bits (277), Expect = e-153
 Identities = 322/337 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcccgtctagacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaga 225
           |||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757

                                                                       
Query: 226 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 697

                                                                       
Query: 286 gggtgtcgaggtcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcg 345
           |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||
Sbjct: 696 gggtgtcgaggtcggacatgggggtgcccgccggcagcgccaccgtgccgccccagagcg 637

                                                                       
Query: 346 tgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagc 405
           |||||||||||||||| |||||||||||||| ||||||  ||||||||||||||||||||
Sbjct: 636 tgttgtcgtagatgatagtgccgccgacgcggaccagcttcagcagctgctcgtggtagc 577

                                                                       
Query: 406 gcacgtagttgggcttgtcggcgtccacgaacgcgaagtcgtagctggccgcgccatcgt 465
           ||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||
Sbjct: 576 gcacgtagttgggcttgtccgcgtccacgaacgcgaagtcgtagctcgccgcgccgtcgt 517

                                                
Query: 466 cctcggcgaggagctcctccaggcgctccaggccggt 502
           ||||| |||||||||| ||||||||| ||||||||||
Sbjct: 516 cctcgacgaggagctcgtccaggcgcgccaggccggt 480



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 73  aataatacaattgattaagggaagcggctggtaaggaa 110
           |||||||||||||||||||  |||||||||||||||||
Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
to top
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 996

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 646

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 645 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 586

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 585 ggcttgtccgcgtccacgaacgcgaagtcg 556
to top
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1096

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 653

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 652 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 593

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 592 ggcttgtccgcgtccacgaacgcgaagtcg 563
to top
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1098

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 655

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 654 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 595

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 594 ggcttgtccgcgtccacgaacgcgaagtcg 565
to top
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA20) gene, complete cds
          Length = 1158

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                        
Query: 177  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
            |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 1054 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 995

                                                                        
Query: 237  gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
            ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 994  gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 935

                                                                        
Query: 297  tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
            || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 934  tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 875

                                                                        
Query: 357  atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
            | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 874  acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 815

                                          
Query: 417  ggcttgtcggcgtccacgaacgcgaagtcg 446
            |||||||| |||||||||||||||||||||
Sbjct: 814  ggcttgtccgcgtccacgaacgcgaagtcg 785
to top
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA
           3-O-methyltransferase, complete cds, clone: 12FPR057
          Length = 976

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 802 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 743

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 742 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 683

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 682 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 623

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 622 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 563

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 562 ggcttgtccgcgtccacgaacgcgaagtcg 533
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Plus

                                                                            
Query: 177      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
                |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 24579635 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 24579694

                                                                            
Query: 237      gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
                ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 24579695 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 24579754

                                                                            
Query: 297      tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
                || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 24579755 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 24579814

                                                                            
Query: 357      atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
                | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 24579815 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 24579874

                                              
Query: 417      ggcttgtcggcgtccacgaacgcgaagtcg 446
                |||||||| |||||||||||||||||||||
Sbjct: 24579875 ggcttgtccgcgtccacgaacgcgaagtcg 24579904



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Plus

                                                                            
Query: 320      cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
                ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 24586412 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 24586471

                                                                            
Query: 380      cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
                ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 24586472 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 24586530

                        
Query: 439      cgaagtcg 446
                ||||||||
Sbjct: 24586531 cgaagtcg 24586538



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 365      gccgccgacgcgcaccagccgcagcagctgctcgtggta 403
                |||||||||||||| |||||||| |||| ||||||||||
Sbjct: 24590859 gccgccgacgcgcagcagccgcaccagccgctcgtggta 24590897



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                            
Query: 177      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
                |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 24586269 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 24586328

                                         
Query: 237      gggtcggcggcgagcttggcgttga 261
                |||||| |||||| |||||||||||
Sbjct: 24586329 gggtcgccggcgatcttggcgttga 24586353



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                            
Query: 182      gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 241
                ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732

                                    
Query: 242      ggcggcgagcttggcgttga 261
                |||||||| | |||||||||
Sbjct: 24590733 ggcggcgaccatggcgttga 24590752
to top
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0026F07
          Length = 137354

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Plus

                                                                         
Query: 177   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
             |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 87895 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 87954

                                                                         
Query: 237   gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
             ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 87955 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 88014

                                                                         
Query: 297   tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
             || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 88015 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 88074

                                                                         
Query: 357   atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
             | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 88075 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 88134

                                           
Query: 417   ggcttgtcggcgtccacgaacgcgaagtcg 446
             |||||||| |||||||||||||||||||||
Sbjct: 88135 ggcttgtccgcgtccacgaacgcgaagtcg 88164



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Plus

                                                                         
Query: 320   cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
             ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 94672 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 94731

                                                                         
Query: 380   cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
             ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 94732 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 94790

                     
Query: 439   cgaagtcg 446
             ||||||||
Sbjct: 94791 cgaagtcg 94798



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 365   gccgccgacgcgcaccagccgcagcagctgctcgtggta 403
             |||||||||||||| |||||||| |||| ||||||||||
Sbjct: 99119 gccgccgacgcgcagcagccgcaccagccgctcgtggta 99157



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                         
Query: 177   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
             |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 94529 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 94588

                                      
Query: 237   gggtcggcggcgagcttggcgttga 261
             |||||| |||||| |||||||||||
Sbjct: 94589 gggtcgccggcgatcttggcgttga 94613



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                         
Query: 182   gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 241
             ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992

                                 
Query: 242   ggcggcgagcttggcgttga 261
             |||||||| | |||||||||
Sbjct: 98993 ggcggcgaccatggcgttga 99012
to top
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full
           insert sequence
          Length = 1096

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 653

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 652 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 593

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 592 ggcttgtccgcgtccacgaacgcgaagtcg 563
to top
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full
           insert sequence
          Length = 996

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 646

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 645 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 586

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 585 ggcttgtccgcgtccacgaacgcgaagtcg 556
to top
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full
           insert sequence
          Length = 1098

 Score =  289 bits (146), Expect = 4e-75
 Identities = 239/270 (88%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                                                       
Query: 237 gggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 296
           ||||||||||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715

                                                                       
Query: 297 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgtag 356
           || ||||  |||||| ||| ||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgtac 655

                                                                       
Query: 357 atgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagttg 416
           | ||||   |||||||||||||||||| |||||||||||||||||||    |||||||||
Sbjct: 654 acgatgtgcccgccgacgcgcaccagctgcagcagctgctcgtggtacttgacgtagttg 595

                                         
Query: 417 ggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||| |||||||||||||||||||||
Sbjct: 594 ggcttgtccgcgtccacgaacgcgaagtcg 565
to top
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence
          Length = 1072

 Score =  174 bits (88), Expect = 2e-40
 Identities = 226/272 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgc 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgacgc 763

                                                                       
Query: 235 gcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcga 294
           | || ||    |  |||  | ||||||| ||||||| |||||||||||| | |  |||||
Sbjct: 762 ggggatcctgagaaagccggacgttgagttccctgatggcggcggagaacctgcggtcga 703

                                                                       
Query: 295 ggtcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgt 354
           |||||   |  |||| | | |  || |||||||| || ||| |||| |||||||||||||
Sbjct: 702 ggtcgctgagcggcgcgtcggggggaagcgccacagtaccggcccacagcgtgttgtcgt 643

                                                                       
Query: 355 agatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtggtagcgcacgtagt 414
           | | || ||| || |||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 642 acacgacggtacccccgacgcgcaccaggcggagcagctgctcgtggtaccggacgtagt 583

                                           
Query: 415 tgggcttgtcggcgtccacgaacgcgaagtcg 446
           | ||||||| |||||| ||||| |||||||||
Sbjct: 582 taggcttgtgggcgtcgacgaaggcgaagtcg 551
to top
>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA
           sequence
          Length = 1018

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 324 gccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagc 383
           ||||| |||||||||||||||||||||||||||  ||    ||||||||||||||| |||
Sbjct: 649 gccacggtgccgccccagagcgtgttgtcgtaggcgagcacgccgccgacgcgcacgagc 590

                                                                       
Query: 384 cgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaag 443
           |||||||||||||||||||||    ||||||||  |||||||||||||||||| ||||||
Sbjct: 589 cgcagcagctgctcgtggtagttgccgtagttgtacttgtcggcgtccacgaaggcgaag 530

                   
Query: 444 tcgtagct 451
           ||| ||||
Sbjct: 529 tcgaagct 522



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           ||||||||||||||||  |||| ||| |||||||| | ||||||   |   |||| ||||
Sbjct: 796 acgacgcggcggcagagcgtgatgccatcggcgatagggagctgcacggggtcgacgcgc 737

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           | ||||||||||| | |||||||||
Sbjct: 736 gtgtcggcggcgatcatggcgttga 712
to top
>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA
           O-methyltransferase, partial cds
          Length = 875

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 324 gccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagc 383
           ||||| |||||||||||||||||||||||||||  ||    ||||||||||||||| |||
Sbjct: 641 gccacggtgccgccccagagcgtgttgtcgtaggcgagcacgccgccgacgcgcacgagc 582

                                                                       
Query: 384 cgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaag 443
           |||||||||||||||||||||    ||||||||  |||||||||||||||||| ||||||
Sbjct: 581 cgcagcagctgctcgtggtagttgccgtagttgtacttgtcggcgtccacgaaggcgaag 522

                   
Query: 444 tcgtagct 451
           ||| ||||
Sbjct: 521 tcgaagct 514



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           ||||||||||||||||  |||| ||| |||||||| | ||||||   |   |||| ||||
Sbjct: 788 acgacgcggcggcagagcgtgatgccatcggcgatagggagctgcacggggtcgacgcgc 729

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           | ||||||||||| | |||||||||
Sbjct: 728 gtgtcggcggcgatcatggcgttga 704
to top
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2
           mRNA
          Length = 1149

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Minus

                                                                       
Query: 320 cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
           ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 741

                                                                       
Query: 380 cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
           ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 740 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 682

                   
Query: 439 cgaagtcg 446
           ||||||||
Sbjct: 681 cgaagtcg 674



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859
to top
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Minus

                                                                       
Query: 320 cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
           ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 465 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 406

                                                                       
Query: 380 cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
           ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 405 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 347

                   
Query: 439 cgaagtcg 446
           ||||||||
Sbjct: 346 cgaagtcg 339



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 608 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 549

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           |||||| |||||| |||||||||||
Sbjct: 548 gggtcgccggcgatcttggcgttga 524
to top
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 879

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Minus

                                                                       
Query: 320 cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
           ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 732 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 673

                                                                       
Query: 380 cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
           ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 672 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 614

                   
Query: 439 cgaagtcg 446
           ||||||||
Sbjct: 613 cgaagtcg 606



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 875 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 816

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           |||||| |||||| |||||||||||
Sbjct: 815 gggtcgccggcgatcttggcgttga 791
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Plus

                                                                            
Query: 323      cgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccag 382
                |||||||| ||||||||| |||||||||||||||  ||||  ||||||||| |  |||||
Sbjct: 18420679 cgccaccgagccgccccacagcgtgttgtcgtaggcgatgaggccgccgaccctgaccag 18420738

                                                                            
Query: 383      ccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaa 442
                | |||||||| ||||||||||||  | | ||||   |||||| |||||||||||||||||
Sbjct: 18420739 ctgcagcagccgctcgtggtagccgaggaagttcaccttgtccgcgtccacgaacgcgaa 18420798

                    
Query: 443      gtcg 446
                ||||
Sbjct: 18420799 gtcg 18420802



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 180      acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 223
                |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 466      cctcggcgaggagctcctcc 485
                ||||||||||||||||||||
Sbjct: 21921955 cctcggcgaggagctcctcc 21921974
to top
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463G11
          Length = 154188

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Plus

                                                                          
Query: 323    cgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccag 382
              |||||||| ||||||||| |||||||||||||||  ||||  ||||||||| |  |||||
Sbjct: 135415 cgccaccgagccgccccacagcgtgttgtcgtaggcgatgaggccgccgaccctgaccag 135474

                                                                          
Query: 383    ccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaa 442
              | |||||||| ||||||||||||  | | ||||   |||||| |||||||||||||||||
Sbjct: 135475 ctgcagcagccgctcgtggtagccgaggaagttcaccttgtccgcgtccacgaacgcgaa 135534

                  
Query: 443    gtcg 446
              ||||
Sbjct: 135535 gtcg 135538



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 180    acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 223
              |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303
to top
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0463D04
          Length = 145828

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Plus

                                                                         
Query: 323   cgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccag 382
             |||||||| ||||||||| |||||||||||||||  ||||  ||||||||| |  |||||
Sbjct: 82553 cgccaccgagccgccccacagcgtgttgtcgtaggcgatgaggccgccgaccctgaccag 82612

                                                                         
Query: 383   ccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaa 442
             | |||||||| ||||||||||||  | | ||||   |||||| |||||||||||||||||
Sbjct: 82613 ctgcagcagccgctcgtggtagccgaggaagttcaccttgtccgcgtccacgaacgcgaa 82672

                 
Query: 443   gtcg 446
             ||||
Sbjct: 82673 gtcg 82676



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 180   acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 223
             |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441
to top
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full
           insert sequence
          Length = 959

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 cgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccag 382
           |||||||| ||||||||| |||||||||||||||  ||||  ||||||||| |  |||||
Sbjct: 662 cgccaccgagccgccccacagcgtgttgtcgtaggcgatgaggccgccgaccctgaccag 603

                                                                       
Query: 383 ccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaa 442
           | |||||||| ||||||||||||  | | ||||   |||||| |||||||||||||||||
Sbjct: 602 ctgcagcagccgctcgtggtagccgaggaagttcaccttgtccgcgtccacgaacgcgaa 543

               
Query: 443 gtcg 446
           ||||
Sbjct: 542 gtcg 539



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 180 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 223
           |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774
to top
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full
           insert sequence
          Length = 1466

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Minus

                                                                       
Query: 320 cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
           ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 953 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 894

                                                                       
Query: 380 cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
           ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 893 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 835

                   
Query: 439 cgaagtcg 446
           ||||||||
Sbjct: 834 cgaagtcg 827



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                        
Query: 177  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
            |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 1096 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 1037

                                     
Query: 237  gggtcggcggcgagcttggcgttga 261
            |||||| |||||| |||||||||||
Sbjct: 1036 gggtcgccggcgatcttggcgttga 1012
to top
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full
           insert sequence
          Length = 1149

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/128 (85%), Gaps = 2/128 (1%)
 Strand = Plus / Minus

                                                                       
Query: 320 cagcgccaccgtgccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcac 379
           ||||||||| |  ||||||||||||||||||||||||   |    ||||||| |||||||
Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtaggccagcacgccgccggcgcgcac 741

                                                                       
Query: 380 cagccgcagcagctgctcgtggta-gcgcacgtagttgggcttgtcggcgtccacgaacg 438
           ||||||||||||| ||||||||||  ||| |||||||   ||||||||||||||||||||
Sbjct: 740 cagccgcagcagccgctcgtggtactcgc-cgtagttccccttgtcggcgtccacgaacg 682

                   
Query: 439 cgaagtcg 446
           ||||||||
Sbjct: 681 cgaagtcg 674



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 177 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 236
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 237 gggtcggcggcgagcttggcgttga 261
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859
to top
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA
           sequence
          Length = 1078

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 181 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 240
           |||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||| |||
Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815

                     
Query: 241 cggcggcgag 250
           ||||||||||
Sbjct: 814 cggcggcgag 805



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 410 gtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||  ||||||||||||||||||  ||||||||
Sbjct: 645 gtagttgtccttgtcggcgtccacgaagacgaagtcg 609
to top
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1136 BP
          Length = 1136

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 179 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 859 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800

                        
Query: 239 gtcggcggcgagc 251
           |||||||||||||
Sbjct: 799 gtcggcggcgagc 787



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
           |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 661 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 602

                     
Query: 437 cgcgaagtcg 446
             ||||||||
Sbjct: 601 gacgaagtcg 592
to top
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA
           sequence
          Length = 1118

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 179 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 860 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 801

                        
Query: 239 gtcggcggcgagc 251
           |||||||||||||
Sbjct: 800 gtcggcggcgagc 788



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
           |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 662 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 603

                     
Query: 437 cgcgaagtcg 446
             ||||||||
Sbjct: 602 gacgaagtcg 593
to top
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence
          Length = 1146

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 179 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 865 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 806

                        
Query: 239 gtcggcggcgagc 251
           |||||||||||||
Sbjct: 805 gtcggcggcgagc 793



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
           |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 667 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 608

                     
Query: 437 cgcgaagtcg 446
             ||||||||
Sbjct: 607 gacgaagtcg 598
to top
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds
          Length = 607

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 183 cggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcg 242
           |||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| ||||||
Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302

                    
Query: 243 gcggcgagc 251
            ||||||||
Sbjct: 301 acggcgagc 293



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 410 gtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||  |||||| |||||||||||| ||||||||
Sbjct: 134 gtagttgtccttgtccgcgtccacgaacacgaagtcg 98
to top
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1320

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1294 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1235

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1234 gtcggcggcgagc 1222



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1096 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1037

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1036 gacgaagtcg 1027
to top
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1082 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1023

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1022 gacgaagtcg 1013
to top
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1308

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1222 gtcggcggcgagc 1210



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1084 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1025

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1024 gacgaagtcg 1015
to top
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1228 gtcggcggcgagc 1216



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1090 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1031

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1030 gacgaagtcg 1021
to top
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1087 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1028

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1027 gacgaagtcg 1018
to top
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1085 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1026

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1025 gacgaagtcg 1016
to top
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1087 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1028

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1027 gacgaagtcg 1018
to top
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1082 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1023

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1022 gacgaagtcg 1013
to top
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1087 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1028

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1027 gacgaagtcg 1018
to top
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1085 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1026

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1025 gacgaagtcg 1016
to top
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1228 gtcggcggcgagc 1216



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1090 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1031

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1030 gacgaagtcg 1021
to top
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1087 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1028

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1027 gacgaagtcg 1018
to top
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1537

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1549

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1087 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1028

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1027 gacgaagtcg 1018
to top
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1544

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1082 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1023

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1022 gacgaagtcg 1013
to top
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1546

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1222 gtcggcggcgagc 1210



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1084 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1025

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1024 gacgaagtcg 1015
to top
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1537

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1273 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1214

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1213 gtcggcggcgagc 1201



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1075 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1016

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1015 gacgaagtcg 1006
to top
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1074 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1015

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1014 gacgaagtcg 1005
to top
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1082 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1023

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1022 gacgaagtcg 1013
to top
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1085 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1026

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1025 gacgaagtcg 1016
to top
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 377  caccagccgcagcagctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaa 436
            |||||||  ||||||| |||||||||||   | |||||||  ||||||||||||||||||
Sbjct: 1082 caccagcttcagcagccgctcgtggtagttgaggtagttgtccttgtcggcgtccacgaa 1023

                      
Query: 437  cgcgaagtcg 446
              ||||||||
Sbjct: 1022 gacgaagtcg 1013
to top
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA1) gene, complete cds
          Length = 1272

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 1166 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 1107

                        
Query: 239  gtcggcggcgag 250
            ||||||||||||
Sbjct: 1106 gtcggcggcgag 1095



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                        
Query: 338  ccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctc 397
            |||||||||||||||||||  || |  |||||||||    ||||||  || |||| ||||
Sbjct: 1007 ccagagcgtgttgtcgtagccgacgaggccgccgaccttgaccagcttcatcagccgctc 948

                                                             
Query: 398  gtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            |||||||   | |||||||  |||||||||||| |||||| ||||||||
Sbjct: 947  gtggtagttgaggtagttgtccttgtcggcgtcgacgaacacgaagtcg 899
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                           
Query: 179     gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
               |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 3314239 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 3314180

                           
Query: 239     gtcggcggcgag 250
               ||||||||||||
Sbjct: 3314179 gtcggcggcgag 3314168



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                           
Query: 338     ccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctc 397
               |||||||||||||||||||  || |  |||||||||    ||||||  || |||| ||||
Sbjct: 3314080 ccagagcgtgttgtcgtagccgacgaggccgccgaccttgaccagcttcatcagccgctc 3314021

                                                                
Query: 398     gtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
               |||||||   | |||||||  |||||||||||| |||||| ||||||||
Sbjct: 3314020 gtggtagttgaggtagttgtccttgtcggcgtcgacgaacacgaagtcg 3313972
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0015I14
          Length = 150650

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                          
Query: 179    gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
              |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 101602 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 101543

                          
Query: 239    gtcggcggcgag 250
              ||||||||||||
Sbjct: 101542 gtcggcggcgag 101531



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                          
Query: 338    ccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctc 397
              |||||||||||||||||||  || |  |||||||||    ||||||  || |||| ||||
Sbjct: 101443 ccagagcgtgttgtcgtagccgacgaggccgccgaccttgaccagcttcatcagccgctc 101384

                                                               
Query: 398    gtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
              |||||||   | |||||||  |||||||||||| |||||| ||||||||
Sbjct: 101383 gtggtagttgaggtagttgtccttgtcggcgtcgacgaacacgaagtcg 101335
to top
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone P0680A03
          Length = 156054

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 5793 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 5734

                        
Query: 239  gtcggcggcgag 250
            ||||||||||||
Sbjct: 5733 gtcggcggcgag 5722



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                        
Query: 338  ccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctc 397
            |||||||||||||||||||  || |  |||||||||    ||||||  || |||| ||||
Sbjct: 5634 ccagagcgtgttgtcgtagccgacgaggccgccgaccttgaccagcttcatcagccgctc 5575

                                                             
Query: 398  gtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            |||||||   | |||||||  |||||||||||| |||||| ||||||||
Sbjct: 5574 gtggtagttgaggtagttgtccttgtcggcgtcgacgaacacgaagtcg 5526
to top
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full
           insert sequence
          Length = 1052

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 179 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
           |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 847 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 788

                       
Query: 239 gtcggcggcgag 250
           ||||||||||||
Sbjct: 787 gtcggcggcgag 776



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                       
Query: 338 ccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctc 397
           |||||||||||||||||||  || |  |||||||||    ||||||  || |||| ||||
Sbjct: 688 ccagagcgtgttgtcgtagccgacgaggccgccgaccttgaccagcttcatcagccgctc 629

                                                            
Query: 398 gtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||||||   | |||||||  |||||||||||| |||||| ||||||||
Sbjct: 628 gtggtagttgaggtagttgtccttgtcggcgtcgacgaacacgaagtcg 580
to top
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1167 BP
          Length = 1167

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 179 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
           ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 859 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800

                        
Query: 239 gtcggcggcgagc 251
           |||||||||||||
Sbjct: 799 gtcggcggcgagc 787



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 696 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 637

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||   | |||||||  |||||||||||||||||| |||||||||
Sbjct: 636 tagttgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 592
to top
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 981 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 922

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 921 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 877
to top
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 967 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 908

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||   | |||||||  |||||||||||||||||| |||||||||
Sbjct: 907 tagttgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 863
to top
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 981 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 922

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 921 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 877
to top
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1086 gtcggcggcgagc 1074



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 983 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 924

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 923 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 879
to top
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1145

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1139 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1080

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1079 gtcggcggcgagc 1067



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 976 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 917

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 916 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 872
to top
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 981 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 922

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 921 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 877
to top
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1222

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 993 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 934

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 933 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 889
to top
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1209

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 993 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 934

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 933 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 889
to top
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 967 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 908

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||   | |||||||  |||||||||||||||||| |||||||||
Sbjct: 907 tagttgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 863
to top
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 967 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 908

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||   | |||||||  |||||||||||||||||| |||||||||
Sbjct: 907 tagttgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 863
to top
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1086 gtcggcggcgagc 1074



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 983 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 924

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 923 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 879
to top
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1438

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1162 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1103

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1102 gtcggcggcgagc 1090



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 999 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 940

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 939 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 895
to top
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1451

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1169 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1110

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1109 gtcggcggcgagc 1097



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1006 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 947

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 946  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 902
to top
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1442

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1444

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1463

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1122 gtcggcggcgagc 1110



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1019 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 960

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 959  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 915
to top
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1464

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1122 gtcggcggcgagc 1110



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1019 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 960

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 959  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 915
to top
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1434

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1152 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1093

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1092 gtcggcggcgagc 1080



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 989 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 930

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 929 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 885
to top
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 981 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 922

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 921 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 877
to top
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 981 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 922

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 921 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 877
to top
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 967 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 908

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 907 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 863
to top
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1153

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1147 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1088

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1087 gtcggcggcgagc 1075



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 984 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 925

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 924 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 880
to top
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1182

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1176 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1117

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1116 gtcggcggcgagc 1104



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1013 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 954

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 953  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 909
to top
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1206

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 993 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 934

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 933 tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 889
to top
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase
            (ccoaomt2) gene, complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1003 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 944

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 943  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 899
to top
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 342 agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
           |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 967 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 908

                                                        
Query: 402 tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           |||   | |||||||  |||||||||||||||||| |||||||||
Sbjct: 907 tagttgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 863
to top
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1451

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 179  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 238
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1173 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1114

                         
Query: 239  gtcggcggcgagc 251
            |||||||||||||
Sbjct: 1113 gtcggcggcgagc 1101



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 342  agcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcagctgctcgtgg 401
            |||||||||||||||  ||||  |||||||   | |||||||  ||| ||| ||||||||
Sbjct: 1010 agcgtgttgtcgtagccgatgaggccgccgggcctcaccagcttcaggagccgctcgtgg 951

                                                         
Query: 402  tagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
            ||||  | |||||||  |||||||||||||||||| |||||||||
Sbjct: 950  tagctgaggtagttgtccttgtcggcgtccacgaaggcgaagtcg 906
to top
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence
          Length = 976

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 gccgccccagagcgtgttgtcgtagatgatggtgccgccgacgcgcaccagccgcagcag 391
           ||||||||| |||||||||||||||  ||||  ||| ||||| |  | |||| |||||||
Sbjct: 624 gccgccccacagcgtgttgtcgtaggcgatgaggcccccgaccctgagcagctgcagcag 565

                                                                  
Query: 392 ctgctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcg 446
           | |||||||||||   | | ||||   |||||| |||||||||||||||||||||
Sbjct: 564 ccgctcgtggtagttgaggaagttcaccttgtccgcgtccacgaacgcgaagtcg 510



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 178 cgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagac 226
           ||||||||||||| |  ||||  |||||||||||||||| |||||||||
Sbjct: 778 cgacgcggcggcacagcgtgagcccgtcggcgatggcgacctggcagac 730
to top
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
           O-methyltransferase (COA26) gene, complete cds
          Length = 1116

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 365 gccgccgacgcgcaccagccgcagcagctgctcgtggta 403
           |||||||||||||| |||||||| |||| ||||||||||
Sbjct: 821 gccgccgacgcgcagcagccgcaccagccgctcgtggta 783



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 182  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 241
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948

                                
Query: 242  ggcggcgagcttggcgttga 261
            |||||||| | |||||||||
Sbjct: 947  ggcggcgaccatggcgttga 928
to top
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full
            insert sequence
          Length = 1895

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 365  gccgccgacgcgcaccagccgcagcagctgctcgtggta 403
            |||||||||||||| |||||||| |||| ||||||||||
Sbjct: 1485 gccgccgacgcgcagcagccgcaccagccgctcgtggta 1447



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 182  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 241
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612

                                
Query: 242  ggcggcgagcttggcgttga 261
            |||||||| | |||||||||
Sbjct: 1611 ggcggcgaccatggcgttga 1592
to top
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase,
           partial cds
          Length = 622

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 181 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 240
           ||||||||||||  |||| ||||||| ||| || ||||||||||| ||||| |||   ||
Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcggtcgt 328

                     
Query: 241 cggcggcgag 250
           ||||||||||
Sbjct: 327 cggcggcgag 318
to top
>gb|L22203.1|SLASADEN Stellaria longipes S-adenosyl-L-methionine:trans-caffeoyl-CoA
           3-O-methyltransferase mRNA, complete cds
          Length = 1013

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 395 ctcgtggtagcgcacgtagttgggcttgtcggcgtccacgaacgcgaagtcgta 448
           ||||||||||  |||||||||||  ||||| ||||||||||| || ||||||||
Sbjct: 524 ctcgtggtagttcacgtagttggttttgtcagcgtccacgaaggcaaagtcgta 471
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 224     gacctcgatgcgcgggtcggcggc 247
               ||||||||||||||||||||||||
Sbjct: 4035540 gacctcgatgcgcgggtcggcggc 4035517
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 240     tcggcggcgagcttggcgttga 261
               ||||||||||||||||||||||
Sbjct: 4580941 tcggcggcgagcttggcgttga 4580920



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 314     cgccggcagcgccaccgtgc 333
               ||||||||||||||||||||
Sbjct: 2819105 cgccggcagcgccaccgtgc 2819124
to top
>gb|AF053553.1|AF053553 Mesembryanthemum crystallinum caffeoyl-CoA O-methyltransferase
           mRNA, complete cds
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 409 cgtagttgggcttgtcggcgtccacgaacgcgaa 442
           ||||||||  |||||||||||||||||| |||||
Sbjct: 593 cgtagttgtccttgtcggcgtccacgaatgcgaa 560
to top
>gb|AC113055.9| Mus musculus chromosome 5, clone RP23-251M20, complete sequence
          Length = 185733

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    acgcgcaccagccgcagcagc 392
              |||||||||||||||||||||
Sbjct: 100217 acgcgcaccagccgcagcagc 100197
to top
>ref|XM_520859.1| PREDICTED: Pan troglodytes similar to voltage-gated potassium
           channel, subfamily H, member 2 isoform b; potassium
           voltage-gated channel, subfamily H, member 2;
           ether-a-go-go-related potassium channel protein; human
           eag-related gene (LOC465411), mRNA
          Length = 715

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 354 acgcgcaccagccgcagcagc 334
to top
>ref|NM_173092.1| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 6 (KCNH6), transcript variant 2,
            mRNA
          Length = 3017

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1237 acgcgcaccagccgcagcagc 1217
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 333    ccgccccagagcgtgttgtcg 353
              |||||||||||||||||||||
Sbjct: 124109 ccgccccagagcgtgttgtcg 124129
to top
>gb|AY706752.1| Oryctolagus cuniculus voltage-gated potassium channel 11.1 (Kv11.1)
           mRNA, partial cds
          Length = 373

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 312 acgcgcaccagccgcagcagc 292
to top
>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence
          Length = 181369

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   acgcgcaccagccgcagcagc 392
             |||||||||||||||||||||
Sbjct: 52353 acgcgcaccagccgcagcagc 52373
to top
>ref|NM_000238.2| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 2 (KCNH2), transcript variant 1,
            mRNA
          Length = 3900

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1617 acgcgcaccagccgcagcagc 1597
to top
>ref|NM_172057.1| Homo sapiens potassium voltage-gated channel, subfamily H
           (eag-related), member 2 (KCNH2), transcript variant 3,
           mRNA
          Length = 3191

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 908 acgcgcaccagccgcagcagc 888
to top
>ref|NM_172056.1| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 2 (KCNH2), transcript variant 2,
            mRNA
          Length = 3164

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1617 acgcgcaccagccgcagcagc 1597
to top
>ref|NM_030779.2| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 6 (KCNH6), transcript variant 1,
            mRNA
          Length = 3421

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1237 acgcgcaccagccgcagcagc 1217
to top
>gb|BC001914.1| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 2, mRNA (cDNA clone IMAGE:3510423),
            partial cds
          Length = 2819

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1261 acgcgcaccagccgcagcagc 1241
to top
>gb|AY520838.1| Homo sapiens KCNH2 gene, partial sequence
          Length = 222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 137 acgcgcaccagccgcagcagc 157
to top
>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence
          Length = 179509

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   acgcgcaccagccgcagcagc 392
             |||||||||||||||||||||
Sbjct: 70021 acgcgcaccagccgcagcagc 70041
to top
>ref|NM_013569.1| Mus musculus potassium voltage-gated channel, subfamily H
            (eag-related), member 2 (Kcnh2), mRNA
          Length = 4235

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1937 acgcgcaccagccgcagcagc 1917
to top
>gb|BC006334.2| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 6, mRNA (cDNA clone MGC:13157
            IMAGE:4303609), complete cds
          Length = 1741

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1215 acgcgcaccagccgcagcagc 1195
to top
>gb|AY380055.1| Homo sapiens clone 3829 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 236

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380054.1| Homo sapiens clone 3584 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 238

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380053.1| Homo sapiens clone 2845 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 237

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380052.1| Homo sapiens clone 2353 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 237

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380051.1| Homo sapiens clone 1509 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 237

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380050.1| Homo sapiens clone 1245 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 236

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 85  acgcgcaccagccgcagcagc 65
to top
>gb|AY380044.1| Homo sapiens clone 3873 potassium channel HERG (KCNH2) gene, exon 7
           and partial cds
          Length = 238

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 86  acgcgcaccagccgcagcagc 66
to top
>gb|AY374424.1| Mus musculus potassium channel erg1a (Kcnh2) mRNA, complete cds
          Length = 3499

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1616 acgcgcaccagccgcagcagc 1596
to top
>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b
           gene, partial cds; mitochondrial
          Length = 800

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 65  cagggaaaaataatacaattg 85
           |||||||||||||||||||||
Sbjct: 742 cagggaaaaataatacaattg 722
to top
>gb|BC051016.1| Mus musculus potassium voltage-gated channel, subfamily H
            (eag-related), member 2, mRNA (cDNA clone IMAGE:6309545),
            partial cds
          Length = 3504

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1762 acgcgcaccagccgcagcagc 1742
to top
>gb|BC080563.1| Homo sapiens cDNA clone IMAGE:6340663, **** WARNING: chimeric clone
           ****
          Length = 2783

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 909 acgcgcaccagccgcagcagc 889
to top
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 243    gcggcgagcttggcgttgagg 263
              |||||||||||||||||||||
Sbjct: 363316 gcggcgagcttggcgttgagg 363296
to top
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the
             5' end of the APG5L gene for APG5 autophagy 5-like (S.
             cerevisiae) and a CpG island, complete sequence
          Length = 34768

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     aaaaaagtattattgaaaact 28
             |||||||||||||||||||||
Sbjct: 11155 aaaaaagtattattgaaaact 11175
to top
>emb|AJ632270.1| Actinoplanes teichomyceticus teicoplanin gene cluster
          Length = 89976

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 427  cgtccacgaacgcgaagtcgt 447
            |||||||||||||||||||||
Sbjct: 7709 cgtccacgaacgcgaagtcgt 7689
to top
>emb|AJ605139.1| Actinoplanes teichomyceticus gene cluster for biosynthesis of
             glycopeptide antibiotic teicoplanin
          Length = 89713

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 427   cgtccacgaacgcgaagtcgt 447
             |||||||||||||||||||||
Sbjct: 14316 cgtccacgaacgcgaagtcgt 14296
to top
>gb|BT007336.1| Homo sapiens potassium voltage-gated channel, subfamily H
            (eag-related), member 2 mRNA, complete cds
          Length = 2319

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1256 acgcgcaccagccgcagcagc 1236
to top
>emb|CR616390.1| full-length cDNA clone CS0DC025YD01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1767

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 891 acgcgcaccagccgcagcagc 871
to top
>dbj|AK091877.1| Homo sapiens cDNA FLJ34558 fis, clone KIDNE2001636, highly similar to
            Rattus norvegicus potassium channel (erg2) mRNA
          Length = 3017

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1237 acgcgcaccagccgcagcagc 1217
to top
>dbj|AK145127.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830048L19
           product:Warning: possibly chimeric clone, full insert
           sequence
          Length = 3979

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 907 acgcgcaccagccgcagcagc 887
to top
>gb|AF363636.1|AF363636 Homo sapiens ether-a-go-go-related K+ channel protein (KCNH2) mRNA,
            complete cds
          Length = 3480

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1604 acgcgcaccagccgcagcagc 1584
to top
>dbj|AB009071.2| Homo sapiens HERG gene, complete cds
          Length = 6290

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 2811 acgcgcaccagccgcagcagc 2791
to top
>gb|AF311913.1|AF311913 Homo sapiens Eag-related gene member 2 (ERG2) mRNA, complete cds
          Length = 3352

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1168 acgcgcaccagccgcagcagc 1148
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 379    ccagccgcagcagctgctcgt 399
              |||||||||||||||||||||
Sbjct: 401238 ccagccgcagcagctgctcgt 401218



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 228     tcgatgcgcgggtcggcggcgagc 251
               |||| |||||||||||||||||||
Sbjct: 6387054 tcgaagcgcgggtcggcggcgagc 6387077
to top
>gb|AE004669.1| Pseudomonas aeruginosa PAO1, section 230 of 529 of the complete genome
          Length = 22444

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 457   cgccatcgtcctcggcgagga 477
             |||||||||||||||||||||
Sbjct: 22270 cgccatcgtcctcggcgagga 22290
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 365     gccgccgacgcgcaccagccgcagc 389
               ||||||| |||||||||||||||||
Sbjct: 4538052 gccgccgccgcgcaccagccgcagc 4538028
to top
>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence
          Length = 124877

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   acgcgcaccagccgcagcagc 392
             |||||||||||||||||||||
Sbjct: 14821 acgcgcaccagccgcagcagc 14801
to top
>emb|AJ609614.1| Homo sapiens mRNA for potassium voltage-gated channel, subfamily H
           (eag-related), member 2, putative transcript variant 4,
           (KCNH2 gene)
          Length = 2123

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 584 acgcgcaccagccgcagcagc 564
to top
>gb|AY889518.1| Synthetic construct Homo sapiens clone FLH015592.01X potassium
            voltage-gated channel subfamily H member 2 (KCNH2) mRNA,
            complete cds
          Length = 2319

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1256 acgcgcaccagccgcagcagc 1236
to top
>emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in linkage group 25,
             complete sequence
          Length = 189554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 322   gcgccaccgtgccgccccaga 342
             |||||||||||||||||||||
Sbjct: 13517 gcgccaccgtgccgccccaga 13537
to top
>emb|AJ010543.1|HSA010543 Homo sapiens herg gene, exon 7
          Length = 488

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 97  acgcgcaccagccgcagcagc 77
to top
>gb|AF012869.1|AF012869 Mus musculus potassium channel Merg1b (Merg1) mRNA, complete cds
          Length = 3150

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 851 acgcgcaccagccgcagcagc 831
to top
>gb|AF012868.1|AF012868 Mus musculus ether-a-go-go-related protein isoform Merg1a (Merg1)
            mRNA, complete cds
          Length = 4235

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1937 acgcgcaccagccgcagcagc 1917
to top
>gb|U75211.1|CPU75211 Cavia porcellus potassium channel protein ERG (gp-erg) mRNA,
           partial cds
          Length = 487

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 383 acgcgcaccagccgcagcagc 363
to top
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 319    gcagcgccaccgtgccgcccc 339
              |||||||||||||||||||||
Sbjct: 294427 gcagcgccaccgtgccgcccc 294447
to top
>gb|AF034762.1|AF034762 Mus musculus ERG B K+ channel isoform (MERG) mRNA, complete cds
          Length = 3115

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 895 acgcgcaccagccgcagcagc 875
to top
>gb|U87513.1|OCU87513 Oryctolagus cuniculus ventricular ERG K+ channel subunit mRNA,
            complete cds
          Length = 3820

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1559 acgcgcaccagccgcagcagc 1539
to top
>gb|U12891.1|PAU12891 Pseudomonas aeruginosa PAO substrain OT684 pyoverdine gene
           transcriptional regulator PvdS (pvdS) gene, complete cds
          Length = 4062

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 457 cgccatcgtcctcggcgagga 477
           |||||||||||||||||||||
Sbjct: 629 cgccatcgtcctcggcgagga 649
to top
>gb|U04270.1|HSU04270 Human putative potassium channel subunit (h-erg) mRNA, complete cds
          Length = 4070

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1787 acgcgcaccagccgcagcagc 1767
to top
>emb|AJ512214.1|HSA512214 Homo sapiens mRNA for potassium channel 1b protein (HERG1b gene)
          Length = 2477

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 372 acgcgcaccagccgcagcagc 392
           |||||||||||||||||||||
Sbjct: 601 acgcgcaccagccgcagcagc 581
to top
>dbj|AB044806.1| Homo sapiens HERG mRNA for HERG-USO, alternatively spliced, complete
            cds
          Length = 3337

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  acgcgcaccagccgcagcagc 392
            |||||||||||||||||||||
Sbjct: 1787 acgcgcaccagccgcagcagc 1767
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    gatgcgcgggtcggcggcga 249
              ||||||||||||||||||||
Sbjct: 369896 gatgcgcgggtcggcggcga 369877
to top
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 228     tcgatgcgcgggtcggcggcgagc 251
               ||||||||||| ||||||||||||
Sbjct: 1810413 tcgatgcgcggctcggcggcgagc 1810390
to top
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence
          Length = 216191

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 68     ggaaaaataatacaattgattaag 91
              ||||||||||| ||||||||||||
Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
to top
>gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome
          Length = 36001

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   gacgcggcggcagatggtga 198
             ||||||||||||||||||||
Sbjct: 11182 gacgcggcggcagatggtga 11201
to top
>gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydrolase (mpd) gene,
           complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1068

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 277 ccggcagcgccaccgtgccg 258
to top
>gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide hydrolase (mpd) gene,
            complete cds; and insertion sequence IS6100, partial
            sequence
          Length = 5231

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 2149 ccggcagcgccaccgtgccg 2130
to top
>gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pesticide hydrolase (mpd)
            gene, complete cds; and insertion sequence IS6100
            transposase gene, complete cds
          Length = 6758

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 3820 ccggcagcgccaccgtgccg 3801
to top
>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0035B22, complete sequence
          Length = 155788

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 466    cctcggcgaggagctcctcc 485
              ||||||||||||||||||||
Sbjct: 127389 cctcggcgaggagctcctcc 127408
to top
>gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone FLH031886.01F
           PA5269 gene, partial cds
          Length = 276

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 238 ggtcggcggcgagcttggcgttga 261
           |||||||||||||| |||||||||
Sbjct: 208 ggtcggcggcgagcatggcgttga 185
to top
>gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd1) gene,
           complete cds
          Length = 2543

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 987 ccggcagcgccaccgtgccg 968
to top
>gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd2) gene,
            complete cds
          Length = 3334

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 1687 ccggcagcgccaccgtgccg 1668
to top
>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence
          Length = 133237

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 66     agggaaaaataatacaattgatta 89
              ||||||||||||||||||| ||||
Sbjct: 111187 agggaaaaataatacaatttatta 111164
to top
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 314     cgccggcagcgccaccgtgc 333
               ||||||||||||||||||||
Sbjct: 1734234 cgccggcagcgccaccgtgc 1734215
to top
>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12
          Length = 333800

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 227    ctcgatgcgcgggtcggcggcgag 250
              ||||||||||| ||||||||||||
Sbjct: 116899 ctcgatgcgcgtgtcggcggcgag 116922
to top
>gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion sequence IS6100
            transposase (tnpA) gene, complete cds, methyl parathion
            hydrolase (mpd) and hypothetical protein genes, complete
            cds, and insertion sequence IS6100 transposase (tnpB)
            gene, complete cds
          Length = 6614

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 3254 ccggcagcgccaccgtgccg 3235
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 311     gcccgccggcagcgccaccgtgccgccc 338
               |||||||||||||||| ||| |||||||
Sbjct: 4826093 gcccgccggcagcgccgccgcgccgccc 4826120
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 182    gcggcggcagatggtgacgccgtc 205
              ||||||||||||||||| ||||||
Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
to top
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene
          Length = 5894

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 247  cgagcttggcgttgaggtccctgagggcggcg 278
            ||||||||||||||  |||| |||||||||||
Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
to top
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 228  tcgatgcgcgggtcggcggcgagc 251
            |||| |||||||||||||||||||
Sbjct: 2353 tcgaagcgcgggtcggcggcgagc 2330
to top
>emb|AL606608.3|OSJN00056 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0015K02,
             complete sequence
          Length = 153623

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   agccgcagcagctgctcgtg 400
             ||||||||||||||||||||
Sbjct: 79255 agccgcagcagctgctcgtg 79274
to top
>emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRNA for aldehyde dehydrogenase
           (aldh gene)
          Length = 2164

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 240 tcggcggcgagcttggcgttgagg 263
           |||||||||||||||||| |||||
Sbjct: 767 tcggcggcgagcttggcgatgagg 744
to top
>gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence
          Length = 15969

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 3753 ccggcagcgccaccgtgccg 3734



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 2431 ccggcagcgccaccgtgccg 2412
to top
>gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 205 ccggcagcgccaccgtgccg 186
to top
>gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds
          Length = 1014

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 810 ccggcagcgccaccgtgccg 829
to top
>gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds
          Length = 1023

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 810 ccggcagcgccaccgtgccg 829
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 314     cgccggcagcgccaccgtgc 333
               ||||||||||||||||||||
Sbjct: 3170008 cgccggcagcgccaccgtgc 3169989
to top
>gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, complete sequence
          Length = 7680

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 316  ccggcagcgccaccgtgccg 335
            ||||||||||||||||||||
Sbjct: 4643 ccggcagcgccaccgtgccg 4624
to top
>gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydrolase (mpd) gene, complete
           cds
          Length = 2191

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 927 ccggcagcgccaccgtgccg 908
to top
>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 374    gcgcaccagccgcagcagct 393
              ||||||||||||||||||||
Sbjct: 363734 gcgcaccagccgcagcagct 363715
to top
>gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence
          Length = 181577

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 381    agccgcagcagctgctcgtg 400
              ||||||||||||||||||||
Sbjct: 159991 agccgcagcagctgctcgtg 160010
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 381      agccgcagcagctgctcgtg 400
                ||||||||||||||||||||
Sbjct: 33728812 agccgcagcagctgctcgtg 33728831
to top
>gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds
          Length = 996

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 205 ccggcagcgccaccgtgccg 186
to top
>gb|AC132938.9| Homo sapiens chromosome 17, clone RP13-20L14, complete sequence
          Length = 154252

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 376   gcaccagccgcagcagctgc 395
             ||||||||||||||||||||
Sbjct: 57690 gcaccagccgcagcagctgc 57709
to top
>gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 of the complete
            genome
          Length = 10294

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 238  ggtcggcggcgagcttggcgttga 261
            |||||||||||||| |||||||||
Sbjct: 8946 ggtcggcggcgagcatggcgttga 8923
to top
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein,
           regulatory protein PyrR (pyrR), aspartate carbamoyl
           transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC)
           genes, complete cds; and unknown gene
          Length = 4080

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 197 gacgccgtcggcgatggcga 216
           ||||||||||||||||||||
Sbjct: 444 gacgccgtcggcgatggcga 425
to top
>gb|AC124287.10| Homo sapiens chromosome 17, clone RP13-991F5, complete sequence
          Length = 162180

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 376   gcaccagccgcagcagctgc 395
             ||||||||||||||||||||
Sbjct: 31776 gcaccagccgcagcagctgc 31757
to top
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 457     cgccatcgtcctcggcgaggagctcctc 484
               |||||||||| || ||||||||||||||
Sbjct: 1695561 cgccatcgtcatcagcgaggagctcctc 1695534
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 238     ggtcggcggcgagcttggcg 257
               ||||||||||||||||||||
Sbjct: 1444782 ggtcggcggcgagcttggcg 1444763
to top
>dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1065_E04
          Length = 115865

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 466   cctcggcgaggagctcctcc 485
             ||||||||||||||||||||
Sbjct: 52670 cctcggcgaggagctcctcc 52689
to top
>emb|Y19223.3|TAQ19223 Thermus aquaticus rpoB gene for RNA polymerase beta subunit and rpoC
            gene for RNA polymerase beta' subunit
          Length = 7954

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 457  cgccatcgtcctcggcgaggagctcctc 484
            |||||||||| || ||||||||||||||
Sbjct: 2058 cgccatcgtcatcagcgaggagctcctc 2085
to top
>ref|NM_207905.1| Eremothecium gossypii AAR011Cp (AAR011C), mRNA
          Length = 2244

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 gcgcaccagccgcagcagct 393
           ||||||||||||||||||||
Sbjct: 642 gcgcaccagccgcagcagct 661
to top
>gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insecticide hydrolase
           (opdB) gene, complete cds
          Length = 1060

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 264 ccggcagcgccaccgtgccg 245
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 361     tggtgccgccgacgcgcacc 380
               ||||||||||||||||||||
Sbjct: 3984133 tggtgccgccgacgcgcacc 3984152
to top
>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 457     cgccatcgtcctcggcgaggagctcctc 484
               |||||||||| || ||||||||||||||
Sbjct: 1383794 cgccatcgtcatcagcgaggagctcctc 1383767
to top
>gb|U78289.1|SFU78289 Streptomyces fradiae tylactone synthase, starter module and modules
             1-7, (tylG) gene, complete cds
          Length = 43280

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   gcgcaccagccgcagcagct 393
             ||||||||||||||||||||
Sbjct: 24410 gcgcaccagccgcagcagct 24391
to top
>gb|J01917.1|ADRCG Adenovirus type 2, complete genome
          Length = 35937

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   gacgcggcggcagatggtga 198
             ||||||||||||||||||||
Sbjct: 11163 gacgcggcggcagatggtga 11182
to top
>gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete sequence
          Length = 4392

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 179  gacgcggcggcagatggtga 198
            ||||||||||||||||||||
Sbjct: 1333 gacgcggcggcagatggtga 1352
to top
>gb|AY029773.1| Pseudomonas putida methyl parathion-degrading protein gene,
           complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 ccggcagcgccaccgtgccg 335
           ||||||||||||||||||||
Sbjct: 235 ccggcagcgccaccgtgccg 216
to top
>dbj|AB070936.1| Streptomyces avermitilis siderophore biosynthetic gene cluster
          Length = 10056

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 228  tcgatgcgcgggtcggcggcgagc 251
            |||| |||||||||||||||||||
Sbjct: 5465 tcgaagcgcgggtcggcggcgagc 5488
to top
>dbj|AB083789.1| Thermus thermophilus rpoB gene for DNA-directed RNA polymerase beta
            chain, complete cds
          Length = 3360

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 457  cgccatcgtcctcggcgaggagctcctc 484
            |||||||||| || ||||||||||||||
Sbjct: 2058 cgccatcgtcatcagcgaggagctcctc 2085


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,592,960
Number of Sequences: 3902068
Number of extensions: 3592960
Number of successful extensions: 89007
Number of sequences better than 10.0: 217
Number of HSP's better than 10.0 without gapping: 219
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85037
Number of HSP's gapped (non-prelim): 3903
length of query: 502
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 480
effective length of database: 17,147,199,772
effective search space: 8230655890560
effective search space used: 8230655890560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top