Clone Name | rbart34b10 |
---|---|
Clone Library Name | barley_pub |
>gb|AF527606.1| Hordeum vulgare iron/ascorbate-dependent oxidoreductase (Hcp1) mRNA, complete cds Length = 1360 Score = 289 bits (146), Expect = 3e-75 Identities = 281/326 (86%) Strand = Plus / Minus Query: 73 ttcagggcgttgatgaatctcttcccttgacgaaaatgttcgaagagcccagccacaaag 132 ||||||| || ||||||||||||||||||| | |||||||| ||||| || | || || Sbjct: 1076 ttcagggtgtcgatgaatctcttcccttgaaggaaatgttcaaagagtccgactacgaaa 1017 Query: 133 tccttggccaatattttcctatatcttggcggtcgcttgccatccaccaaaccgggcgcc 192 |||||||||| ||||||||||||||||| |||||||| |||||| |||||||||||| Sbjct: 1016 tccttggccatcattttcctatatcttggtggtcgcttctcatccagcaaaccgggcgct 957 Query: 193 ggttctagcatcgtttccgcatccacggcgtaaaacatagccagggaaagcctatccttc 252 || || |||| |||||| |||||||||| || |||| ||||| |||||||| |||||| Sbjct: 956 ggctccagcaccgtttcttcatccacggcatagaacacggccagcgaaagcctctccttc 897 Query: 253 ttgaagttcgtcaccactctgtgaaatgggctcctaaagattccattgttcattatttct 312 | |||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct: 896 tcagtgttcgtcaccactctgtgaaccgggctcctaaagattccattgttcattatctcc 837 Query: 313 aggcagtctgctaggttaaccagcaatgtgtgcggcttggctggaacattgtaccatctc 372 ||||||||||||| ||| | || || ||||| |||||||||||||||||||||||| || Sbjct: 836 aggcagtctgctaagttgatcaccagcgtgtgaggcttggctggaacattgtaccatttc 777 Query: 373 ccatctctctgaacttgcaagccacc 398 |||||||||||||||||||||||||| Sbjct: 776 ccatctctctgaacttgcaagccacc 751 Score = 44.1 bits (22), Expect = 0.34 Identities = 31/34 (91%) Strand = Plus / Minus Query: 9 ccatctctttattcttcataggcaatcactgtta 42 ||||||||||||||| |||||| ||||| ||||| Sbjct: 1131 ccatctctttattctacataggtaatcaatgtta 1098
>emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chromosome 10 Contains part of the DOCK1 gene for dedicator of cyto-kinesis 1, complete sequence Length = 154818 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 369 tctcccatctctctgaacttgc 390 |||||||||||||||||||||| Sbjct: 76243 tctcccatctctctgaacttgc 76264
>emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, complete sequence Length = 177714 Score = 44.1 bits (22), Expect = 0.34 Identities = 22/22 (100%) Strand = Plus / Plus Query: 211 gcatccacggcgtaaaacatag 232 |||||||||||||||||||||| Sbjct: 121066 gcatccacggcgtaaaacatag 121087
>ref|NM_185692.1| Oryza sativa (japonica cultivar-group), Ozsa8043 predicted mRNA Length = 1164 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 719
>ref|XM_476309.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1053 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 719
>emb|CR376855.11| Zebrafish DNA sequence from clone DKEY-56N2 in linkage group 25, complete sequence Length = 219164 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 211 gcatccacggcgtaaaacata 231 ||||||||||||||||||||| Sbjct: 152114 gcatccacggcgtaaaacata 152134
>emb|BX248386.35| Zebrafish DNA sequence from clone CH211-231M12, complete sequence Length = 148681 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 gcatccacggcgtaaaacata 231 ||||||||||||||||||||| Sbjct: 123942 gcatccacggcgtaaaacata 123922
>emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on chromosome 13 Contains the 5' end of the gene for chondromodulin I precursor (CHM-I), a novel gene, the PCDH8 gene for protocadherin 8 and 4 CpG islands, complete sequence Length = 173292 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 360 attgtaccatctcccatctctctga 384 |||||||||||||||| |||||||| Sbjct: 29810 attgtaccatctcccacctctctga 29786
>emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in linkage group 11, complete sequence Length = 212880 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 gcatccacggcgtaaaacata 231 ||||||||||||||||||||| Sbjct: 207644 gcatccacggcgtaaaacata 207624
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 3905561 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 3905517 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 3893670 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 3893626 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 3855682 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 3855638
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0035I03 Length = 153749 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 11437 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 11393
>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0015E04 Length = 152046 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 151692 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 151648 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 356 gaacattgtaccatctcccatctctctgaacttgcaagccaccga 400 ||||||||||||| | ||||| ||||||| ||||| |||||||| Sbjct: 113636 gaacattgtaccacttgccatccctctgaatttgcaggccaccga 113592
>emb|BX005349.6| Zebrafish DNA sequence from clone DKEY-111D8 in linkage group 10, complete sequence Length = 103469 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 gcatccacggcgtaaaacata 231 ||||||||||||||||||||| Sbjct: 10940 gcatccacggcgtaaaacata 10920
>emb|BX571961.11| Zebrafish DNA sequence from clone DKEY-205O12 in linkage group 22, complete sequence Length = 149478 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 211 gcatccacggcgtaaaacata 231 ||||||||||||||||||||| Sbjct: 98344 gcatccacggcgtaaaacata 98364
>dbj|AB021290.1| Homo sapiens gene for chondromodulin-1, promoter and partial cds Length = 2982 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 360 attgtaccatctcccatctctctga 384 |||||||||||||||| |||||||| Sbjct: 1330 attgtaccatctcccacctctctga 1354
>gb|AC003959.1| Homo sapiens chromosome 5, P1 clone 1029A7 (LBNL H15), complete sequence Length = 83684 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 ctctttattcttcataggca 32 |||||||||||||||||||| Sbjct: 6888 ctctttattcttcataggca 6869
>gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, complete sequence Length = 188948 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 tagcatcgtttccgcatcca 217 |||||||||||||||||||| Sbjct: 166593 tagcatcgtttccgcatcca 166612
>ref|XM_753922.1| Ustilago maydis 521 hypothetical protein (UM02868.1) partial mRNA Length = 2991 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 125 ccacaaagtccttggccaat 144 |||||||||||||||||||| Sbjct: 2887 ccacaaagtccttggccaat 2868
>gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosome 8, complete sequence Length = 211388 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 caatattttcctatatcttg 160 |||||||||||||||||||| Sbjct: 141678 caatattttcctatatcttg 141697
>gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome 3, complete sequence Length = 166604 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 293 ttccattgttcattatttct 312 |||||||||||||||||||| Sbjct: 80071 ttccattgttcattatttct 80052
>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12, complete sequence Length = 212974 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 gcatccacggcgtaaaacat 230 |||||||||||||||||||| Sbjct: 117154 gcatccacggcgtaaaacat 117135
>gb|AC099414.4| Mus musculus BAC clone RP23-122C18 from 3, complete sequence Length = 203057 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 ttccattgttcattatttct 312 |||||||||||||||||||| Sbjct: 9450 ttccattgttcattatttct 9469
>emb|CR956383.8| Pig DNA sequence from clone CH242-271L5 on chromosome 17, complete sequence Length = 163007 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 taataaacgcccaacctata 70 |||||||||||||||||||| Sbjct: 118910 taataaacgcccaacctata 118929
>gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosome 9, complete sequence Length = 211119 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 270 tctgtgaaatgggctcctaa 289 |||||||||||||||||||| Sbjct: 153685 tctgtgaaatgggctcctaa 153704
>gb|AC116366.2| Homo sapiens chromosome 5 clone RP11-89G4, complete sequence Length = 169385 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 ctctttattcttcataggca 32 |||||||||||||||||||| Sbjct: 19115 ctctttattcttcataggca 19096
>gb|AC023426.29| Homo sapiens 12 BAC RP11-396L8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 148610 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 307 atttctaggcagtctgctag 326 |||||||||||||||||||| Sbjct: 122632 atttctaggcagtctgctag 122613
>gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete genome Length = 34119 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 agtccttggccaatattttc 150 |||||||||||||||||||| Sbjct: 32595 agtccttggccaatattttc 32614
>gb|AC156804.2| Pan troglodytes BAC clone CH251-371A18 from chromosome unknown, complete sequence Length = 232130 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 ctctttattcttcataggca 32 |||||||||||||||||||| Sbjct: 15548 ctctttattcttcataggca 15529
>gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, complete sequence Length = 198540 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 agattccattgttcattatt 309 |||||||||||||||||||| Sbjct: 51899 agattccattgttcattatt 51918
>emb|CR954297.15| Zebrafish DNA sequence from clone DKEY-69M3 in linkage group 8, complete sequence Length = 232837 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 gcatccacggcgtaaaacat 230 |||||||||||||||||||| Sbjct: 85062 gcatccacggcgtaaaacat 85081
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome Length = 1551335 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tctcttcccttgacgaaaat 109 |||||||||||||||||||| Sbjct: 1096031 tctcttcccttgacgaaaat 1096012
>gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, complete sequence Length = 181469 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 374 catctctctgaacttgcaag 393 |||||||||||||||||||| Sbjct: 124280 catctctctgaacttgcaag 124261
>emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chromosome X, complete sequence Length = 264395 Score = 40.1 bits (20), Expect = 5.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 235 agggaaagcctatccttcttgaag 258 ||||||| |||||||||||||||| Sbjct: 197778 agggaaatcctatccttcttgaag 197755 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,322,489 Number of Sequences: 3902068 Number of extensions: 3322489 Number of successful extensions: 64966 Number of sequences better than 10.0: 33 Number of HSP's better than 10.0 without gapping: 33 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 64891 Number of HSP's gapped (non-prelim): 74 length of query: 400 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 378 effective length of database: 17,147,199,772 effective search space: 6481641513816 effective search space used: 6481641513816 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)