ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart33h05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC132119.2| Mus musculus BAC clone RP23-467E2 from chromosome... 42 0.12
2gb|AC124500.5| Mus musculus BAC clone RP24-69C19 from chromosome... 42 0.12
3ref|XM_656047.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 0.48
4ref|NM_032221.3| Homo sapiens chromodomain helicase DNA binding ... 38 1.9
5ref|XM_534421.2| PREDICTED: Canis familiaris similar to chromodo... 38 1.9
6gb|AF525085.1| Homo sapiens RIGB (RIGB) mRNA, complete cds 38 1.9
7emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 ... 38 1.9
8gb|AC148485.10| Medicago truncatula clone mth2-46j5, complete se... 38 1.9
9emb|AL031667.21|HS620E11 Human DNA sequence from clone RP4-620E1... 38 1.9
10ref|XM_967269.1| PREDICTED: Tribolium castaneum similar to Sympl... 38 1.9
11emb|CR339041.7| Zebrafish DNA sequence from clone CH211-147G22, ... 38 1.9
12gb|AY034072.1| Homo sapiens chromodomain helicase DNA binding pr... 38 1.9
13gb|DP000053.1| Oryctolagus cuniculus target 126 genomic scaffold 38 1.9
14emb|BX649231.4| Zebrafish DNA sequence from clone DKEY-225H23 in... 38 1.9
15gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, comp... 36 7.5
16gb|AC163032.5| Mus musculus BAC clone RP24-144G20 from chromosom... 36 7.5
17gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, comple... 36 7.5
18gb|AF165176.1| Homo sapiens chromosome 21q22.3 PAC B02270, compl... 36 7.5
19gb|AC131297.11| Mus musculus chromosome 8, clone RP23-284E15, co... 36 7.5
20gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete... 36 7.5
21gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete... 36 7.5
22ref|XM_804621.1| Trypanosoma cruzi strain CL Brener tubulin-tyro... 36 7.5
23gb|U95743.1|HUU95743 Homo sapiens chromosome 16 BAC clone CIT987... 36 7.5
24ref|XM_806020.1| Trypanosoma cruzi strain CL Brener tubulin-tyro... 36 7.5
25gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p... 36 7.5
26gb|AC146175.1| Pan troglodytes BAC clone CH251-559G23 from Y, co... 36 7.5
27emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083 36 7.5
28gb|AC145769.1| Pan troglodytes BAC clone CH251-203H3 from Y, com... 36 7.5
29emb|AL590113.8| Human DNA sequence from clone RP11-234D19 on chr... 36 7.5
30emb|AL133286.9| Human DNA sequence from clone RP4-580N22 on chro... 36 7.5
31gb|AC163034.4| Mus musculus BAC clone RP23-394C13 from chromosom... 36 7.5
32emb|AL954235.1| Pan troglodytes chromosome 22 clone RP43-030A20 ... 36 7.5
33emb|BX537117.6| Zebrafish DNA sequence from clone CH211-281N15 i... 36 7.5
34gb|AC162925.4| Mus musculus BAC clone RP23-302D18 from chromosom... 36 7.5
35dbj|BS000558.1| Pan troglodytes chromosome Y clone:PTB-471H19, c... 36 7.5
36gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 36 7.5
37dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 36 7.5
38gb|AC097518.2| Homo sapiens BAC clone RP11-487E13 from 4, comple... 36 7.5
39gb|AC165267.2| Zea mays clone ZMMBBb-151F20, complete sequence 36 7.5
40emb|BX649325.3| Zebrafish DNA sequence from clone DKEY-81F9 in l... 36 7.5
41gb|AC018574.6| Homo sapiens chromosome , clone RP11-4G2, complet... 36 7.5
42gb|AC160634.2| Mus musculus BAC clone RP23-429J21 from chromosom... 36 7.5
43gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete se... 36 7.5
44gb|AC010727.6|AC010727 Homo sapiens BAC clone RP11-224E16 from 3... 36 7.5
45gb|AC011114.5|AC011114 Homo sapiens, clone RP11-115A23, complete... 36 7.5
46emb|BX005006.10| Zebrafish DNA sequence from clone DKEY-47K14, c... 36 7.5
47gb|AC009173.9| Homo sapiens chromosome 16 clone RP11-99H5, compl... 36 7.5
48emb|BX934223.1| Gallus gallus finished cDNA, clone ChEST444i5 36 7.5
49gb|AC007275.4|AC007275 Homo sapiens BAC clone RP11-109F19 from Y... 36 7.5
50gb|AC026888.6|AC026888 Homo sapiens chromosome 14 clone CTD-2243... 36 7.5
51dbj|BS000163.1| Pan troglodytes chromosome 22 clone:RP43-010B02,... 36 7.5
52gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35... 36 7.5
53gb|AC087094.3| Homo sapiens chromosome 3 clone RP11-94M9 map 3p,... 36 7.5
54dbj|AP001166.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 36 7.5
55emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chro... 36 7.5 
>gb|AC132119.2| Mus musculus BAC clone RP23-467E2 from chromosome 6, complete sequence
          Length = 161817

 Score = 42.1 bits (21), Expect = 0.12
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    ccaaaacatgcttaatttcag 30
             |||||||||||||||||||||
Sbjct: 14987 ccaaaacatgcttaatttcag 14967
to top
>gb|AC124500.5| Mus musculus BAC clone RP24-69C19 from chromosome 6, complete sequence
          Length = 190224

 Score = 42.1 bits (21), Expect = 0.12
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     ccaaaacatgcttaatttcag 30
              |||||||||||||||||||||
Sbjct: 178606 ccaaaacatgcttaatttcag 178586
to top
>ref|XM_656047.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3535.2), mRNA
          Length = 1389

 Score = 40.1 bits (20), Expect = 0.48
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  atttcagggatgggcacatt 43
           ||||||||||||||||||||
Sbjct: 688 atttcagggatgggcacatt 707
to top
>ref|NM_032221.3| Homo sapiens chromodomain helicase DNA binding protein 6 (CHD6), mRNA
          Length = 10389

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   acatgcttaatttcaggga 33
            |||||||||||||||||||
Sbjct: 1491 acatgcttaatttcaggga 1473
to top
>ref|XM_534421.2| PREDICTED: Canis familiaris similar to chromodomain helicase DNA
            binding protein 6, transcript variant 1 (LOC477230), mRNA
          Length = 8475

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   acatgcttaatttcaggga 33
            |||||||||||||||||||
Sbjct: 1422 acatgcttaatttcaggga 1404
to top
>gb|AF525085.1| Homo sapiens RIGB (RIGB) mRNA, complete cds
          Length = 1635

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 15  acatgcttaatttcaggga 33
           |||||||||||||||||||
Sbjct: 421 acatgcttaatttcaggga 403
to top
>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7,
             complete sequence
          Length = 168673

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 4     aacaacccaaaacatgcttaatt 26
             |||||||||||||||||| ||||
Sbjct: 43536 aacaacccaaaacatgctaaatt 43514
to top
>gb|AC148485.10| Medicago truncatula clone mth2-46j5, complete sequence
          Length = 111045

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    aaacatgcttaatttcagg 31
             |||||||||||||||||||
Sbjct: 43545 aaacatgcttaatttcagg 43527
to top
>emb|AL031667.21|HS620E11 Human DNA sequence from clone RP4-620E11 on chromosome 20q11.2-12
              Contains the 3' end of the LPIN3 gene for lipin 3, the
              C20orf130 gene, a novel pseudogene, the 3' end of the CHD6
              gene for chromodomain helicase DNA binding protein 6, a
              lymphocyte antigen 6 complex locus H (LY6H) pseudogene and
              a CpG island, complete sequence
          Length = 142520

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 15     acatgcttaatttcaggga 33
              |||||||||||||||||||
Sbjct: 135903 acatgcttaatttcaggga 135921
to top
>ref|XM_967269.1| PREDICTED: Tribolium castaneum similar to Symplekin (LOC661083),
           mRNA
          Length = 3183

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaaacatgcttaatttca 29
           |||||||||||||||||||
Sbjct: 160 caaaacatgcttaatttca 178
to top
>emb|CR339041.7| Zebrafish DNA sequence from clone CH211-147G22, complete sequence
          Length = 161478

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     acccaaaacatgcttaatt 26
             |||||||||||||||||||
Sbjct: 67503 acccaaaacatgcttaatt 67521
to top
>gb|AY034072.1| Homo sapiens chromodomain helicase DNA binding protein 5 (CHD5) mRNA,
            complete cds
          Length = 8326

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   acatgcttaatttcaggga 33
            |||||||||||||||||||
Sbjct: 1491 acatgcttaatttcaggga 1473
to top
>gb|DP000053.1| Oryctolagus cuniculus target 126 genomic scaffold
          Length = 470930

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 5      acaacccaaaacatgctta 23
              |||||||||||||||||||
Sbjct: 451489 acaacccaaaacatgctta 451471
to top
>emb|BX649231.4| Zebrafish DNA sequence from clone DKEY-225H23 in linkage group 20,
              complete sequence
          Length = 153569

 Score = 38.2 bits (19), Expect = 1.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      aacccaaaacatgcttaat 25
              |||||||||||||||||||
Sbjct: 104961 aacccaaaacatgcttaat 104979
to top
>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence
          Length = 167871

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 6      caacccaaaacatgctta 23
              ||||||||||||||||||
Sbjct: 100818 caacccaaaacatgctta 100801
to top
>gb|AC163032.5| Mus musculus BAC clone RP24-144G20 from chromosome 12, complete
             sequence
          Length = 186416

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    atgcttaatttcagggat 34
             ||||||||||||||||||
Sbjct: 26599 atgcttaatttcagggat 26582
to top
>gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, complete sequence
          Length = 120007

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 5     acaacccaaaacatgctt 22
             ||||||||||||||||||
Sbjct: 19607 acaacccaaaacatgctt 19624
to top
>gb|AF165176.1| Homo sapiens chromosome 21q22.3 PAC B02270, complete sequence
          Length = 120609

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 5     acaacccaaaacatgctt 22
             ||||||||||||||||||
Sbjct: 61738 acaacccaaaacatgctt 61755
to top
>gb|AC131297.11| Mus musculus chromosome 8, clone RP23-284E15, complete sequence
          Length = 188817

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    gcttaatttcagggatgg 36
             ||||||||||||||||||
Sbjct: 79208 gcttaatttcagggatgg 79225
to top
>gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete sequence
          Length = 173008

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aaaacatgcttaatttca 29
              ||||||||||||||||||
Sbjct: 154593 aaaacatgcttaatttca 154576
to top
>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aaaacatgcttaatttca 29
             ||||||||||||||||||
Sbjct: 47452 aaaacatgcttaatttca 47435
to top
>ref|XM_804621.1| Trypanosoma cruzi strain CL Brener tubulin-tyrosine ligase
            (Tc00.1047053506477.30) partial mRNA
          Length = 2178

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    aacccaaaacatgcttaa 24
            ||||||||||||||||||
Sbjct: 1069 aacccaaaacatgcttaa 1052
to top
>gb|U95743.1|HUU95743 Homo sapiens chromosome 16 BAC clone CIT987-SK65D3, complete sequence
          Length = 192730

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 27     tcagggatgggcacatta 44
              ||||||||||||||||||
Sbjct: 181663 tcagggatgggcacatta 181646
to top
>ref|XM_806020.1| Trypanosoma cruzi strain CL Brener tubulin-tyrosine ligase
            (Tc00.1047053508995.30) partial mRNA
          Length = 2139

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    aacccaaaacatgcttaa 24
            ||||||||||||||||||
Sbjct: 1030 aacccaaaacatgcttaa 1013
to top
>gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p, complete sequence
          Length = 172811

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    aatttcagggatgggcac 40
             ||||||||||||||||||
Sbjct: 44107 aatttcagggatgggcac 44124
to top
>gb|AC146175.1| Pan troglodytes BAC clone CH251-559G23 from Y, complete sequence
          Length = 228185

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     acatgcttaatttcaggg 32
              ||||||||||||||||||
Sbjct: 134072 acatgcttaatttcaggg 134055
to top
>emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083
          Length = 340000

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      acaacccaaaacatgctt 22
              ||||||||||||||||||
Sbjct: 104869 acaacccaaaacatgctt 104886
to top
>gb|AC145769.1| Pan troglodytes BAC clone CH251-203H3 from Y, complete sequence
          Length = 165958

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    acatgcttaatttcaggg 32
             ||||||||||||||||||
Sbjct: 71845 acatgcttaatttcaggg 71828
to top
>emb|AL590113.8| Human DNA sequence from clone RP11-234D19 on chromosome 1 Contains a
             novel gene (gm117), the BCL10 gene for B-cell CLL/lymphoma
             10 and the 5' end of a novel gene, complete sequence
          Length = 97789

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    aaaacatgcttaatttca 29
             ||||||||||||||||||
Sbjct: 11183 aaaacatgcttaatttca 11200
to top
>emb|AL133286.9| Human DNA sequence from clone RP4-580N22 on chromosome 1q42.2-44
             Contains the 3' end of the CHS1 gene for Chediak-Higashi
             syndrome 1 protein and a CpG island, complete sequence
          Length = 93354

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    aaacatgcttaatttcag 30
             ||||||||||||||||||
Sbjct: 89080 aaacatgcttaatttcag 89097
to top
>gb|AC163034.4| Mus musculus BAC clone RP23-394C13 from chromosome 12, complete sequence
          Length = 187877

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 17     atgcttaatttcagggat 34
              ||||||||||||||||||
Sbjct: 135855 atgcttaatttcagggat 135838
to top
>emb|AL954235.1| Pan troglodytes chromosome 22 clone RP43-030A20 map 22q22.2-q22.3,
             complete sequence
          Length = 169458

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 5     acaacccaaaacatgctt 22
             ||||||||||||||||||
Sbjct: 11529 acaacccaaaacatgctt 11546
to top
>emb|BX537117.6| Zebrafish DNA sequence from clone CH211-281N15 in linkage group 17,
              complete sequence
          Length = 161999

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      acaacccaaaacatgctt 22
              ||||||||||||||||||
Sbjct: 152978 acaacccaaaacatgctt 152995
to top
>gb|AC162925.4| Mus musculus BAC clone RP23-302D18 from chromosome 6, complete sequence
          Length = 225947

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 19     gcttaatttcagggatgg 36
              ||||||||||||||||||
Sbjct: 135799 gcttaatttcagggatgg 135816
to top
>dbj|BS000558.1| Pan troglodytes chromosome Y clone:PTB-471H19, complete sequences
          Length = 156402

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acatgcttaatttcaggg 32
             ||||||||||||||||||
Sbjct: 81383 acatgcttaatttcaggg 81400
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     acatgcttaatttcaggg 32
              ||||||||||||||||||
Sbjct: 512880 acatgcttaatttcaggg 512897
to top
>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 12      aaaacatgcttaatttca 29
               ||||||||||||||||||
Sbjct: 2062236 aaaacatgcttaatttca 2062253
to top
>gb|AC097518.2| Homo sapiens BAC clone RP11-487E13 from 4, complete sequence
          Length = 189323

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    caaaacatgcttaatttc 28
             ||||||||||||||||||
Sbjct: 94152 caaaacatgcttaatttc 94169
to top
>gb|AC165267.2| Zea mays clone ZMMBBb-151F20, complete sequence
          Length = 115478

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    aaacatgcttaatttcag 30
             ||||||||||||||||||
Sbjct: 72145 aaacatgcttaatttcag 72162
to top
>emb|BX649325.3| Zebrafish DNA sequence from clone DKEY-81F9 in linkage group 24, complete
              sequence
          Length = 169135

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 8      acccaaaacatgcttaat 25
              ||||||||||||||||||
Sbjct: 120918 acccaaaacatgcttaat 120901
to top
>gb|AC018574.6| Homo sapiens chromosome , clone RP11-4G2, complete sequence
          Length = 171858

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 5      acaacccaaaacatgctt 22
              ||||||||||||||||||
Sbjct: 165084 acaacccaaaacatgctt 165067
to top
>gb|AC160634.2| Mus musculus BAC clone RP23-429J21 from chromosome 12, complete sequence
          Length = 176160

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aaaacatgcttaatttca 29
              ||||||||||||||||||
Sbjct: 101536 aaaacatgcttaatttca 101519
to top
>gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete sequence
          Length = 178580

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 21     ttaatttcagggatgggc 38
              ||||||||||||||||||
Sbjct: 101647 ttaatttcagggatgggc 101664
to top
>gb|AC010727.6|AC010727 Homo sapiens BAC clone RP11-224E16 from 3, complete sequence
          Length = 148061

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acatgcttaatttcaggg 32
             ||||||||||||||||||
Sbjct: 75526 acatgcttaatttcaggg 75543
to top
>gb|AC011114.5|AC011114 Homo sapiens, clone RP11-115A23, complete sequence
          Length = 101971

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     acaacccaaaacatgctt 22
             ||||||||||||||||||
Sbjct: 12083 acaacccaaaacatgctt 12066
to top
>emb|BX005006.10| Zebrafish DNA sequence from clone DKEY-47K14, complete sequence
          Length = 232594

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 17     atgcttaatttcagggat 34
              ||||||||||||||||||
Sbjct: 110730 atgcttaatttcagggat 110747
to top
>gb|AC009173.9| Homo sapiens chromosome 16 clone RP11-99H5, complete sequence
          Length = 149842

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    tcagggatgggcacatta 44
             ||||||||||||||||||
Sbjct: 30768 tcagggatgggcacatta 30751
to top
>emb|BX934223.1| Gallus gallus finished cDNA, clone ChEST444i5
          Length = 679

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 8   acccaaaacatgcttaatttca 29
           ||||| ||||||||||||||||
Sbjct: 464 acccacaacatgcttaatttca 443
to top
>gb|AC007275.4|AC007275 Homo sapiens BAC clone RP11-109F19 from Y, complete sequence
          Length = 169904

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acatgcttaatttcaggg 32
             ||||||||||||||||||
Sbjct: 80413 acatgcttaatttcaggg 80430
to top
>gb|AC026888.6|AC026888 Homo sapiens chromosome 14 clone CTD-2243E23 and CTD-2009K21 map
             14q24.3-31, complete sequence
          Length = 208894

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    aaaacatgcttaatttca 29
             ||||||||||||||||||
Sbjct: 69416 aaaacatgcttaatttca 69433
to top
>dbj|BS000163.1| Pan troglodytes chromosome 22 clone:RP43-010B02, map 22, complete
              sequences
          Length = 182740

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      acaacccaaaacatgctt 22
              ||||||||||||||||||
Sbjct: 181625 acaacccaaaacatgctt 181642
to top
>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aaaacatgcttaatttca 29
              ||||||||||||||||||
Sbjct: 229682 aaaacatgcttaatttca 229665
to top
>gb|AC087094.3| Homo sapiens chromosome 3 clone RP11-94M9 map 3p, complete sequence
          Length = 170876

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 23    aatttcagggatgggcac 40
             ||||||||||||||||||
Sbjct: 14642 aatttcagggatgggcac 14625
to top
>dbj|AP001166.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-865B13, complete
             sequence
          Length = 104600

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    aaaacatgcttaatttca 29
             ||||||||||||||||||
Sbjct: 56605 aaaacatgcttaatttca 56622
to top
>emb|AL663072.12| Mouse DNA sequence from clone RP23-22J3 on chromosome X, complete
              sequence
          Length = 249536

 Score = 36.2 bits (18), Expect = 7.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     tttcagggatgggcacat 42
              ||||||||||||||||||
Sbjct: 246247 tttcagggatgggcacat 246230


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 480,675
Number of Sequences: 3902068
Number of extensions: 480675
Number of successful extensions: 126584
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126410
Number of HSP's gapped (non-prelim): 174
length of query: 54
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 34
effective length of database: 17,155,003,908
effective search space: 583270132872
effective search space used: 583270132872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top