ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart33g11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 48 0.025
2gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Can... 44 0.39
3gb|AC006840.17|AC006840 Homo sapiens chromosome 4 clone C0422C23... 44 0.39
4dbj|AB046365.1| Bombyx mori mRNA for laminin, partial cds 44 0.39
5gb|AC025447.5| Homo sapiens chromosome 5 clone CTD-2085H24, comp... 42 1.5
6emb|BX530092.15| Mouse DNA sequence from clone RP23-45N17 on chr... 42 1.5
7gb|AC010368.4|AC010368 Homo sapiens chromosome 5 clone CTD-2046J... 42 1.5
8dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.5
9gb|AC007182.3|AC007182 Homo sapiens chromosome 14 clone BAC 507E... 42 1.5
10emb|Z81126.2|CET22E6 Caenorhabditis elegans Cosmid T22E6, comple... 40 6.1
11emb|Z50176.1|CEC09G1 Caenorhabditis elegans Cosmid C09G1, comple... 40 6.1
12emb|AL161899.21| Human DNA sequence from clone RP11-418I10 on ch... 40 6.1
13gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 6.1
14emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A stra... 40 6.1
15gb|DQ087286.1| Saccharopolyspora pogona BusF (busF), BusG (busG)... 40 6.1
16gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 6.1
17gb|AC016907.6| Homo sapiens BAC clone RP11-439P4 from 2, complet... 40 6.1
18dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.1
19gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, comple... 40 6.1
20emb|Z92775.2|CEC06H5 Caenorhabditis elegans Cosmid C06H5, comple... 40 6.1
21emb|AL139296.4|CNS01DXF Human chromosome 14 DNA sequence BAC C-2... 40 6.1
22gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome 40 6.1
23gb|AC171898.2| Capitella capitata clone JGIBGZA-37B13, complete ... 40 6.1
24emb|BX005180.6| Mouse DNA sequence from clone RP23-414F9 on chro... 40 6.1

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 118    caaattacatgaaaaatttaacttcaaa 145
              ||||||||||||||| ||||||||||||
Sbjct: 554386 caaattacatgaaaagtttaacttcaaa 554359



to top

>gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 128936

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 115   atccaaattacatgaaaaattt 136
             ||||||||||||||||||||||
Sbjct: 85427 atccaaattacatgaaaaattt 85406



to top

>gb|AC006840.17|AC006840 Homo sapiens chromosome 4 clone C0422C23, complete sequence
          Length = 201657

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 130    aaaatttaacttcaaatggatc 151
              ||||||||||||||||||||||
Sbjct: 181059 aaaatttaacttcaaatggatc 181038



to top

>dbj|AB046365.1| Bombyx mori mRNA for laminin, partial cds
          Length = 3470

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 214 tgcgatgataaaacaggagcct 235
           ||||||||||||||||||||||
Sbjct: 518 tgcgatgataaaacaggagcct 539



to top

>gb|AC025447.5| Homo sapiens chromosome 5 clone CTD-2085H24, complete sequence
          Length = 117543

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 121   attacatgaaaaatttaactt 141
             |||||||||||||||||||||
Sbjct: 72466 attacatgaaaaatttaactt 72446



to top

>emb|BX530092.15| Mouse DNA sequence from clone RP23-45N17 on chromosome X, complete
            sequence
          Length = 136088

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 177  tggagaaagatgtctagttgg 197
            |||||||||||||||||||||
Sbjct: 3773 tggagaaagatgtctagttgg 3793



to top

>gb|AC010368.4|AC010368 Homo sapiens chromosome 5 clone CTD-2046J7, complete sequence
          Length = 149307

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 121   attacatgaaaaatttaactt 141
             |||||||||||||||||||||
Sbjct: 86436 attacatgaaaaatttaactt 86456



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 290    ggcggtggccaggtgaagtcg 310
              |||||||||||||||||||||
Sbjct: 314538 ggcggtggccaggtgaagtcg 314518



to top

>gb|AC007182.3|AC007182 Homo sapiens chromosome 14 clone BAC 507E23 map 14q24.3, complete
              sequence
          Length = 192389

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 123    tacatgaaaaatttaacttcaaatggatc 151
              ||||||||||||||||||  |||||||||
Sbjct: 183300 tacatgaaaaatttaactcaaaatggatc 183272



to top

>emb|Z81126.2|CET22E6 Caenorhabditis elegans Cosmid T22E6, complete sequence
          Length = 13219

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 atgaaaaatttaacttcaaa 145
           ||||||||||||||||||||
Sbjct: 32  atgaaaaatttaacttcaaa 51



to top

>emb|Z50176.1|CEC09G1 Caenorhabditis elegans Cosmid C09G1, complete sequence
          Length = 41033

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   atgaaaaatttaacttcaaa 145
             ||||||||||||||||||||
Sbjct: 40961 atgaaaaatttaacttcaaa 40980



to top

>emb|AL161899.21| Human DNA sequence from clone RP11-418I10 on chromosome 13, complete
              sequence
          Length = 159981

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    tatgtaatcagacatcaagt 175
              ||||||||||||||||||||
Sbjct: 151613 tatgtaatcagacatcaagt 151594



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 203    tcacatgaggctgcgatgat 222
              ||||||||||||||||||||
Sbjct: 980844 tcacatgaggctgcgatgat 980825



to top

>emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              3/7
          Length = 311321

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 397    gtccgtggccggcggtgccgtcca 420
              |||||| |||||||||||||||||
Sbjct: 237083 gtccgttgccggcggtgccgtcca 237106



to top

>gb|DQ087286.1| Saccharopolyspora pogona BusF (busF), BusG (busG), BusH (busH), BusI
             (busI), BusJ (busJ), BusK (busK), BusL (busL), BusM
             (busM), BusN (busN), BusO (busO), BusP (busP), BusQ
             (busQ), BusR (busR), and BusS (busS) genes, complete cds
          Length = 36538

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ccggcaggcggtggccaggt 303
             ||||||||||||||||||||
Sbjct: 11362 ccggcaggcggtggccaggt 11343



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 397    gtccgtggccggcggtgccgtcca 420
              |||||| |||||||||||||||||
Sbjct: 779099 gtccgttgccggcggtgccgtcca 779122



to top

>gb|AC016907.6| Homo sapiens BAC clone RP11-439P4 from 2, complete sequence
          Length = 202827

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      aaagaaatggccatttatta 22
              ||||||||||||||||||||
Sbjct: 181833 aaagaaatggccatttatta 181852



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    gccgagcccgaggtcgaact 449
              ||||||||||||||||||||
Sbjct: 215856 gccgagcccgaggtcgaact 215875



to top

>gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, complete sequence
          Length = 159591

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    agacatcaagtgtggagaaa 184
              ||||||||||||||||||||
Sbjct: 135375 agacatcaagtgtggagaaa 135394



to top

>emb|Z92775.2|CEC06H5 Caenorhabditis elegans Cosmid C06H5, complete sequence
          Length = 41299

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   aaattacatgaaaaatttaa 138
             ||||||||||||||||||||
Sbjct: 22074 aaattacatgaaaaatttaa 22093



to top

>emb|AL139296.4|CNS01DXF Human chromosome 14 DNA sequence BAC C-2504D12 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 209710

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 397    gtccgtggccggcggtgccg 416
              ||||||||||||||||||||
Sbjct: 108353 gtccgtggccggcggtgccg 108334



to top

>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome
          Length = 2153922

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 397    gtccgtggccggcggtgccgtcca 420
              |||||| |||||||||||||||||
Sbjct: 323274 gtccgttgccggcggtgccgtcca 323297



to top

>gb|AC171898.2| Capitella capitata clone JGIBGZA-37B13, complete sequence
          Length = 32964

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 15    atttattacaacattgctctactc 38
             ||||||||||||||||||| ||||
Sbjct: 21468 atttattacaacattgctcgactc 21491



to top

>emb|BX005180.6| Mouse DNA sequence from clone RP23-414F9 on chromosome X, complete
              sequence
          Length = 148346

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    atgaaaaatttaacttcaaa 145
              ||||||||||||||||||||
Sbjct: 108186 atgaaaaatttaacttcaaa 108167


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,414,307
Number of Sequences: 3902068
Number of extensions: 3414307
Number of successful extensions: 65212
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64898
Number of HSP's gapped (non-prelim): 314
length of query: 454
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 432
effective length of database: 17,147,199,772
effective search space: 7407590301504
effective search space used: 7407590301504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top