ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart33g09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB020961.1| Zea mays mRNA for cysteine protease component of... 103 5e-19
2ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predic... 100 8e-18
3dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
4dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
5dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
6dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA ... 100 8e-18
7gb|AY103676.1| Zea mays PCO102242 mRNA sequence 94 5e-16
8gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) ... 78 3e-11
9gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence 70 7e-09
10gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4... 70 7e-09
11gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4... 70 7e-09
12gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4... 70 7e-09
13gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4... 70 7e-09
14gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4... 70 7e-09
15gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4... 70 7e-09
16gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.... 70 7e-09
17gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.... 70 7e-09
18gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.... 70 7e-09
19gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.... 70 7e-09
20gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4... 70 7e-09
21gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4... 70 7e-09
22gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4... 70 7e-09
23gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4... 70 7e-09
24gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4... 70 7e-09
25gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4... 70 7e-09
26gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4... 70 7e-09
27gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4... 70 7e-09
28gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 g... 70 7e-09
29emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cyst... 62 2e-06
30dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 60 7e-06
31emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 60 7e-06
32emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 60 7e-06
33gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, com... 54 4e-04
34gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete se... 46 0.10
35gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-2... 46 0.10
36dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease... 46 0.10
37gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome... 46 0.10
38emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine p... 42 1.6
39emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 42 1.6
40gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseu... 42 1.6
41gb|AC111100.13| Mus musculus chromosome 3, clone RP23-179J8, com... 40 6.3
42gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosom... 40 6.3
43ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region... 40 6.3
44ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region... 40 6.3
45gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds 40 6.3
46gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 40 6.3
47emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitoc... 40 6.3
48gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1... 40 6.3
49emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 6.3
50emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chro... 40 6.3
51emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for... 40 6.3
52gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion ori... 40 6.3
53gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, com... 40 6.3
54gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome... 40 6.3
55gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosom... 40 6.3
56gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor,... 40 6.3
57gb|AC097454.2| Homo sapiens BAC clone RP11-2F17 from 4, complete... 40 6.3
58gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine prote... 40 6.3
59gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, com... 40 6.3
60gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:663983... 40 6.3
61gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete... 40 6.3
62gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complet... 40 6.3
63gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, compl... 40 6.3
64emb|CT030189.8| Mouse DNA sequence from clone RP24-402B23 on chr... 40 6.3
65gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds 40 6.3
66gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene... 40 6.3 
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor
            complex, complete cds
          Length = 1828

 Score =  103 bits (52), Expect = 5e-19
 Identities = 105/122 (86%), Gaps = 3/122 (2%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactga---cagtgggctgtccttggccgcg 399
            |||||||||||||| ||| ||  ||||||||||||   |||||||||||||||| ||  |
Sbjct: 1452 ggcttggccagggttcgcttcgtagccttcactgaaagcagtgggctgtccttgcccatg 1393

                                                                        
Query: 400  aggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtga 459
            ||||| ||||||||| ||  |||||||||||| |||| ||| ||||||||||||||||||
Sbjct: 1392 aggcaggttccctgcctgacgttgcagatggggtagtcatgggggcagcagctgtagtga 1333

              
Query: 460  tc 461
            ||
Sbjct: 1332 tc 1331
to top
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1377

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1331 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1272

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1271 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1212

              
Query: 463  tc 464
            ||
Sbjct: 1211 tc 1210
to top
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full
            insert sequence
          Length = 1753

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

              
Query: 463  tc 464
            ||
Sbjct: 1276 tc 1275



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 73   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1667 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1610

                    
Query: 133  ccgatttt 140
            ||| ||||
Sbjct: 1609 ccgttttt 1602
to top
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full
            insert sequence
          Length = 1774

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

              
Query: 463  tc 464
            ||
Sbjct: 1276 tc 1275
to top
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full
           insert sequence
          Length = 976

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                       
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
           ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 598 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 539

                                                                       
Query: 403 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
           || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 538 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 479

             
Query: 463 tc 464
           ||
Sbjct: 478 tc 477



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                       
Query: 73  agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
           |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 869 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 812

                   
Query: 133 ccgatttt 140
           ||| ||||
Sbjct: 811 ccgttttt 804
to top
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha,
            complete cds
          Length = 1929

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1376 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1317

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1316 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1257

              
Query: 463  tc 464
            ||
Sbjct: 1256 tc 1255



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 73   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1647 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1590

                    
Query: 133  ccgatttt 140
            ||| ||||
Sbjct: 1589 ccgttttt 1582
to top
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence
          Length = 1878

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                        
Query: 375  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 434
            ||||||||||||||||||| ||  |||||| ||||||||| ||  |||||||||||| ||
Sbjct: 1453 tgacagtgggctgtccttgcccatgaggcaggttccctgcctgacgttgcagatggggta 1394

                                       
Query: 435  gttatgagggcagcagctgtagtgatc 461
            || ||| ||||||||||||||||||||
Sbjct: 1393 gtcatgggggcagcagctgtagtgatc 1367
to top
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds
          Length = 1830

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                        
Query: 375  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 434
            ||||||||||||||||||| ||  |||  | ||||||||| ||  |||||||||||| ||
Sbjct: 1418 tgacagtgggctgtccttgcccatgagcgaggttccctgcctgacgttgcagatggggta 1359

                                       
Query: 435  gttatgagggcagcagctgtagtgatc 461
            || ||| ||||||||||||||||||||
Sbjct: 1358 gtcatgggggcagcagctgtagtgatc 1332
to top
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 36/39 (92%), Gaps = 1/39 (2%)
 Strand = Plus / Minus

                                                  
Query: 73  agctgagttttacatatacatatgcaaaagcaaatttgg 111
           |||||| |||||||| || ||||||||||||||||||||
Sbjct: 561 agctgaattttacat-tatatatgcaaaagcaaatttgg 524
to top
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

              
Query: 459 atc 461
           |||
Sbjct: 64  atc 62



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp71)
          Length = 1680

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 418  gtgttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
            ||||||||||||||||||| ||| |||||||| |||||||| |||||
Sbjct: 1260 gtgttgcagatgggatagtcatgggggcagcaactgtagtggtcatc 1214
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 343      ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
                ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 33157603 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 33157652



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                            
Query: 421      ttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
                ||||||||||| || |  ||||||||||||||||||||||||||
Sbjct: 33157777 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatc 33157820



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                            
Query: 73       agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
                |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 33157332 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 33157389

                        
Query: 133      ccgatttt 140
                ||| ||||
Sbjct: 33157390 ccgttttt 33157397
to top
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 343   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 47996 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 48045



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 421   ttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
             ||||||||||| || |  ||||||||||||||||||||||||||
Sbjct: 48170 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatc 48213



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 73    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 47725 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 47782

                     
Query: 133   ccgatttt 140
             ||| ||||
Sbjct: 47783 ccgttttt 47790
to top
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 343   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 40253 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 40302



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 421   ttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
             ||||||||||| || |  ||||||||||||||||||||||||||
Sbjct: 40427 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatc 40470



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 73    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 39982 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 40039

                     
Query: 133   ccgatttt 140
             ||| ||||
Sbjct: 40040 ccgttttt 40047
to top
>gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, complete cds
          Length = 1831

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 406  gttccctgcttggtgttgcagatgggatagttatgagggcagcagct 452
            |||||||| ||  |||||||||||||||||| ||| |||||||||||
Sbjct: 1336 gttccctggttaatgttgcagatgggatagtcatgtgggcagcagct 1290
to top
>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence
          Length = 97953

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 438   atgagggcagcagctgtagtgatcatc 464
             |||||||||||| ||||||||||||||
Sbjct: 70783 atgagggcagcaactgtagtgatcatc 70809
to top
>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence
          Length = 124676

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 438   atgagggcagcagctgtagtgatcatc 464
             |||||||||||| ||||||||||||||
Sbjct: 82072 atgagggcagcaactgtagtgatcatc 82098
to top
>dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease, complete cds
          Length = 1768

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 442  gggcagcagctgtagtgatcatc 464
            |||||||||||||||||||||||
Sbjct: 1395 gggcagcagctgtagtgatcatc 1373
to top
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence
          Length = 202981

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 130   aacccgattttaggattatgtacaggagcat 160
             |||||||||||||||||| | ||||||||||
Sbjct: 65968 aacccgattttaggattaggaacaggagcat 65998
to top
>emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine proteinase, partial
          Length = 995

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 420 gttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
           ||||||||||||||| | ||| |||||||| ||||| || |||||
Sbjct: 599 gttgcagatgggatactcatgtgggcagcaactgtaatggtcatc 555
to top
>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
              complete sequence
          Length = 129478

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 80     ttttacatatacatatgcaaaagca 104
              |||||||| ||||||||||||||||
Sbjct: 119390 ttttacatttacatatgcaaaagca 119414
to top
>gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseudotzain (PM33cysP) mRNA,
            complete cds
          Length = 1882

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 441  agggcagcagctgtagtgatc 461
            |||||||||||||||||||||
Sbjct: 1398 agggcagcagctgtagtgatc 1378
to top
>gb|AC111100.13| Mus musculus chromosome 3, clone RP23-179J8, complete sequence
          Length = 216852

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     cataataacaatggcagctc 55
              ||||||||||||||||||||
Sbjct: 120204 cataataacaatggcagctc 120185
to top
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence
          Length = 235813

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 155    gagcatctattataaagaagatac 178
              ||||||||||||||||| ||||||
Sbjct: 211168 gagcatctattataaaggagatac 211191
to top
>ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen
           11/4 precursor - chicken (LOC426939), mRNA
          Length = 1599

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 159 tatgagggcagcagctgtag 140
to top
>ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen
           11/4 precursor - chicken (LOC425214), partial mRNA
          Length = 1648

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 706 tatgagggcagcagctgtag 687
to top
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds
          Length = 3146

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 144  attatgtacaggagcatctattat 167
            |||| |||||||||||||||||||
Sbjct: 1972 attaggtacaggagcatctattat 1995
to top
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    acatatacatatgcaaaagcaaat 107
             ||||||||||||||||||| ||||
Sbjct: 96777 acatatacatatgcaaaagtaaat 96754
to top
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome
          Length = 85779

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   aaatttggtggttctgtaaa 123
             ||||||||||||||||||||
Sbjct: 41670 aaatttggtggttctgtaaa 41689
to top
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete
              sequence
          Length = 250743

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     atacatatgcaaaagcaaat 107
              ||||||||||||||||||||
Sbjct: 171275 atacatatgcaaaagcaaat 171294
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the
             5' end of the RORB gene for RAR-related orphan receptor B
             protein (RZRB, ROR-BETA), two novel genes and two CpG
             islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 228   gtgatcatttgcagaagttaatca 251
             |||||||||| |||||||||||||
Sbjct: 81873 gtgatcattttcagaagttaatca 81896
to top
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains
             pseudogene similar to part of a novel gene (KIAA1688), a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 6 (SLC25A6) (ANT3)
             pseudogene and a CpG island, complete sequence
          Length = 169550

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    ttttacatatacatatgcaa 99
             ||||||||||||||||||||
Sbjct: 22532 ttttacatatacatatgcaa 22513
to top
>emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for cytochrome B extending
            from map position 71.3 to 80.2. (Strain D273-10B.)
          Length = 6264

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  aaatttggtggttctgtaaa 123
            ||||||||||||||||||||
Sbjct: 1475 aaatttggtggttctgtaaa 1494
to top
>gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion origin of replication (ori6)
            and oli1 gene, complete cds
          Length = 8316

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  aaatttggtggttctgtaaa 123
            ||||||||||||||||||||
Sbjct: 2631 aaatttggtggttctgtaaa 2650
to top
>gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, complete cds
          Length = 765

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 aaatttggtggttctgtaaa 123
           ||||||||||||||||||||
Sbjct: 184 aaatttggtggttctgtaaa 203
to top
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence
          Length = 220673

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 155   gagcatctattataaagaagatac 178
             ||||||||||||||||| ||||||
Sbjct: 75779 gagcatctattataaaggagatac 75802
to top
>gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosome 12, complete
            sequence
          Length = 155367

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   cttgatgaattccataataa 43
            ||||||||||||||||||||
Sbjct: 8995 cttgatgaattccataataa 8976
to top
>gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor, precursor RNA,
           complete cds
          Length = 1940

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 41  tatgagggcagcagctgtag 22
to top
>gb|AC097454.2| Homo sapiens BAC clone RP11-2F17 from 4, complete sequence
          Length = 163486

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    tcatgtttcttgatgaattc 35
             ||||||||||||||||||||
Sbjct: 44937 tcatgtttcttgatgaattc 44918
to top
>gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine protease (PRT15) mRNA,
           partial cds
          Length = 1456

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 421 ttgcagatgggatagttatgagggcagcagctgtagtgatcatc 464
           |||||||| ||| ||| ||| |||||||||||  ||||||||||
Sbjct: 989 ttgcagataggaaagtcatgggggcagcagctagagtgatcatc 946
to top
>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence
          Length = 179835

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     acatatacatatgcaaaagcaaat 107
              ||||||||||||||||||| ||||
Sbjct: 171309 acatatacatatgcaaaagtaaat 171286
to top
>gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:6639837, complete cds
          Length = 5263

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tttacatatacatatgcaaa 100
            ||||||||||||||||||||
Sbjct: 3028 tttacatatacatatgcaaa 3009
to top
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    ttacatatacatatgcaaaa 101
             ||||||||||||||||||||
Sbjct: 66744 ttacatatacatatgcaaaa 66763
to top
>gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complete sequence
          Length = 203428

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     acatatacatatgcaaaagcaaat 107
              |||||||||||| |||||||||||
Sbjct: 152020 acatatacatattcaaaagcaaat 151997
to top
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence
          Length = 151453

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ccctgcttggtgttgcagat 428
             ||||||||||||||||||||
Sbjct: 20107 ccctgcttggtgttgcagat 20126
to top
>emb|CT030189.8| Mouse DNA sequence from clone RP24-402B23 on chromosome 12, complete
             sequence
          Length = 223910

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    cttgatgaattccataataa 43
             ||||||||||||||||||||
Sbjct: 60956 cttgatgaattccataataa 60975
to top
>gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds
          Length = 2080

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 41  tatgagggcagcagctgtag 22
to top
>gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene, intron 4
          Length = 1453

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 aaatttggtggttctgtaaa 123
           ||||||||||||||||||||
Sbjct: 598 aaatttggtggttctgtaaa 617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,317,529
Number of Sequences: 3902068
Number of extensions: 4317529
Number of successful extensions: 83773
Number of sequences better than 10.0: 66
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83556
Number of HSP's gapped (non-prelim): 204
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top