Clone Name | rbart33f09 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA sequence Length = 953 Score = 351 bits (177), Expect = 1e-93 Identities = 198/205 (96%) Strand = Plus / Minus Query: 241 cgcccgtctagacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaga 300 |||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757 Query: 301 cctcgatgcgcgggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagc 360 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 697 Query: 361 gggtgtcgaggtcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcg 420 |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 696 gggtgtcgaggtcggacatgggggtgcccgccggcagcgccaccgtgccgccccagagcg 637 Query: 421 tgttgtcgtagatgatggtgccgcc 445 |||||||||||||||| |||||||| Sbjct: 636 tgttgtcgtagatgatagtgccgcc 612 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 148 aataatacaattgattaagggaagcggctggtaaggaa 185 ||||||||||||||||||| ||||||||||||||||| Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA Length = 996 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 647
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1096 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 654
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1098 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 656
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA20) gene, complete cds Length = 1158 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 1054 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 995 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 994 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 935 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 934 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 876
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA 3-O-methyltransferase, complete cds, clone: 12FPR057 Length = 976 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 802 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 743 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 742 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 683 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 682 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 624
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Plus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 24579635 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 24579694 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 24579695 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 24579754 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 24579755 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 24579813 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 24586412 cagcgccacggacccgccccagagcgtgttgtcgtag 24586448 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Plus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 24586269 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 24586328 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 24586329 gggtcgccggcgatcttggcgttga 24586353 Score = 40.1 bits (20), Expect = 6.0 Identities = 65/80 (81%) Strand = Plus / Plus Query: 257 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732 Query: 317 gacggcgagcttggcgttga 336 | |||||| | ||||||||| Sbjct: 24590733 ggcggcgaccatggcgttga 24590752
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0026F07 Length = 137354 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Plus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 87895 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 87954 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 87955 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 88014 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 88015 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 88073 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 94672 cagcgccacggacccgccccagagcgtgttgtcgtag 94708 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Plus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 94529 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 94588 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 94589 gggtcgccggcgatcttggcgttga 94613 Score = 40.1 bits (20), Expect = 6.0 Identities = 65/80 (81%) Strand = Plus / Plus Query: 257 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992 Query: 317 gacggcgagcttggcgttga 336 | |||||| | ||||||||| Sbjct: 98993 ggcggcgaccatggcgttga 99012
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full insert sequence Length = 1096 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 654
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full insert sequence Length = 996 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 647
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full insert sequence Length = 1098 Score = 188 bits (95), Expect = 1e-44 Identities = 158/179 (88%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775 Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371 |||||| |||||||| ||| |||||||||||||| |||| ||||||| | ||| ||| Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715 Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430 || |||| |||||| ||| ||||||||||||||||||| |||| |||||||||||||| Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 656
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence Length = 1072 Score = 113 bits (57), Expect = 5e-22 Identities = 57/57 (100%) Strand = Plus / Minus Query: 250 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds Length = 607 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 258 cggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcg 317 |||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| |||||| Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302 Query: 318 acggcgagc 326 ||||||||| Sbjct: 301 acggcgagc 293
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA sequence Length = 1078 Score = 67.9 bits (34), Expect = 3e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 315 |||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||| ||| Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815 Query: 316 cgacggcgag 325 || ||||||| Sbjct: 814 cggcggcgag 805
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1136 BP Length = 1136 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 859 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 807
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA sequence Length = 1118 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 860 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 808
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence Length = 1146 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 865 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 813
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1320 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1294 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1242
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1308 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1230
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1236
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1236
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1549 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1544 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1546 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1230
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1273 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1221
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA1) gene, complete cds Length = 1272 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313 |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 1166 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 1107 Query: 314 gtcgacggcgag 325 |||| ||||||| Sbjct: 1106 gtcggcggcgag 1095
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 398 cgccaccgtgccgccccagagcgtgttgtcgtag 431 |||||||| ||||||||| ||||||||||||||| Sbjct: 18420679 cgccaccgagccgccccacagcgtgttgtcgtag 18420712
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313 |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 3314239 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 3314180 Query: 314 gtcgacggcgag 325 |||| ||||||| Sbjct: 3314179 gtcggcggcgag 3314168
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463G11 Length = 154188 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 398 cgccaccgtgccgccccagagcgtgttgtcgtag 431 |||||||| ||||||||| ||||||||||||||| Sbjct: 135415 cgccaccgagccgccccacagcgtgttgtcgtag 135448
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463D04 Length = 145828 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 398 cgccaccgtgccgccccagagcgtgttgtcgtag 431 |||||||| ||||||||| ||||||||||||||| Sbjct: 82553 cgccaccgagccgccccacagcgtgttgtcgtag 82586
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0015I14 Length = 150650 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313 |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 101602 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 101543 Query: 314 gtcgacggcgag 325 |||| ||||||| Sbjct: 101542 gtcggcggcgag 101531
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03 Length = 156054 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313 |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 5793 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 5734 Query: 314 gtcgacggcgag 325 |||| ||||||| Sbjct: 5733 gtcggcggcgag 5722
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full insert sequence Length = 959 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 398 cgccaccgtgccgccccagagcgtgttgtcgtag 431 |||||||| ||||||||| ||||||||||||||| Sbjct: 662 cgccaccgagccgccccacagcgtgttgtcgtag 629
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full insert sequence Length = 1052 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313 |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| ||| | Sbjct: 847 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 788 Query: 314 gtcgacggcgag 325 |||| ||||||| Sbjct: 787 gtcggcggcgag 776
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1167 BP Length = 1167 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 859 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 807
>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA sequence Length = 1018 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 399 gccaccgtgccgccccagagcgtgttgtcgtag 431 ||||| ||||||||||||||||||||||||||| Sbjct: 649 gccacggtgccgccccagagcgtgttgtcgtag 617 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 295 |||||||||||||||| |||| ||| |||||||| | |||||| Sbjct: 796 acgacgcggcggcagagcgtgatgccatcggcgatagggagctg 753
>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA O-methyltransferase, partial cds Length = 875 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 399 gccaccgtgccgccccagagcgtgttgtcgtag 431 ||||| ||||||||||||||||||||||||||| Sbjct: 641 gccacggtgccgccccagagcgtgttgtcgtag 609 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 295 |||||||||||||||| |||| ||| |||||||| | |||||| Sbjct: 788 acgacgcggcggcagagcgtgatgccatcggcgatagggagctg 745
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1094
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1139 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1087
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1094
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1438 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1162 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1110
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1169 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1117
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1442 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1444 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1130
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1130
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1152 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1100
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1147 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1095
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1176 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1124
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||||| |||||||||||| ||| || ||||||||||| ||||| Sbjct: 1173 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1121
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2 mRNA Length = 1149 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 883 gggtcgccggcgatcttggcgttga 859 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtag 764
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA Length = 612 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 608 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 549 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 548 gggtcgccggcgatcttggcgttga 524 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 465 cagcgccacggacccgccccagagcgtgttgtcgtag 429
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA Length = 879 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 875 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 816 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 815 gggtcgccggcgatcttggcgttga 791 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 732 cagcgccacggacccgccccagagcgtgttgtcgtag 696
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full insert sequence Length = 1466 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 1096 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 1037 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 1036 gggtcgccggcgatcttggcgttga 1012 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 953 cagcgccacggacccgccccagagcgtgttgtcgtag 917
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full insert sequence Length = 1149 Score = 50.1 bits (25), Expect = 0.006 Identities = 70/85 (82%) Strand = Plus / Minus Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311 |||| ||||||||||| ||||| |||||||| || | |||||| | |||| | |||| Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884 Query: 312 gggtcgacggcgagcttggcgttga 336 |||||| |||||| ||||||||||| Sbjct: 883 gggtcgccggcgatcttggcgttga 859 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431 ||||||||| | |||||||||||||||||||||||| Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtag 764
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence Length = 976 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 253 cgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagac 301 ||||||||||||| | |||| |||||||||||||||| ||||||||| Sbjct: 778 cgacgcggcggcacagcgtgagcccgtcggcgatggcgacctggcagac 730 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 407 gccgccccagagcgtgttgtcgtag 431 ||||||||| ||||||||||||||| Sbjct: 624 gccgccccacagcgtgttgtcgtag 600
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase, partial cds Length = 622 Score = 46.1 bits (23), Expect = 0.097 Identities = 44/51 (86%) Strand = Plus / Minus Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306 |||||||||||| |||| ||||||| ||| || ||||||||||| ||||| Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcga 337
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15, complete sequence Length = 137357 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 55 ccctctcctctcatcaaatttc 76 |||||||||||||||||||||| Sbjct: 118827 ccctctcctctcatcaaatttc 118848
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02, complete sequence Length = 127642 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 55 ccctctcctctcatcaaatttc 76 |||||||||||||||||||||| Sbjct: 9747 ccctctcctctcatcaaatttc 9768
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 55 ccctctcctctcatcaaatttc 76 |||||||||||||||||||||| Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895
>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full insert sequence Length = 551 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 55 ccctctcctctcatcaaatttc 76 |||||||||||||||||||||| Sbjct: 216 ccctctcctctcatcaaatttc 195
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 408 ccgccccagagcgtgttgtcg 428 ||||||||||||||||||||| Sbjct: 124109 ccgccccagagcgtgttgtcg 124129
>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b gene, partial cds; mitochondrial Length = 800 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 140 cagggaaaaataatacaattg 160 ||||||||||||||||||||| Sbjct: 742 cagggaaaaataatacaattg 722
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the 5' end of the APG5L gene for APG5 autophagy 5-like (S. cerevisiae) and a CpG island, complete sequence Length = 34768 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 aaaaaagtattattgaaaact 103 ||||||||||||||||||||| Sbjct: 11155 aaaaaagtattattgaaaact 11175
>emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in linkage group 25, complete sequence Length = 189554 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 397 gcgccaccgtgccgccccaga 417 ||||||||||||||||||||| Sbjct: 13517 gcgccaccgtgccgccccaga 13537
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29 Length = 303450 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 394 gcagcgccaccgtgccgcccc 414 ||||||||||||||||||||| Sbjct: 294427 gcagcgccaccgtgccgcccc 294447
>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence Length = 178820 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccactcctccctctcctctc 66 |||||||||||||||||||| Sbjct: 73124 ccactcctccctctcctctc 73105
>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence Length = 216585 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 ccactcctccctctcctctc 66 |||||||||||||||||||| Sbjct: 160872 ccactcctccctctcctctc 160891
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence Length = 216191 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 143 ggaaaaataatacaattgattaag 166 ||||||||||| |||||||||||| Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
>gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome Length = 36001 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 gacgcggcggcagatggtga 273 |||||||||||||||||||| Sbjct: 11182 gacgcggcggcagatggtga 11201
>gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1068 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 277 ccggcagcgccaccgtgccg 258
>gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide hydrolase (mpd) gene, complete cds; and insertion sequence IS6100, partial sequence Length = 5231 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 2149 ccggcagcgccaccgtgccg 2130
>gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide hydrolase (mpd) gene, complete cds Length = 1062 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 271 ccggcagcgccaccgtgccg 252
>gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pesticide hydrolase (mpd) gene, complete cds; and insertion sequence IS6100 transposase gene, complete cds Length = 6758 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 3820 ccggcagcgccaccgtgccg 3801
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA26) gene, complete cds Length = 1116 Score = 40.1 bits (20), Expect = 6.0 Identities = 65/80 (81%) Strand = Plus / Minus Query: 257 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948 Query: 317 gacggcgagcttggcgttga 336 | |||||| | ||||||||| Sbjct: 947 ggcggcgaccatggcgttga 928
>gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd1) gene, complete cds Length = 2543 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 987 ccggcagcgccaccgtgccg 968
>gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd2) gene, complete cds Length = 3334 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 1687 ccggcagcgccaccgtgccg 1668
>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence Length = 133237 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 141 agggaaaaataatacaattgatta 164 ||||||||||||||||||| |||| Sbjct: 111187 agggaaaaataatacaatttatta 111164
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cgccggcagcgccaccgtgc 408 |||||||||||||||||||| Sbjct: 1734234 cgccggcagcgccaccgtgc 1734215
>gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion sequence IS6100 transposase (tnpA) gene, complete cds, methyl parathion hydrolase (mpd) and hypothetical protein genes, complete cds, and insertion sequence IS6100 transposase (tnpB) gene, complete cds Length = 6614 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 3254 ccggcagcgccaccgtgccg 3235
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3' end of the KCNN3 gene for potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, a novel gene and the 5' end of the ADAR gene for adenosine deaminase, RNA-specific, complete sequence Length = 173014 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 49 actcctccctctcctctcatcaaa 72 |||||||||||||| ||||||||| Sbjct: 107848 actcctccctctcccctcatcaaa 107871
>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete sequence Length = 26986 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 ccactcctccctctcctctcatca 70 |||||| ||||||||||||||||| Sbjct: 3590 ccactcttccctctcctctcatca 3613
>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part of the FMN2 gene for formin 2, complete sequence Length = 127208 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 actcctccctctcctctcat 68 |||||||||||||||||||| Sbjct: 48178 actcctccctctcctctcat 48159
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 6.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 386 gcccgccggcagcgccaccgtgccgccc 413 |||||||||||||||| ||| ||||||| Sbjct: 4826093 gcccgccggcagcgccgccgcgccgccc 4826120
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5' end of the RORB gene for RAR-related orphan receptor B protein (RZRB, ROR-BETA), two novel genes and two CpG islands, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 tttaagagtacagtacataa 40 |||||||||||||||||||| Sbjct: 106430 tttaagagtacagtacataa 106411
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 319 cggcgagcttggcgttgagg 338 |||||||||||||||||||| Sbjct: 363315 cggcgagcttggcgttgagg 363296
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 257 gcggcggcagatggtgacgccgtc 280 ||||||||||||||||| |||||| Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene Length = 5894 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 322 cgagcttggcgttgaggtccctgagggcggcg 353 |||||||||||||| |||| ||||||||||| Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence Length = 214780 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cactcctccctctcctctca 67 |||||||||||||||||||| Sbjct: 84202 cactcctccctctcctctca 84221
>gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence Length = 15969 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 3753 ccggcagcgccaccgtgccg 3734 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 2431 ccggcagcgccaccgtgccg 2412
>gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds Length = 1053 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 205 ccggcagcgccaccgtgccg 186
>gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds Length = 1014 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 810 ccggcagcgccaccgtgccg 829
>gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds Length = 1023 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 810 ccggcagcgccaccgtgccg 829
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cgccggcagcgccaccgtgc 408 |||||||||||||||||||| Sbjct: 3170008 cgccggcagcgccaccgtgc 3169989
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 299 gacctcgatgcgcgggtcgacggc 322 ||||||||||||||||||| |||| Sbjct: 4035540 gacctcgatgcgcgggtcggcggc 4035517
>gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, complete sequence Length = 7680 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 4643 ccggcagcgccaccgtgccg 4624
>gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydrolase (mpd) gene, complete cds Length = 2191 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 927 ccggcagcgccaccgtgccg 908
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 313 ggtcgacggcgagcttggcg 332 |||||||||||||||||||| Sbjct: 4135815 ggtcgacggcgagcttggcg 4135834 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 389 cgccggcagcgccaccgtgc 408 |||||||||||||||||||| Sbjct: 2819105 cgccggcagcgccaccgtgc 2819124
>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence Length = 148794 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gtttaagagtacagtacata 39 |||||||||||||||||||| Sbjct: 114656 gtttaagagtacagtacata 114637
>gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds Length = 996 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 205 ccggcagcgccaccgtgccg 186
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein, regulatory protein PyrR (pyrR), aspartate carbamoyl transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC) genes, complete cds; and unknown gene Length = 4080 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gacgccgtcggcgatggcga 291 |||||||||||||||||||| Sbjct: 444 gacgccgtcggcgatggcga 425
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 299 gacctcgatgcgcgggtcga 318 |||||||||||||||||||| Sbjct: 3283101 gacctcgatgcgcgggtcga 3283082
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full insert sequence Length = 1895 Score = 40.1 bits (20), Expect = 6.0 Identities = 65/80 (81%) Strand = Plus / Minus Query: 257 gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612 Query: 317 gacggcgagcttggcgttga 336 | |||||| | ||||||||| Sbjct: 1611 ggcggcgaccatggcgttga 1592
>gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insecticide hydrolase (opdB) gene, complete cds Length = 1060 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 264 ccggcagcgccaccgtgccg 245
>gb|J01917.1|ADRCG Adenovirus type 2, complete genome Length = 35937 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 gacgcggcggcagatggtga 273 |||||||||||||||||||| Sbjct: 11163 gacgcggcggcagatggtga 11182
>gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete sequence Length = 4392 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 gacgcggcggcagatggtga 273 |||||||||||||||||||| Sbjct: 1333 gacgcggcggcagatggtga 1352
>gb|AY029773.1| Pseudomonas putida methyl parathion-degrading protein gene, complete cds Length = 1026 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ccggcagcgccaccgtgccg 410 |||||||||||||||||||| Sbjct: 235 ccggcagcgccaccgtgccg 216 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,674,386 Number of Sequences: 3902068 Number of extensions: 3674386 Number of successful extensions: 89302 Number of sequences better than 10.0: 155 Number of HSP's better than 10.0 without gapping: 155 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 87906 Number of HSP's gapped (non-prelim): 1379 length of query: 445 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 423 effective length of database: 17,147,199,772 effective search space: 7253265503556 effective search space used: 7253265503556 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)