ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart33f09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full... 351 1e-93
2ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA 188 1e-44
3ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group... 188 1e-44
4ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group... 188 1e-44
5gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 188 1e-44
6dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for ... 188 1e-44
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 188 1e-44
8dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic D... 188 1e-44
9dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
10dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
11dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
12gb|AY108449.1| Zea mays PCO131734 mRNA sequence 113 5e-22
13gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase m... 82 2e-12
14gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full ... 68 3e-08
15emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyl... 66 1e-07
16gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full ... 66 1e-07
17gb|AY104406.1| Zea mays PCO108855 mRNA sequence 66 1e-07
18gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methy... 66 1e-07
19gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-met... 66 1e-07
20gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-meth... 66 1e-07
21gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-m... 66 1e-07
22gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3... 66 1e-07
23gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3... 66 1e-07
24gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltr... 66 1e-07
25gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltra... 66 1e-07
26gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) ... 66 1e-07
27gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line)... 66 1e-07
28gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltran... 66 1e-07
29gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltra... 66 1e-07
30gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltran... 66 1e-07
31gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltran... 66 1e-07
32gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-met... 66 1e-07
33gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltrans... 66 1e-07
34gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-meth... 66 1e-07
35gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltrans... 66 1e-07
36gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltra... 66 1e-07
37gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltr... 66 1e-07
38gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltran... 66 1e-07
39gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltra... 66 1e-07
40gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methylt... 66 1e-07
41gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methylt... 66 1e-07
42gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltrans... 66 1e-07
43gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltrans... 66 1e-07
44gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltra... 66 1e-07
45gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltr... 66 1e-07
46gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltr... 66 1e-07
47gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltra... 66 1e-07
48gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltra... 66 1e-07
49gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltran... 66 1e-07
50gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltra... 66 1e-07
51gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltra... 66 1e-07
52gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 64 4e-07
53dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
54dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
55dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
56dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
57dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
58dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
59dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
60dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
61emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyl... 58 3e-05
62gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full... 58 3e-05
63dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffe... 58 3e-05
64gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
65gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
66gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (... 58 3e-05
67gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferas... 58 3e-05
68gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (c... 58 3e-05
69gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransfera... 58 3e-05
70gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransf... 58 3e-05
71gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransfe... 58 3e-05
72gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
73gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase... 58 3e-05
74gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase... 58 3e-05
75gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (... 58 3e-05
76gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (... 58 3e-05
77gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (... 58 3e-05
78gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferas... 58 3e-05
79gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
80gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
81gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferas... 58 3e-05
82gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase... 58 3e-05
83gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase... 58 3e-05
84gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
85gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (c... 58 3e-05
86gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
87gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase ... 58 3e-05
88gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (... 58 3e-05
89gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransfer... 58 3e-05
90gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransf... 58 3e-05
91gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransfe... 58 3e-05
92gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltran... 58 3e-05
93gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyl... 58 3e-05
94gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransfe... 58 3e-05
95gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransfe... 58 3e-05
96ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.006
97ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.006
98ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.006
99dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
100dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
101gb|AY104670.1| Zea mays PCO117754 mRNA sequence 50 0.006
102dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O... 46 0.097
103gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.38
104gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.38
105dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
106dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.38
107gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 1.5
108gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543... 42 1.5
109emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chr... 42 1.5
110emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in... 42 1.5
111emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 42 1.5
112gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, c... 40 6.0
113gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosom... 40 6.0
114gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, co... 40 6.0
115gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome 40 6.0
116gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydro... 40 6.0
117gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide h... 40 6.0
118gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide h... 40 6.0
119gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide h... 40 6.0
120gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide h... 40 6.0
121gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide ... 40 6.0
122gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pestici... 40 6.0
123gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 40 6.0
124gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase... 40 6.0
125gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase... 40 6.0
126gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete... 40 6.0
127gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 6.0
128gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion se... 40 6.0
129emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chr... 40 6.0
130emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chrom... 40 6.0
131emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chro... 40 6.0
132gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.0
133emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 6.0
134gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 6.0
135gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 6.0
136emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin hea... 40 6.0
137gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, comp... 40 6.0
138gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence 40 6.0
139gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds 40 6.0
140gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds 40 6.0
141gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds 40 6.0
142gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.0
143dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 6.0
144gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, comp... 40 6.0
145gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydro... 40 6.0
146gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.0
147gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, comp... 40 6.0
148gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds 40 6.0
149gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical... 40 6.0
150dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.0
151dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
152gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insectici... 40 6.0
153gb|J01917.1|ADRCG Adenovirus type 2, complete genome 40 6.0
154gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete seq... 40 6.0
155gb|AY029773.1| Pseudomonas putida methyl parathion-degrading pro... 40 6.0 
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA
           sequence
          Length = 953

 Score =  351 bits (177), Expect = 1e-93
 Identities = 198/205 (96%)
 Strand = Plus / Minus

                                                                       
Query: 241 cgcccgtctagacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaga 300
           |||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757

                                                                       
Query: 301 cctcgatgcgcgggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagc 360
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 697

                                                                       
Query: 361 gggtgtcgaggtcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcg 420
           |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||
Sbjct: 696 gggtgtcgaggtcggacatgggggtgcccgccggcagcgccaccgtgccgccccagagcg 637

                                    
Query: 421 tgttgtcgtagatgatggtgccgcc 445
           |||||||||||||||| ||||||||
Sbjct: 636 tgttgtcgtagatgatagtgccgcc 612



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 148 aataatacaattgattaagggaagcggctggtaaggaa 185
           |||||||||||||||||||  |||||||||||||||||
Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
to top
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 996

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 647
to top
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1096

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 654
to top
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1098

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 656
to top
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA20) gene, complete cds
          Length = 1158

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                        
Query: 252  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
            |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 1054 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 995

                                                                        
Query: 312  gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
            |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 994  gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 935

                                                                       
Query: 372  tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
            || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 934  tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 876
to top
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA
           3-O-methyltransferase, complete cds, clone: 12FPR057
          Length = 976

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 802 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 743

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 742 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 683

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 682 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 624
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Plus

                                                                            
Query: 252      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
                |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 24579635 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 24579694

                                                                            
Query: 312      gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
                |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 24579695 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 24579754

                                                                           
Query: 372      tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
                || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 24579755 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 24579813



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                     
Query: 395      cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
                ||||||||| |  ||||||||||||||||||||||||
Sbjct: 24586412 cagcgccacggacccgccccagagcgtgttgtcgtag 24586448



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                            
Query: 252      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
                |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 24586269 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 24586328

                                         
Query: 312      gggtcgacggcgagcttggcgttga 336
                |||||| |||||| |||||||||||
Sbjct: 24586329 gggtcgccggcgatcttggcgttga 24586353



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                            
Query: 257      gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
                ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732

                                    
Query: 317      gacggcgagcttggcgttga 336
                | |||||| | |||||||||
Sbjct: 24590733 ggcggcgaccatggcgttga 24590752
to top
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0026F07
          Length = 137354

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Plus

                                                                         
Query: 252   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
             |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 87895 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 87954

                                                                         
Query: 312   gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
             |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 87955 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 88014

                                                                        
Query: 372   tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
             || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 88015 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 88073



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 395   cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
             ||||||||| |  ||||||||||||||||||||||||
Sbjct: 94672 cagcgccacggacccgccccagagcgtgttgtcgtag 94708



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
             |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 94529 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 94588

                                      
Query: 312   gggtcgacggcgagcttggcgttga 336
             |||||| |||||| |||||||||||
Sbjct: 94589 gggtcgccggcgatcttggcgttga 94613



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                         
Query: 257   gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
             ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992

                                 
Query: 317   gacggcgagcttggcgttga 336
             | |||||| | |||||||||
Sbjct: 98993 ggcggcgaccatggcgttga 99012
to top
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full
           insert sequence
          Length = 1096

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 713

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 712 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 654
to top
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full
           insert sequence
          Length = 996

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 706

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 705 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 647
to top
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full
           insert sequence
          Length = 1098

 Score =  188 bits (95), Expect = 1e-44
 Identities = 158/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                                                       
Query: 312 gggtcgacggcgagcttggcgttgaggtccctgagggcggcggagaagcgggtgtcgagg 371
           |||||| |||||||| ||| |||||||||||||| |||| ||||||| |    ||| |||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccagg 715

                                                                      
Query: 372 tcggacaagggcgtgcccgccggcagcgccaccgtgccgccccagagcgtgttgtcgta 430
           || ||||  |||||| ||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 714 tccgacagcggcgtgtccggcggcagcgccaccgtgccggcccacagcgtgttgtcgta 656
to top
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence
          Length = 1072

 Score =  113 bits (57), Expect = 5e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                    
Query: 250 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766
to top
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds
          Length = 607

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcg 317
           |||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| ||||||
Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302

                    
Query: 318 acggcgagc 326
           |||||||||
Sbjct: 301 acggcgagc 293
to top
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA
           sequence
          Length = 1078

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 315
           |||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||| |||
Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815

                     
Query: 316 cgacggcgag 325
           || |||||||
Sbjct: 814 cggcggcgag 805
to top
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1136 BP
          Length = 1136

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 859 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 807
to top
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA
           sequence
          Length = 1118

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 860 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 808
to top
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence
          Length = 1146

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 865 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 813
to top
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1320

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1294 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1242
to top
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
to top
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1308

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1230
to top
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1236
to top
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
to top
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
to top
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
to top
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
to top
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
to top
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1309

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
to top
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1236
to top
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
to top
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1537

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1549

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1233
to top
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1544

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
to top
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1546

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1230
to top
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1537

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1273 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1221
to top
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1220
to top
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1306

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
to top
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1231
to top
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            |||||||||||||| ||||||||||||| ||| || ||||||||||| |||||
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcga 1228
to top
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA1) gene, complete cds
          Length = 1272

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 1166 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 1107

                        
Query: 314  gtcgacggcgag 325
            |||| |||||||
Sbjct: 1106 gtcggcggcgag 1095
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 255      acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
                |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 398      cgccaccgtgccgccccagagcgtgttgtcgtag 431
                |||||||| ||||||||| |||||||||||||||
Sbjct: 18420679 cgccaccgagccgccccacagcgtgttgtcgtag 18420712
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                           
Query: 254     gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
               |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 3314239 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 3314180

                           
Query: 314     gtcgacggcgag 325
               |||| |||||||
Sbjct: 3314179 gtcggcggcgag 3314168
to top
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463G11
          Length = 154188

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 255    acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
              |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                
Query: 398    cgccaccgtgccgccccagagcgtgttgtcgtag 431
              |||||||| ||||||||| |||||||||||||||
Sbjct: 135415 cgccaccgagccgccccacagcgtgttgtcgtag 135448
to top
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0463D04
          Length = 145828

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 255   acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
             |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 398   cgccaccgtgccgccccagagcgtgttgtcgtag 431
             |||||||| ||||||||| |||||||||||||||
Sbjct: 82553 cgccaccgagccgccccacagcgtgttgtcgtag 82586
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0015I14
          Length = 150650

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                          
Query: 254    gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
              |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 101602 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 101543

                          
Query: 314    gtcgacggcgag 325
              |||| |||||||
Sbjct: 101542 gtcggcggcgag 101531
to top
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone P0680A03
          Length = 156054

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 5793 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 5734

                        
Query: 314  gtcgacggcgag 325
            |||| |||||||
Sbjct: 5733 gtcggcggcgag 5722
to top
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full
           insert sequence
          Length = 959

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
           |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 398 cgccaccgtgccgccccagagcgtgttgtcgtag 431
           |||||||| ||||||||| |||||||||||||||
Sbjct: 662 cgccaccgagccgccccacagcgtgttgtcgtag 629
to top
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full
           insert sequence
          Length = 1052

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 847 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 788

                       
Query: 314 gtcgacggcgag 325
           |||| |||||||
Sbjct: 787 gtcggcggcgag 776
to top
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1167 BP
          Length = 1167

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 859 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 807
to top
>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA
           sequence
          Length = 1018

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 399 gccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||| |||||||||||||||||||||||||||
Sbjct: 649 gccacggtgccgccccagagcgtgttgtcgtag 617



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 295
           ||||||||||||||||  |||| ||| |||||||| | ||||||
Sbjct: 796 acgacgcggcggcagagcgtgatgccatcggcgatagggagctg 753
to top
>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA
           O-methyltransferase, partial cds
          Length = 875

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 399 gccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||| |||||||||||||||||||||||||||
Sbjct: 641 gccacggtgccgccccagagcgtgttgtcgtag 609



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 295
           ||||||||||||||||  |||| ||| |||||||| | ||||||
Sbjct: 788 acgacgcggcggcagagcgtgatgccatcggcgatagggagctg 745
to top
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
to top
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
to top
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
to top
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1094
to top
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1145

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1139 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1087
to top
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
to top
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1222

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
to top
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1209

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
to top
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
to top
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
to top
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1094
to top
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1438

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1162 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1110
to top
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1451

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1169 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1117
to top
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1442

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1444

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1463

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1130
to top
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1464

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1130
to top
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1434

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1152 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1100
to top
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
to top
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1092
to top
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
to top
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1147 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1095
to top
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1182

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1176 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1124
to top
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1206

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1104
to top
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1172

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase
            (ccoaomt2) gene, complete cds
          Length = 1172

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1114
to top
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1181

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1078
to top
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1451

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
            ||||||||||||||  |||||||||||| ||| || ||||||||||| |||||
Sbjct: 1173 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcga 1121
to top
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2
           mRNA
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 312 gggtcgacggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtag 764
to top
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 608 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 549

                                    
Query: 312 gggtcgacggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 548 gggtcgccggcgatcttggcgttga 524



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 465 cagcgccacggacccgccccagagcgtgttgtcgtag 429
to top
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 879

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 875 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 816

                                    
Query: 312 gggtcgacggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 815 gggtcgccggcgatcttggcgttga 791



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 732 cagcgccacggacccgccccagagcgtgttgtcgtag 696
to top
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full
            insert sequence
          Length = 1466

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
            |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 1096 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 1037

                                     
Query: 312  gggtcgacggcgagcttggcgttga 336
            |||||| |||||| |||||||||||
Sbjct: 1036 gggtcgccggcgatcttggcgttga 1012



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 953 cagcgccacggacccgccccagagcgtgttgtcgtag 917
to top
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full
           insert sequence
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 312 gggtcgacggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 395 cagcgccaccgtgccgccccagagcgtgttgtcgtag 431
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 800 cagcgccacggacccgccccagagcgtgttgtcgtag 764
to top
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence
          Length = 976

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 253 cgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagac 301
           ||||||||||||| |  ||||  |||||||||||||||| |||||||||
Sbjct: 778 cgacgcggcggcacagcgtgagcccgtcggcgatggcgacctggcagac 730



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 407 gccgccccagagcgtgttgtcgtag 431
           ||||||||| |||||||||||||||
Sbjct: 624 gccgccccacagcgtgttgtcgtag 600
to top
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase,
           partial cds
          Length = 622

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           ||||||||||||  |||| ||||||| ||| || ||||||||||| |||||
Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcga 337
to top
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15,
              complete sequence
          Length = 137357

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 55     ccctctcctctcatcaaatttc 76
              ||||||||||||||||||||||
Sbjct: 118827 ccctctcctctcatcaaatttc 118848
to top
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02,
            complete sequence
          Length = 127642

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 55   ccctctcctctcatcaaatttc 76
            ||||||||||||||||||||||
Sbjct: 9747 ccctctcctctcatcaaatttc 9768
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 55       ccctctcctctcatcaaatttc 76
                ||||||||||||||||||||||
Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895
to top
>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full
           insert sequence
          Length = 551

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 55  ccctctcctctcatcaaatttc 76
           ||||||||||||||||||||||
Sbjct: 216 ccctctcctctcatcaaatttc 195
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 408    ccgccccagagcgtgttgtcg 428
              |||||||||||||||||||||
Sbjct: 124109 ccgccccagagcgtgttgtcg 124129
to top
>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b
           gene, partial cds; mitochondrial
          Length = 800

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 140 cagggaaaaataatacaattg 160
           |||||||||||||||||||||
Sbjct: 742 cagggaaaaataatacaattg 722
to top
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the
             5' end of the APG5L gene for APG5 autophagy 5-like (S.
             cerevisiae) and a CpG island, complete sequence
          Length = 34768

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    aaaaaagtattattgaaaact 103
             |||||||||||||||||||||
Sbjct: 11155 aaaaaagtattattgaaaact 11175
to top
>emb|BX004812.8| Zebrafish DNA sequence from clone CH211-201M7 in linkage group 25,
             complete sequence
          Length = 189554

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 397   gcgccaccgtgccgccccaga 417
             |||||||||||||||||||||
Sbjct: 13517 gcgccaccgtgccgccccaga 13537
to top
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 394    gcagcgccaccgtgccgcccc 414
              |||||||||||||||||||||
Sbjct: 294427 gcagcgccaccgtgccgcccc 294447
to top
>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence
          Length = 178820

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ccactcctccctctcctctc 66
             ||||||||||||||||||||
Sbjct: 73124 ccactcctccctctcctctc 73105
to top
>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence
          Length = 216585

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ccactcctccctctcctctc 66
              ||||||||||||||||||||
Sbjct: 160872 ccactcctccctctcctctc 160891
to top
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence
          Length = 216191

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 143    ggaaaaataatacaattgattaag 166
              ||||||||||| ||||||||||||
Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
to top
>gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome
          Length = 36001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   gacgcggcggcagatggtga 273
             ||||||||||||||||||||
Sbjct: 11182 gacgcggcggcagatggtga 11201
to top
>gb|AY627039.1| Brucella sp. mp-7 organophosphate pesticide hydrolase (mpd) gene,
           complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627038.1| Ochrobactrum sp. mp-6 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627037.1| Ochrobactrum sp. mp-5 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627036.1| Ochrobactrum sp. mp-4 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1068

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 277 ccggcagcgccaccgtgccg 258
to top
>gb|AY627035.1| Ochrobactrum sp. mp-3 organophosphate pesticide hydrolase (mpd) gene,
            complete cds; and insertion sequence IS6100, partial
            sequence
          Length = 5231

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 2149 ccggcagcgccaccgtgccg 2130
to top
>gb|AY627034.1| Achromobacter sp. mp-2 organophosphate pesticide hydrolase (mpd)
           gene, complete cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 271 ccggcagcgccaccgtgccg 252
to top
>gb|AY627033.1| Pseudaminobacter sp. mp-1 organophosphate pesticide hydrolase (mpd)
            gene, complete cds; and insertion sequence IS6100
            transposase gene, complete cds
          Length = 6758

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 3820 ccggcagcgccaccgtgccg 3801
to top
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA26) gene, complete cds
          Length = 1116

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 257  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948

                                
Query: 317  gacggcgagcttggcgttga 336
            | |||||| | |||||||||
Sbjct: 947  ggcggcgaccatggcgttga 928
to top
>gb|DQ173275.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd1) gene,
           complete cds
          Length = 2543

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 987 ccggcagcgccaccgtgccg 968
to top
>gb|DQ173274.1| Burkholderia sp. FDS-1 methyl parathion hydrolase (mpd2) gene,
            complete cds
          Length = 3334

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 1687 ccggcagcgccaccgtgccg 1668
to top
>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence
          Length = 133237

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 141    agggaaaaataatacaattgatta 164
              ||||||||||||||||||| ||||
Sbjct: 111187 agggaaaaataatacaatttatta 111164
to top
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 389     cgccggcagcgccaccgtgc 408
               ||||||||||||||||||||
Sbjct: 1734234 cgccggcagcgccaccgtgc 1734215
to top
>gb|AY251554.2| Pseudomonas sp. WBC-3 transposon mph insertion sequence IS6100
            transposase (tnpA) gene, complete cds, methyl parathion
            hydrolase (mpd) and hypothetical protein genes, complete
            cds, and insertion sequence IS6100 transposase (tnpB)
            gene, complete cds
          Length = 6614

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 3254 ccggcagcgccaccgtgccg 3235
to top
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3'
              end of the KCNN3 gene for potassium intermediate/small
              conductance calcium-activated channel, subfamily N, member
              3, a novel gene and the 5' end of the ADAR gene for
              adenosine deaminase, RNA-specific, complete sequence
          Length = 173014

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 49     actcctccctctcctctcatcaaa 72
              |||||||||||||| |||||||||
Sbjct: 107848 actcctccctctcccctcatcaaa 107871
to top
>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete
            sequence
          Length = 26986

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   ccactcctccctctcctctcatca 70
            |||||| |||||||||||||||||
Sbjct: 3590 ccactcttccctctcctctcatca 3613
to top
>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part
             of the FMN2 gene for formin 2, complete sequence
          Length = 127208

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    actcctccctctcctctcat 68
             ||||||||||||||||||||
Sbjct: 48178 actcctccctctcctctcat 48159
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 386     gcccgccggcagcgccaccgtgccgccc 413
               |||||||||||||||| ||| |||||||
Sbjct: 4826093 gcccgccggcagcgccgccgcgccgccc 4826120
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5'
              end of the RORB gene for RAR-related orphan receptor B
              protein (RZRB, ROR-BETA), two novel genes and two CpG
              islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     tttaagagtacagtacataa 40
              ||||||||||||||||||||
Sbjct: 106430 tttaagagtacagtacataa 106411
to top
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 319    cggcgagcttggcgttgagg 338
              ||||||||||||||||||||
Sbjct: 363315 cggcgagcttggcgttgagg 363296
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 257    gcggcggcagatggtgacgccgtc 280
              ||||||||||||||||| ||||||
Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
to top
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene
          Length = 5894

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 322  cgagcttggcgttgaggtccctgagggcggcg 353
            ||||||||||||||  |||| |||||||||||
Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
to top
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence
          Length = 214780

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    cactcctccctctcctctca 67
             ||||||||||||||||||||
Sbjct: 84202 cactcctccctctcctctca 84221
to top
>gb|DQ092437.1| Insertion vector pWSMK-T, complete sequence
          Length = 15969

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 3753 ccggcagcgccaccgtgccg 3734



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 2431 ccggcagcgccaccgtgccg 2412
to top
>gb|DQ356953.1| Sphingomonas sp. Dsp-2 mpd gene, complete cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 205 ccggcagcgccaccgtgccg 186
to top
>gb|DQ356952.1| Pseudomonas sp. Dsp-1 mpd gene, complete cds
          Length = 1014

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 810 ccggcagcgccaccgtgccg 829
to top
>gb|DQ356951.1| Stenotrophomonas sp. Dsp-4 mpd gene, complete cds
          Length = 1023

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 810 ccggcagcgccaccgtgccg 829
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 389     cgccggcagcgccaccgtgc 408
               ||||||||||||||||||||
Sbjct: 3170008 cgccggcagcgccaccgtgc 3169989
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 299     gacctcgatgcgcgggtcgacggc 322
               ||||||||||||||||||| ||||
Sbjct: 4035540 gacctcgatgcgcgggtcggcggc 4035517
to top
>gb|DQ264732.1| Shuttle expression-secretion vector pP43NMK, complete sequence
          Length = 7680

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  ccggcagcgccaccgtgccg 410
            ||||||||||||||||||||
Sbjct: 4643 ccggcagcgccaccgtgccg 4624
to top
>gb|AF338729.1|AF338729 Plesiomonas sp. M6 methyl parathion hydrolase (mpd) gene, complete
           cds
          Length = 2191

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 927 ccggcagcgccaccgtgccg 908
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 313     ggtcgacggcgagcttggcg 332
               ||||||||||||||||||||
Sbjct: 4135815 ggtcgacggcgagcttggcg 4135834



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 389     cgccggcagcgccaccgtgc 408
               ||||||||||||||||||||
Sbjct: 2819105 cgccggcagcgccaccgtgc 2819124
to top
>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence
          Length = 148794

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     gtttaagagtacagtacata 39
              ||||||||||||||||||||
Sbjct: 114656 gtttaagagtacagtacata 114637
to top
>gb|DQ001540.1| Burkholderia cepacia MpdB gene, complete cds
          Length = 996

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 205 ccggcagcgccaccgtgccg 186
to top
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein,
           regulatory protein PyrR (pyrR), aspartate carbamoyl
           transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC)
           genes, complete cds; and unknown gene
          Length = 4080

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 272 gacgccgtcggcgatggcga 291
           ||||||||||||||||||||
Sbjct: 444 gacgccgtcggcgatggcga 425
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 299     gacctcgatgcgcgggtcga 318
               ||||||||||||||||||||
Sbjct: 3283101 gacctcgatgcgcgggtcga 3283082
to top
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full
            insert sequence
          Length = 1895

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 257  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612

                                
Query: 317  gacggcgagcttggcgttga 336
            | |||||| | |||||||||
Sbjct: 1611 ggcggcgaccatggcgttga 1592
to top
>gb|AY646835.2| Burkholderia sp. FDS-1 organophosphorus insecticide hydrolase
           (opdB) gene, complete cds
          Length = 1060

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 264 ccggcagcgccaccgtgccg 245
to top
>gb|J01917.1|ADRCG Adenovirus type 2, complete genome
          Length = 35937

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   gacgcggcggcagatggtga 273
             ||||||||||||||||||||
Sbjct: 11163 gacgcggcggcagatggtga 11182
to top
>gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete sequence
          Length = 4392

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  gacgcggcggcagatggtga 273
            ||||||||||||||||||||
Sbjct: 1333 gacgcggcggcagatggtga 1352
to top
>gb|AY029773.1| Pseudomonas putida methyl parathion-degrading protein gene,
           complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 ccggcagcgccaccgtgccg 410
           ||||||||||||||||||||
Sbjct: 235 ccggcagcgccaccgtgccg 216


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,674,386
Number of Sequences: 3902068
Number of extensions: 3674386
Number of successful extensions: 89302
Number of sequences better than 10.0: 155
Number of HSP's better than 10.0 without gapping: 155
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87906
Number of HSP's gapped (non-prelim): 1379
length of query: 445
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 423
effective length of database: 17,147,199,772
effective search space: 7253265503556
effective search space used: 7253265503556
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top