>ref|XM_760893.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_0466) partial mRNA
          Length = 8583

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 165  taatcaatttcagagagttta 185
            |||||||||||||||||||||
Sbjct: 4898 taatcaatttcagagagttta 4878

>gb|AC096755.2| Homo sapiens BAC clone RP11-519M16 from 4, complete sequence
          Length = 182440

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aactggacttaaaaatttgct 69
              |||||||||||||||||||||
Sbjct: 175821 aactggacttaaaaatttgct 175801

>gb|AC150428.3| Branchiostoma floridae clone CH302-86J11, complete sequence
          Length = 193518

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 131  tcatcataaattcttcttca 150
            ||||||||||||||||||||
Sbjct: 6039 tcatcataaattcttcttca 6020

>gb|AC129591.4| Mus musculus BAC clone RP24-510A3 from chromosome 14, complete sequence
          Length = 176214

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    tttgctgaggacaggaggaa 83
             ||||||||||||||||||||
Sbjct: 85177 tttgctgaggacaggaggaa 85158

>ref|XM_805678.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511605.20) partial mRNA
          Length = 1128

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 73  gacaggaggaacatgaggaa 92
           ||||||||||||||||||||
Sbjct: 335 gacaggaggaacatgaggaa 354

>emb|AL161901.18| Human DNA sequence from clone RP11-521H3 on chromosome 13 Contains a
             novel gene and a eukaryotic translation initiation factor
             4A, variant 1 (EIF4A1) pseudogene, complete sequence
          Length = 150054

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   ttcatcataaattcttcttc 149
             ||||||||||||||||||||
Sbjct: 44193 ttcatcataaattcttcttc 44212

>gb|AC007112.6| Arabidopsis thaliana chromosome 2 clone F24C20 map mi398, complete
             sequence
          Length = 96371

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   tcatcataaattcttcttca 150
             ||||||||||||||||||||
Sbjct: 36369 tcatcataaattcttcttca 36350

>emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in linkage group 4,
             complete sequence
          Length = 182374

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    ttttgaagtttggattgcaa 50
             ||||||||||||||||||||
Sbjct: 30014 ttttgaagtttggattgcaa 30033

>gb|AC150390.2| Branchiostoma floridae clone CH302-115N8, complete sequence
          Length = 230518

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   tcatcataaattcttcttca 150
             ||||||||||||||||||||
Sbjct: 41489 tcatcataaattcttcttca 41470


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,117,733
Number of Sequences: 3902068
Number of extensions: 2117733
Number of successful extensions: 136302
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 136280
Number of HSP's gapped (non-prelim): 22
length of query: 218
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 196
effective length of database: 17,147,199,772
effective search space: 3360851155312
effective search space used: 3360851155312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)