Clone Name	rbart33f06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr...	414	e-112
2	gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote...	406	e-110
3	gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote...	402	e-109
4	gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote...	391	e-105
5	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	297	2e-77
6	dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D...	297	2e-77
7	dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D...	297	2e-77
8	dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
9	dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
10	dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
11	dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
12	dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
13	dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon...	297	2e-77
14	dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon...	289	4e-75
15	dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon...	289	4e-75
16	gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot...	159	1e-35
17	gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot...	157	4e-35
18	gb|AY105015.1| Zea mays PCO137646 mRNA sequence	157	4e-35
19	ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA	153	6e-34
20	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
21	dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
22	dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
23	dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR...	153	6e-34
24	dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon...	153	6e-34
25	emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro...	153	6e-34
26	gb|AY106931.1| Zea mays PCO140073 mRNA sequence	133	6e-28
27	gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN...	133	6e-28
28	gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds	125	1e-25
29	gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot...	125	1e-25
30	emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein	121	2e-24
31	emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein	115	1e-22
32	ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic...	101	2e-18
33	emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,...	101	2e-18
34	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	101	2e-18
35	gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr...	100	8e-18
36	ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic...	98	3e-17
37	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
38	dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
39	dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
40	dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
41	dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR...	98	3e-17
42	emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative...	96	1e-16
43	gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c...	96	1e-16
44	gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote...	96	1e-16
45	gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat...	92	2e-15
46	ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic...	88	3e-14
47	gb|BT016300.1| Zea mays clone Contig133 mRNA sequence	88	3e-14
48	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	88	3e-14
49	gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon...	88	3e-14
50	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	88	3e-14
51	dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com...	88	3e-14
52	dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
53	dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
54	dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
55	dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
56	dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
57	gb|AY104464.1| Zea mays PCO114899 mRNA sequence	88	3e-14
58	gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT...	88	3e-14
59	emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo...	84	5e-13
60	gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot...	74	5e-10
61	gb|AY112388.1| Zea mays CL24208_1 mRNA sequence	74	5e-10
62	gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int...	64	5e-07
63	gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot...	62	2e-06
64	ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822...	60	7e-06
65	gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2...	60	7e-06
66	dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D...	60	7e-06
67	dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	7e-06
68	ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT...	58	3e-05
69	gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds	58	3e-05
70	gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds	58	3e-05
71	gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi...	58	3e-05
72	gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann...	58	3e-05
73	dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	58	3e-05
74	dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl...	58	3e-05
75	gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot...	56	1e-04
76	gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds	56	1e-04
77	dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds	56	1e-04
78	ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A...	52	0.002
79	ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron...	52	0.002
80	gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr...	52	0.002
81	gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr...	52	0.002
82	emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co...	52	0.002
83	emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co...	52	0.002
84	emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co...	52	0.002
85	gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s...	52	0.002
86	dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	52	0.002
87	gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr...	52	0.002
88	dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds	50	0.007
89	emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic...	48	0.027
90	emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla...	48	0.027
91	gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot...	48	0.027
92	dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsi...	48	0.027
93	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	48	0.027
94	ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.11
95	gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome...	46	0.11
96	emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,...	46	0.11
97	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	46	0.11
98	dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.11
99	dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.11
100	ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori...	44	0.42
101	ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori...	44	0.42
102	emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonopl...	44	0.42
103	dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds	44	0.42
104	dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds	44	0.42
105	dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds	44	0.42
106	ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water c...	42	1.7
107	gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence	42	1.7
108	ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), ...	42	1.7
109	ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA	42	1.7
110	ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori...	42	1.7
111	emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 ...	42	1.7
112	gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major in...	42	1.7
113	gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like pr...	42	1.7
114	emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ...	42	1.7
115	emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like pr...	42	1.7
116	emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ...	42	1.7
117	gb|AC183494.1| Brassica oleracea Contig C, complete sequence	42	1.7
118	gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, comp...	42	1.7
119	gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mR...	42	1.7
120	dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	42	1.7
121	emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Co...	42	1.7
122	emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Co...	42	1.7
123	gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete s...	42	1.7
124	emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquapor...	42	1.7
125	gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP...	42	1.7
126	gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRN...	42	1.7
127	gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple...	42	1.7
128	ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA	42	1.7
129	dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds	42	1.7
130	ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A...	40	6.6
131	gb|AC165149.5| Mus musculus BAC clone RP24-114C10 from chromosom...	40	6.6
132	ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A...	40	6.6
133	ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A...	40	6.6
134	gb|AC121551.11| Mus musculus chromosome 1, clone RP24-144H23, co...	40	6.6
135	gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet...	40	6.6
136	ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical...	40	6.6
137	gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete se...	40	6.6
138	gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosom...	40	6.6
139	emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p...	40	6.6
140	gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683...	40	6.6
141	gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic...	40	6.6
142	emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene	40	6.6
143	gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A),...	40	6.6
144	gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A),...	40	6.6
145	emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to...	40	6.6
146	gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome	40	6.6
147	dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788	40	6.6
148	gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, c...	40	6.6
149	gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ...	40	6.6
150	gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ...	40	6.6
151	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	40	6.6
152	emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co...	40	6.6
153	emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co...	40	6.6
154	emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co...	40	6.6
155	emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co...	40	6.6
156	emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co...	40	6.6
157	emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co...	40	6.6
158	emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co...	40	6.6
159	emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co...	40	6.6
160	emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co...	40	6.6
161	gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	6.6
162	gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, compl...	40	6.6
163	gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s...	40	6.6
164	gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth...	40	6.6
165	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	6.6
166	dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri...	40	6.6
167	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	40	6.6
168	emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl...	40	6.6
169	tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ...	40	6.6
170	gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro...	40	6.6

---

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  414 bits (209), Expect = e-112
 Identities = 336/379 (88%), Gaps = 17/379 (4%)
 Strand = Plus / Minus

                                                                       
Query: 114 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 166
           ||||||||||||||||||||||| || ||||||||||||||||| ||||||       ||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                                       
Query: 167 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 226
            |||||||| ||||||||||| |||||||||||||||| |||||         |||||||
Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823

                                                                       
Query: 227 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 286
           || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||||
Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763

                                                                       
Query: 287 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703

                                                                       
Query: 347 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 406
            | ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643

                                                                       
Query: 407 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 466
           |||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583

                              
Query: 467 ggcgatgggggcgatggtg 485
           |||||||||||||||||||
Sbjct: 582 ggcgatgggggcgatggtg 564



 Score =  119 bits (60), Expect = 9e-24
 Identities = 86/94 (91%), Gaps = 3/94 (3%)
 Strand = Plus / Minus

                                                                        
Query: 1    gaatcgcataaggaaactcaactgaagaattctcaaaccccaacaacttcacaacatcac 60
            |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||
Sbjct: 1029 gaatcgcataaggaaactcaactgaaaaattctcaaaccccaccaacttcacaacatcac 970

                                              
Query: 61   attatattacagatagagaagcatgcatcatcca 94
            |||   ||||||||| || | |||||||||||||
Sbjct: 969  att---ttacagataaaggaacatgcatcatcca 939

---

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  406 bits (205), Expect = e-110
 Identities = 232/241 (96%)
 Strand = Plus / Minus

                                                                       
Query: 245 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 304
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 305 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 364
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                       
Query: 365 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 424
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622

                                                                       
Query: 425 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562

            
Query: 485 g 485
           |
Sbjct: 561 g 561

---

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  402 bits (203), Expect = e-109
 Identities = 233/243 (95%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 302
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 303 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 362
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                       
Query: 363 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 422
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621

                                                                       
Query: 423 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561

              
Query: 483 gtg 485
           |||
Sbjct: 560 gtg 558

---

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  391 bits (197), Expect = e-105
 Identities = 233/245 (95%)
 Strand = Plus / Minus

                                                                       
Query: 241 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 300
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 301 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 360
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                       
Query: 361 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 420
           ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627

                                                                       
Query: 421 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 480
           ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567

                
Query: 481 tggtg 485
           |||||
Sbjct: 566 tggtg 562

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                            
Query: 256      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 316      ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
                |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                                            
Query: 376      caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
                | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946

                                                                  
Query: 436      cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
                ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 13250896

---

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                         
Query: 256   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 316   ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
             |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                                         
Query: 376   caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
             | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756

                                                               
Query: 436   cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
             ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 12706

---

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                          
Query: 256    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 316    ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
              |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                                          
Query: 376    caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
              | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134

                                                                
Query: 436    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
              ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 168084

---

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 596

---

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 598

---

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 599

---

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 597

---

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 599

---

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  297 bits (150), Expect = 2e-77
 Identities = 210/230 (91%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 597

---

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  289 bits (146), Expect = 4e-75
 Identities = 209/230 (90%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 598

---

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  289 bits (146), Expect = 4e-75
 Identities = 209/230 (90%)
 Strand = Plus / Minus

                                                                       
Query: 256 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 315
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 316 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 375
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                                       
Query: 376 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 435
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526

                                                             
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 476

---

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  159 bits (80), Expect = 1e-35
 Identities = 163/188 (86%), Gaps = 2/188 (1%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
           |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 359 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 417
           || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

                                                                       
Query: 418 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 477
           ||  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585

                   
Query: 478 cgatggtg 485
           ||||||||
Sbjct: 584 cgatggtg 577

---

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  157 bits (79), Expect = 4e-35
 Identities = 160/187 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 359 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 418
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801

                                                                       
Query: 419 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 478
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741

                  
Query: 479 gatggtg 485
           |||||||
Sbjct: 740 gatggtg 734

---

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  157 bits (79), Expect = 4e-35
 Identities = 160/187 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 359 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 418
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800

                                                                       
Query: 419 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 478
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740

                  
Query: 479 gatggtg 485
           |||||||
Sbjct: 739 gatggtg 733

---

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                                       
Query: 369 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564

                                                                    
Query: 429 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 507

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Plus

                                                                            
Query: 309      ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
                ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                            
Query: 369      ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
                |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302

                                                                         
Query: 429      ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
                |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 26627359

---

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Plus

                                                                          
Query: 309    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                          
Query: 369    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683

                                                                       
Query: 429    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
              |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 169740

---

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Plus

                                                                         
Query: 309   ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
             ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                                         
Query: 369   ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
             |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463

                                                                      
Query: 429   ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
             |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 61520

---

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                                       
Query: 369 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637

                                                                    
Query: 429 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 580

---

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                                       
Query: 369 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439

                                                                    
Query: 429 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 382

---

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  153 bits (77), Expect = 6e-34
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                          
Query: 309    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 368
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                          
Query: 369    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 428
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532

                                                                       
Query: 429    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
              |||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 250475



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                          
Query: 407    catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 466
              |||||| ||||||  ||| ||||||||  ||||||||||||| |||||||||||||||||
Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154

                                 
Query: 467    ggcgatgggggcgatggtg 485
               |||||||| |||||||||
Sbjct: 332155 cgcgatgggcgcgatggtg 332173

---

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  133 bits (67), Expect = 6e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 374
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                                       
Query: 375 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 434
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638

                                                              
Query: 435 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
            | ||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtg 587

---

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  133 bits (67), Expect = 6e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 374
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                                       
Query: 375 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 434
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620

                                                              
Query: 435 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
            | ||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtg 569

---

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  125 bits (63), Expect = 1e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 374
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                                       
Query: 375 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 434
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561

                                                              
Query: 435 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
            | ||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtg 510

---

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  125 bits (63), Expect = 1e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 374
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                                       
Query: 375 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 434
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629

                                                              
Query: 435 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
            | ||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtg 578

---

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  121 bits (61), Expect = 2e-24
 Identities = 157/189 (83%)
 Strand = Plus / Minus

                                                                       
Query: 297 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 356
           ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 357 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 416
           | ||||||||| |||||  |||| || ||| |||| ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

                                                                       
Query: 417 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 476
           || ||||||||||| ||  | | ||||||||| || ||||||||||| || || ||||| 
Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596

                    
Query: 477 gcgatggtg 485
           |||||||||
Sbjct: 595 gcgatggtg 587

---

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  115 bits (58), Expect = 1e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 380 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 439
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | |||||
Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622

                                                         
Query: 440 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtg 576



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715

---

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
           ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                       
Query: 359 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 418
           || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577

                                                                       
Query: 419 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 478
           |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517

                  
Query: 479 gatggtg 485
           || ||||
Sbjct: 516 gacggtg 510

---

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                         
Query: 299   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
             ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                         
Query: 359   ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 418
             || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602

                                                                         
Query: 419   ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 478
             |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662

                    
Query: 479   gatggtg 485
             || ||||
Sbjct: 92663 gacggtg 92669

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                            
Query: 299      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 358
                ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                            
Query: 359      ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 418
                || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626

                                                                            
Query: 419      ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 478
                |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686

                       
Query: 479      gatggtg 485
                || ||||
Sbjct: 27568687 gacggtg 27568693



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 352      agatgttggtgaagtcgccgctg 374
                |||||||||||||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232

---

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 380 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 439
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | || ||
Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653

                                                         
Query: 440 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           ||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtg 607



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746

---

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                            
Query: 378      acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
                |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863

                                                             
Query: 438      aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
                ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                           
Query: 384     gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 443
               |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                                     
Query: 444     ttggccccgacgatgaagccga 465
               ||||| ||||||| || |||||
Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390

---

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                          
Query: 378    acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
              |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892

                                                           
Query: 438    aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
              ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937

---

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543

---

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592

---

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529

---

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||||| |||| | |||||||||||||| || |||||||||
Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 615 ccgatggcgatgggggcgatggtg 592

---

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 537 ccgatggcgatgggggcgatggtg 514



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653

---

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                         
Query: 378   acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 437
             ||||| || ||||| ||||| || ||||||||||| ||||||  |||||| |||||  ||
Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784

                                                             
Query: 438   aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
             ||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtg 44736



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 361   tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 412
             |||||||||||||| |||| || || ||||| || || || |||||||||||
Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154

---

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638

                                                         
Query: 400 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 445
           | |||||||| || || |||||||| ||||||||| | ||||||||
Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592

---

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 536 ccgatggcgatgggggcgatggtg 513



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652

---

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||||| |||| | || ||||||||||| || |||||||||
Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 633 ccgatggcgatgggggcgatggtg 610



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                           
Query: 402     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945

                                       
Query: 462     ccgatggcgatgggggcgatggtg 485
               ||||||||||||||||||||||||
Sbjct: 2544946 ccgatggcgatgggggcgatggtg 2544969



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 299     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 352      agatgttggtgaagtcgccgctg 374
                |||||||||||||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564

---

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                          
Query: 402    gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
              |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149

                                      
Query: 462    ccgatggcgatgggggcgatggtg 485
              ||||||||||||||||||||||||
Sbjct: 125148 ccgatggcgatgggggcgatggtg 125125



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 299    gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
              ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                           
Query: 402     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055

                                       
Query: 462     ccgatggcgatgggggcgatggtg 485
               ||||||||||||||||||||||||
Sbjct: 2545056 ccgatggcgatgggggcgatggtg 2545079



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 299     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 352      agatgttggtgaagtcgccgctg 374
                |||||||||||||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098

---

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 614 ccgatggcgatgggggcgatggtg 591



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730

---

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 355 ccgatggcgatgggggcgatggtg 378

---

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 623 ccgatggcgatgggggcgatggtg 600



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739

---

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 625 ccgatggcgatgggggcgatggtg 602



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741

---

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 149 ccgatggcgatgggggcgatggtg 126



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265

---

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           ||||||||||||||||||||||||
Sbjct: 621 ccgatggcgatgggggcgatggtg 598



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737

---

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           |||||||| |||||||||||||||
Sbjct: 632 ccgatggcaatgggggcgatggtg 609



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748

---

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630

                                   
Query: 462 ccgatggcgatgggggcgatggtg 485
           |||||||| |||||||||||||||
Sbjct: 629 ccgatggcaatgggggcgatggtg 606



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 299 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 346
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745

---

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596

                                                         
Query: 400 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 445
           | |||||||| || || |||||||| ||||| ||| | ||||||||
Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550

---

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 533

---

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 482
           ||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 478

---

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 438 aggatgttggccccgacgatgaagccgatggcgatgggggcgat 481
           |||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

---

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                       
Query: 321 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 380
           |||||||  |||||||||  |||||||| ||||  ||| ||  |||| ||| |||| | |
Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766

                                                                       
Query: 381 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 440
           || |||||||| |||||||| |||||||||||  |||||| ||||  |||| |  |||||
Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706

                              
Query: 441 atgttggccccgacgatga 459
            ||||||| ||||||||||
Sbjct: 705 ctgttggcgccgacgatga 687

---

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 443
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                                 
Query: 444 ttggccccgacgatgaagccga 465
           ||||| ||||||| || |||||
Sbjct: 548 ttggcgccgacgacgaggccga 527

---

>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds
          Length = 1072

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 395
           ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| 
Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660

                                                 
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggc 433
           || || || ||||| || || |||||||| ||||||||
Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622

---

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 384   gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 443
             |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                                   
Query: 444   ttggccccgacgatgaagccga 465
             ||||| ||||||| || |||||
Sbjct: 98841 ttggcgccgacgacgaggccga 98820

---

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 443
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                                 
Query: 444 ttggccccgacgatgaagccga 465
           ||||| ||||||| || |||||
Sbjct: 551 ttggcgccgacgacgaggccga 530

---

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549

---

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511

---

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 436 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539

---

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           ||||||||||||| |||  | |||||||||| || || || || || ||||| ||||| |
Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633

                                                                       
Query: 400 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 459
           | ||||||||||| || || ||||| || || ||  | | ||||||||| || || ||||
Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573

                                    
Query: 460 agccgatggcgatgggggcgatggt 484
           |||||||||| ||||| || |||||
Sbjct: 572 agccgatggcaatgggtgcaatggt 548

---

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 440
           ||||| ||||||||||| || ||||||||||| || || ||||| ||||||||  | | |
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637

                                                        
Query: 441 atgttggccccgacgatgaagccgatggcgatgggggcgatggtg 485
           |||||||| || || ||||| || || || |||||||| ||||||
Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtg 592

---

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 436  cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
            ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695

---

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || || ||||| || |||||  | ||||||||||| ||||||
Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581

                                        
Query: 456 atgaagccgatggcgatgggggcgatggt 484
           ||||  || ||||||| ||| ||||||||
Sbjct: 580 atgagaccaatggcgaggggagcgatggt 552

---

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 381 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 440
           ||||||||||| ||||| || |||||||||||  ||||||||||||| ||| |  |||| 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 441 atgttggccccgacga 456
           | |||||| |||||||
Sbjct: 648 acgttggcgccgacga 633

---

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           ||||| |||||||| |||||||||||||||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753

---

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 440 gatgttggccccgacgatgaagccgatggcgatggg 475
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286

---

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650

             
Query: 456 at 457
           ||
Sbjct: 649 at 648

---

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                        
Query: 396  cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
            ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225

              
Query: 456  at 457
            ||
Sbjct: 1226 at 1227

---

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540

             
Query: 456 at 457
           ||
Sbjct: 539 at 538

---

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611

             
Query: 456 at 457
           ||
Sbjct: 610 at 609

---

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588

             
Query: 456 at 457
           ||
Sbjct: 587 at 586

---

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593

             
Query: 456 at 457
           ||
Sbjct: 592 at 591

---

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590

             
Query: 456 at 457
           ||
Sbjct: 589 at 588

---

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612

             
Query: 456 at 457
           ||
Sbjct: 611 at 610

---

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 396   cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
             ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439

               
Query: 456   at 457
             ||
Sbjct: 19438 at 19437

---

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 396 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 455
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557

             
Query: 456 at 457
           ||
Sbjct: 556 at 555

---

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 440 gatgttggccccgacgatgaagccgatggcgat 472
           ||||||||| |||||||| ||||||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgat 289

---

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 441 atgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           |||||||| ||||||||||| ||||| || ||||| ||||||||
Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggt 537

---

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           ||||| ||||| || |||||||||||||||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720

---

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 361 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 412
           |||||| ||||||| | ||||| |||||||| ||||| || |||||||||||
Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668

---

>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1,
           complete cds
          Length = 1001

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 99/124 (79%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           ||||||||||||||  |||||||||||| |||    |  |||| ||||||||||| || |
Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648

                                                                       
Query: 400 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 459
           | |||||||| ||||||||    || ||||||||| | | ||||||||| || || ||||
Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588

               
Query: 460 agcc 463
           ||||
Sbjct: 587 agcc 584

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 445     tggccccgacgatgaagccgatggcgatgggggcga 480
               |||| ||||||||||||||| || ||||||||||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981

---

>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 352 agatgttggtgaagtcgccgctg 374
           |||||||||||||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855

---

>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 352   agatgttggtgaagtcgccgctg 374
             |||||||||||||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853

---

>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 352    agatgttggtgaagtcgccgctg 374
              |||||||||||||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430

---

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 308    gccggcgaggccaccgccgatga 330
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 308     gccggcgaggccaccgccga 327
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165

---

>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 352 agatgttggtgaagtcgccgctg 374
           |||||||||||||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816

---

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 299 gtagacgatgccggcgaggccaccgccgatg 329
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592

---

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 380 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 425
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543

---

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 380 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 425
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528

---

>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip
           gene)
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 384 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 433
           ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664

---

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 440 gatgttggccccgacgatgaagccgatggc 469
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292

---

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 450 ccgacgatgaagccgatggcga 471
           ||||||||||||||||||||||
Sbjct: 311 ccgacgatgaagccgatggcga 290

---

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 440 gatgttggccccgacgatgaagccgatggc 469
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292

---

>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340
           (DELTA-TIP2/TIP2;2) mRNA, complete cds
          Length = 977

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599

                
Query: 462 ccgat 466
           |||||
Sbjct: 598 ccgat 594

---

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 309 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||  |||||||||| ||| || ||||||||||||| ||||
Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661

---

>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaac 414
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577

---

>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaac 414
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577

---

>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 381 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 425
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750

---

>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7,
             complete sequence
          Length = 168673

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 48    ttcacaacatcacattatatt 68
             |||||||||||||||||||||
Sbjct: 78807 ttcacaacatcacattatatt 78827

---

>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein
           mRNA, partial cds
          Length = 770

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425

                                    
Query: 400 cagggttcatggaaccgccggagaa 424
           |||||||||| || ||||| |||||
Sbjct: 424 cagggttcattgagccgccagagaa 400

---

>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA,
           partial cds
          Length = 684

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 399
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338

                                    
Query: 400 cagggttcatggaaccgccggagaa 424
           |||||||||| || ||||| |||||
Sbjct: 337 cagggttcattgagccgccagagaa 313

---

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 402   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802

                  
Query: 462   ccgat 466
             |||||
Sbjct: 64801 ccgat 64797

---

>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein
          Length = 991

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 333 gggccggcccagtagatccag 353
           |||||||||||||||||||||
Sbjct: 655 gggccggcccagtagatccag 635

---

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 402   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167

                  
Query: 462   ccgat 466
             |||||
Sbjct: 54166 ccgat 54162

---

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 436    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
              ||||||||||||| || |||||||| || || ||||| || ||||||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695

---

>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534

                
Query: 462 ccgat 466
           |||||
Sbjct: 533 ccgat 529

---

>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 972

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596

                
Query: 462 ccgat 466
           |||||
Sbjct: 595 ccgat 591

---

>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230090D02 product:aquaporin 6,
           full insert sequence
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaac 414
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578

---

>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 954

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582

                
Query: 462 ccgat 466
           |||||
Sbjct: 581 ccgat 577

---

>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557

                
Query: 462 ccgat 466
           |||||
Sbjct: 556 ccgat 552

---

>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence
          Length = 969

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 461
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600

                
Query: 462 ccgat 466
           |||||
Sbjct: 599 ccgat 595

---

>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene)
          Length = 535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 381 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 425
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490

---

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 440 gatgttggccccgacgatgaagccgatggcgatgggggcgatggt 484
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245

---

>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence
          Length = 2291

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 381  gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 425
            ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271

---

>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 378   acggcggggccgaatgagcgtgcagggttcatggaac 414
             ||||| |||||||| ||||| || |||||||||||||
Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581

---

>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 378 acggcggggccgaatgagcgtgcagggttcatggaac 414
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578

---

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 444 ttggccccgacgatgaagccgatggcgat 472
           ||||| |||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289

---

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712

---

>gb|AC165149.5| Mus musculus BAC clone RP24-114C10 from chromosome 13, complete
             sequence
          Length = 191162

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    ggaaactcaactgaagaatt 31
             ||||||||||||||||||||
Sbjct: 13923 ggaaactcaactgaagaatt 13942

---

>ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform (PPP2R2C), transcript variant 1,
            mRNA
          Length = 4117

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   aaaccccaacaacttcacaa 54
            ||||||||||||||||||||
Sbjct: 3856 aaaccccaacaacttcacaa 3837

---

>ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform (PPP2R2C), transcript variant 2,
            mRNA
          Length = 4087

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   aaaccccaacaacttcacaa 54
            ||||||||||||||||||||
Sbjct: 3826 aaaccccaacaacttcacaa 3807

---

>gb|AC121551.11| Mus musculus chromosome 1, clone RP24-144H23, complete sequence
          Length = 168683

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     ggaaactcaactgaagaatt 31
              ||||||||||||||||||||
Sbjct: 136133 ggaaactcaactgaagaatt 136114

---

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 200    ggcatcatggaaaccaaaca 219
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824

---

>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507837.100) partial mRNA
          Length = 4953

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 461  gccgatggcgatgggggcgatggt 484
            ||||||| ||||||||||||||||
Sbjct: 4372 gccgatgacgatgggggcgatggt 4395

---

>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence
          Length = 138303

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 384   gggccgaatgagcgtgcagggttcatggaacc 415
             |||||||||||||| || |||||||| |||||
Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913

---

>gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosome 6, complete sequence
          Length = 212735

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    aaaccccaacaacttcacaa 54
             ||||||||||||||||||||
Sbjct: 57462 aaaccccaacaacttcacaa 57481

---

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 318  ccaccgccgatgagcgggccggcccagtagatccag 353
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097

---

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648

---

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706

---

>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene
          Length = 993

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690

---

>gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory
           subunit B (PR 52), gamma isoform, mRNA (cDNA clone
           IMAGE:4816112)
          Length = 1172

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  aaaccccaacaacttcacaa 54
           ||||||||||||||||||||
Sbjct: 918 aaaccccaacaacttcacaa 899

---

>gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:5300526)
          Length = 2161

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   aaaccccaacaacttcacaa 54
            ||||||||||||||||||||
Sbjct: 1900 aaaccccaacaacttcacaa 1881

---

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 298 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||||||||||| | |  | ||||  || |||||| ||||||||||||||
Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724

---

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 308     gccggcgaggccaccgccga 327
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040

---

>dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788
          Length = 1737

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   aaaccccaacaacttcacaa 54
            ||||||||||||||||||||
Sbjct: 1499 aaaccccaacaacttcacaa 1480

---

>gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, complete sequence
          Length = 191656

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 31     tctcaaaccccaacaacttcacaa 54
              ||||||||||||||| ||||||||
Sbjct: 107696 tctcaaaccccaacaccttcacaa 107719

---

>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 318  ccaccgccgatgagcgggccggcccagtagatccag 353
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407

---

>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tctgaaccaaacaacatgac 140
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     cggcgaggccaccgccgatg 329
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206

---

>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 996

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687

---

>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677

---

>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZD11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 950

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692

---

>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693

---

>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZD10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693

---

>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 904

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691

---

>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692

---

>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 973

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691

---

>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS84ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683

---

>gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-367K14, complete
             sequence
          Length = 108667

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    aaaccccaacaacttcacaa 54
             ||||||||||||||||||||
Sbjct: 32732 aaaccccaacaacttcacaa 32713

---

>gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, complete sequence
          Length = 160943

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    aaaccccaacaacttcacaa 54
             ||||||||||||||||||||
Sbjct: 82311 aaaccccaacaacttcacaa 82330

---

>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence
          Length = 1042

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712

---

>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 321  ccgccgatgagcgggccggc 340
            ||||||||||||||||||||
Sbjct: 7090 ccgccgatgagcgggccggc 7109

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 453     acgatgaagccgatggcgatgggggcga 480
               |||||||||||||| |||| ||||||||
Sbjct: 4744058 acgatgaagccgatcgcgacgggggcga 4744085

---

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 318 ccaccgccgatgagcgggccggcccagtagatccag 353
           ||||||||||| |  || ||||||||||||||||||
Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 319    caccgccgatgagcgggccg 338
              ||||||||||||||||||||
Sbjct: 557849 caccgccgatgagcgggccg 557868

---

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 452     gacgatgaagccgatggcgatggg 475
               ||||||| ||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatggg 1047141

---

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 121     tctgaaccaaacaacatgac 140
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503

---

>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene,
            complete cds
          Length = 1398

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 318  ccaccgccgatgagcgggccggcccagtagatccag 353
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,650,303
Number of Sequences: 3902068
Number of extensions: 3650303
Number of successful extensions: 70691
Number of sequences better than 10.0: 170
Number of HSP's better than 10.0 without gapping: 164
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 69679
Number of HSP's gapped (non-prelim): 994
length of query: 485
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 463
effective length of database: 17,147,199,772
effective search space: 7939153494436
effective search space used: 7939153494436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---