ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart33d12 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds Length = 1343 Score = 391 bits (197), Expect = e-105 Identities = 260/281 (92%) Strand = Plus / Minus Query: 147 ccgaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtag 206 |||||||||||||||||||| | ||||| ||| || |||||||| ||||||||| |||| Sbjct: 936 ccgaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtac 877 Query: 207 gcggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccag 266 |||||| |||||||| |||||||||||||||||||| || |||||| ||||||||||| Sbjct: 876 aaggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccag 817 Query: 267 gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 326 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 816 gccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtg 757 Query: 327 ccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaagga 386 |||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 756 ccggtgatcgggatagtggccaagtgcaccatgaacaccgcgaagccgattggcagggga 697 Query: 387 gccagcactgggacgtgggagtcacgggcgctgcgcttggg 427 ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 696 gccaggactgggacgtgggagtcacgggcgctgcgcttggg 656
>ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 283 bits (143), Expect = 2e-73 Identities = 245/279 (87%) Strand = Plus / Minus Query: 149 gaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtaggc 208 |||||||| || ||||| ||||||| ||| || |||||||||||||||||| ||||||| Sbjct: 864 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 805 Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggc 268 |||||| |||||||| ||||||| ||||||||||| ||||||||| |||||| ||| || Sbjct: 804 ggcggcgatggcggcgccgatgaggggccccacccagaagatccagtggtcatgccatgc 745 Query: 269 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 328 ||| | | |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 744 cttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgcc 685 Query: 329 ggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagc 388 |||||| ||||| ||||||| ||| ||||||||||||||||| || ||||| | |||||| Sbjct: 684 ggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaacccaattggaagaggagc 625 Query: 389 cagcactgggacgtgggagtcacgggcgctgcgcttggg 427 ||||| |||||||||||||| |||||| |||||||||| Sbjct: 624 aagcacggggacgtgggagtcgcgggcgttgcgcttggg 586
>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds Length = 1104 Score = 276 bits (139), Expect = 6e-71 Identities = 244/279 (87%) Strand = Plus / Minus Query: 149 gaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtaggc 208 ||||||||||||||| || ||||||| ||| || |||||||| ||||||||| |||| || Sbjct: 852 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 793 Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggc 268 ||||| |||||||| ||||||||||| |||||||| ||||||||| ||||||||||||| Sbjct: 792 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 733 Query: 269 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 328 ||| |||||||||||||| || ||||| || |||||||| |||||||||||||||||||| Sbjct: 732 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 673 Query: 329 ggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagc 388 |||||| ||||| |||||||| || |||||||||||||| || ||||| || | ||| || Sbjct: 672 ggtgatggggatcgtggccagatggaccatgaacaccgcaaacccgatggggagaggggc 613 Query: 389 cagcactgggacgtgggagtcacgggcgctgcgcttggg 427 ||||| ||||| || |||||||||||| |||||||||| Sbjct: 612 aagcacggggacatgagagtcacgggcgttgcgcttggg 574
>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete cds Length = 1207 Score = 276 bits (139), Expect = 6e-71 Identities = 244/279 (87%) Strand = Plus / Minus Query: 149 gaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtaggc 208 ||||||||||||||| || ||||||| ||| || |||||||| ||||||||| |||| || Sbjct: 907 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 848 Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggc 268 ||||| |||||||| ||||||||||| |||||||| ||||||||| ||||||||||||| Sbjct: 847 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 788 Query: 269 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 328 ||| |||||||||||||| || ||||| || |||||||| |||||||||||||||||||| Sbjct: 787 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 728 Query: 329 ggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagc 388 |||||| ||||| |||||||| || |||||||||||||| || ||||| || | ||| || Sbjct: 727 ggtgatggggatcgtggccagatggaccatgaacaccgcaaacccgatggggagaggggc 668 Query: 389 cagcactgggacgtgggagtcacgggcgctgcgcttggg 427 ||||| ||||| || |||||||||||| |||||||||| Sbjct: 667 aagcacggggacatgagagtcacgggcgttgcgcttggg 629
>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1235 Score = 262 bits (132), Expect = 8e-67 Identities = 229/260 (88%), Gaps = 1/260 (0%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 883 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 824 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | ||||||||||| |||||||| |||||||||||||||| || ||||||||||| Sbjct: 823 atcagcggccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatg 764 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || |||||||| ||||| || |||||||||||||||||||||||||| ||||| |||| | Sbjct: 763 acagcagctcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtgg-c 705 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||| ||||||||||| ||||| |||||||| | |||||||||||| |||| ||||||| Sbjct: 704 aggtggaccatgaacacggcgaatccgattgggagaggagccagcaccgggatgtgggag 645 Query: 408 tcacgggcgctgcgcttggg 427 ||||||||| |||||||||| Sbjct: 644 tcacgggcgttgcgcttggg 625
>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds Length = 1318 Score = 254 bits (128), Expect = 2e-64 Identities = 227/260 (87%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| || |||||| |||||||||||||||||||||| ||| Sbjct: 971 agcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcgccg 912 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | |||||||||||| |||||||| |||||||||||||||| || |||||||||| Sbjct: 911 atcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatg 852 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || |||||||| ||||| || || ||||||||||||||||||||||| ||||| |||||| Sbjct: 851 acagcagctcccaagcttctcgcggggttgatgccggtgccggtgatggggatggtggcc 792 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 | ||| ||||||||||| ||||| |||||||| | |||||||||||| |||| |||||| Sbjct: 791 aagtggaccatgaacacagcgaatccgattgggagaggagccagcaccgggatgtgggaa 732 Query: 408 tcacgggcgctgcgcttggg 427 ||||||||| |||||||||| Sbjct: 731 tcacgggcgttgcgcttggg 712
>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd Length = 1251 Score = 254 bits (128), Expect = 2e-64 Identities = 227/260 (87%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| || |||||| |||||||||||||||||||||| ||| Sbjct: 891 agcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcgccg 832 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | |||||||||||| |||||||| |||||||||||||||| || |||||||||| Sbjct: 831 atcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatg 772 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || |||||||| ||||| || || ||||||||||||||||||||||| ||||| |||||| Sbjct: 771 acagcagctcccaagcttctcgcggggttgatgccggtgccggtgatggggatggtggcc 712 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 | ||| ||||||||||| ||||| |||||||| | |||||||||||| |||| |||||| Sbjct: 711 aagtggaccatgaacacagcgaatccgattgggagaggagccagcaccgggatgtgggaa 652 Query: 408 tcacgggcgctgcgcttggg 427 ||||||||| |||||||||| Sbjct: 651 tcacgggcgttgcgcttggg 632
>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete cds Length = 1171 Score = 246 bits (124), Expect = 5e-62 Identities = 226/260 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| || Sbjct: 929 agcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgcca 870 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | ||| |||||||| |||||||| |||| ||||||||||| || ||||||||||| Sbjct: 869 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 810 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || ||||| | |||||| |||||||||||||||||||||||||| ||||| |||||| Sbjct: 809 accgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 750 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||||||||||||||| ||||| || ||||| | |||||| ||||| || ||||||||| Sbjct: 749 aggtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggag 690 Query: 408 tcacgggcgctgcgcttggg 427 |||||||| ||||||||||| Sbjct: 689 tcacgggcactgcgcttggg 670
>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete cds Length = 1156 Score = 246 bits (124), Expect = 5e-62 Identities = 226/260 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || || ||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 919 agcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcgccg 860 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | ||| |||||||| |||||||| |||| ||||||||||| || ||||||||||| Sbjct: 859 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 800 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || ||||| |||||||| |||||||||||||||||||||||||| ||||| |||||| Sbjct: 799 accgcggctcccaagctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 740 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||||||||||||||| ||||| || || || | ||| |||| ||| |||||||||||| Sbjct: 739 aggtgcaccatgaacacggcgaacccaatcggaagaggggccaacaccgggacgtgggag 680 Query: 408 tcacgggcgctgcgcttggg 427 |||||||| ||||||||||| Sbjct: 679 tcacgggcactgcgcttggg 660
>gb|AY109332.1| Zea mays CL502_5 mRNA sequence Length = 1969 Score = 246 bits (124), Expect = 5e-62 Identities = 226/260 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || || ||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 347 agcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcgccg 288 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | ||| |||||||| |||||||| |||| ||||||||||| || ||||||||||| Sbjct: 287 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 228 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || ||||| |||||||| |||||||||||||||||||||||||| ||||| |||||| Sbjct: 227 accgcggctcccaagctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 168 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||||||||||||||| ||||| || || || | ||| |||| ||| |||||||||||| Sbjct: 167 aggtgcaccatgaacacggcgaacccaatcggaagaggggccaacaccgggacgtgggag 108 Query: 408 tcacgggcgctgcgcttggg 427 |||||||| ||||||||||| Sbjct: 107 tcacgggcactgcgcttggg 88 Score = 165 bits (83), Expect = 1e-37 Identities = 164/191 (85%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| || |||||| |||||||||| | ||| || |||||||||| ||||| || Sbjct: 1551 cccacccagaaaatccagtggtcatcccatggcttgtccttgttgtagacgacggcggcg 1492 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| ||||||||||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 1491 cccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtggacc 1432 Query: 357 atgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcg 416 |||||||| ||||||||||| || | |||||||| || |||||||||||||| |||||| Sbjct: 1431 atgaacacggcgaagccgatggggaggggagccagaaccgggacgtgggagtcgcgggcg 1372 Query: 417 ctgcgcttggg 427 |||||||||| Sbjct: 1371 ttgcgcttggg 1361
>ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1214 Score = 230 bits (116), Expect = 3e-57 Identities = 224/260 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 909 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 850 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | || |||||||| |||||||| |||||||||||||||| || ||||||||||| Sbjct: 849 atcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtagata 790 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || | ||| |||||||| |||||||| ||||||||||||||||| ||||| |||||| Sbjct: 789 accgcggttcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggcc 730 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 || || ||||||||||||||||| || ||||| | |||||||| ||| |||| ||||||| Sbjct: 729 agatggaccatgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggag 670 Query: 408 tcacgggcgctgcgcttggg 427 || |||||| |||||||||| Sbjct: 669 tcgcgggcgttgcgcttggg 650
>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full insert sequence Length = 1214 Score = 230 bits (116), Expect = 3e-57 Identities = 224/260 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 909 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 850 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | || |||||||| |||||||| |||||||||||||||| || ||||||||||| Sbjct: 849 atcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtagata 790 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || | ||| |||||||| |||||||| ||||||||||||||||| ||||| |||||| Sbjct: 789 accgcggttcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggcc 730 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 || || ||||||||||||||||| || ||||| | |||||||| ||| |||| ||||||| Sbjct: 729 agatggaccatgaacaccgcgaatccaattgggagaggagccaacaccgggatgtgggag 670 Query: 408 tcacgggcgctgcgcttggg 427 || |||||| |||||||||| Sbjct: 669 tcgcgggcgttgcgcttggg 650
>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence Length = 1215 Score = 222 bits (112), Expect = 7e-55 Identities = 223/260 (85%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| || Sbjct: 937 agcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgcca 878 Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 || | ||| |||||||| |||||||| |||| ||||||||||| || ||||||||||| Sbjct: 877 atcagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 818 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || || ||||| | | |||| |||||||||||||||||||||||||| |||| ||| || Sbjct: 817 accgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtcc 758 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||||||||||||||| ||||| || ||||| | |||||| ||||| || ||||||||| Sbjct: 757 aggtgcaccatgaacacggcgaacccaattgggagaggagctagcaccggaacgtgggag 698 Query: 408 tcacgggcgctgcgcttggg 427 |||||||| ||||||||||| Sbjct: 697 tcacgggcactgcgcttggg 678
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence Length = 1348 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| ||||||||| |||| ||||||| ||| || ||||||||||| ||||| || Sbjct: 829 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 770 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 cccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtgcacc 710 Query: 357 atgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcg 416 |||||||| ||||||||||| || | |||||||| || |||||||||||||| |||||| Sbjct: 709 atgaacacggcgaagccgatggggaggggagccagaaccgggacgtgggagtcgcgggcg 650 Query: 417 ctgcgcttggg 427 |||||||||| Sbjct: 649 ttgcgcttggg 639
>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds Length = 1133 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| ||||||||| |||| ||||||| ||| || ||||||||||| ||||| || Sbjct: 777 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 718 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 717 cccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtgcacc 658 Query: 357 atgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcg 416 |||||||| ||||||||||| || | |||||||| || |||||||||||||| |||||| Sbjct: 657 atgaacacggcgaagccgatggggaggggagccagaaccgggacgtgggagtcgcgggcg 598 Query: 417 ctgcgcttggg 427 |||||||||| Sbjct: 597 ttgcgcttggg 587
>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete cds Length = 1171 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| ||||||||| |||| ||||||| ||| || ||||||||||| ||||| || Sbjct: 848 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 789 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 788 cccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtgcacc 729 Query: 357 atgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcg 416 |||||||| ||||||||||| || | |||||||| || |||||||||||||| |||||| Sbjct: 728 atgaacacggcgaagccgatggggaggggagccagaaccgggacgtgggagtcgcgggcg 669 Query: 417 ctgcgcttggg 427 |||||||||| Sbjct: 668 ttgcgcttggg 658
>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA, partial cds Length = 411 Score = 174 bits (88), Expect = 2e-40 Identities = 151/172 (87%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||| ||||||| | || ||||||||||| || |||||||| ||||| || ||||||| Sbjct: 409 ggtcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggt 350 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 ||||||||||||||||||| ||||| ||||| ||||| ||||||||||| ||||| |||| Sbjct: 349 tgatgccggtgccggtgatggggatggtggctaggtggaccatgaacacggcgaatccga 290 Query: 376 ttggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttggg 427 |||| | |||||||||||| |||| |||||||||||| ||| |||||||||| Sbjct: 289 ttgggagaggagccagcaccgggatgtgggagtcacgagcgttgcgcttggg 238
>ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1215 Score = 172 bits (87), Expect = 6e-40 Identities = 174/203 (85%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| ||||| ||||| |||||||| | ||| ||||||||| | |||||||||| Sbjct: 873 ccgatgaacggcccaacccagaagatccactgatcactccaggccttgttgttgttgtag 814 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 | |||||| | |||| |||||| |||||||||||||||||||||||||| ||||| || Sbjct: 813 accacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtc 754 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||||||||||||||||||||||||| |||||||||| ||||||| ||| || || || Sbjct: 753 gccaggtgcaccatgaacaccgcgaacccgattggcagcggagccaacacgggaacatgt 694 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| |||||| |||||||||| Sbjct: 693 gagtcgcgggcgttgcgcttggg 671
>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full insert sequence Length = 1215 Score = 172 bits (87), Expect = 6e-40 Identities = 174/203 (85%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| ||||| ||||| |||||||| | ||| ||||||||| | |||||||||| Sbjct: 873 ccgatgaacggcccaacccagaagatccactgatcactccaggccttgttgttgttgtag 814 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 | |||||| | |||| |||||| |||||||||||||||||||||||||| ||||| || Sbjct: 813 accacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtc 754 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||||||||||||||||||||||||| |||||||||| ||||||| ||| || || || Sbjct: 753 gccaggtgcaccatgaacaccgcgaacccgattggcagcggagccaacacgggaacatgt 694 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| |||||| |||||||||| Sbjct: 693 gagtcgcgggcgttgcgcttggg 671
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 904 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 845 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 844 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 785 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 784 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 725 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 724 gggacatgtgagtcgcgggcgttgcgcttggg 693
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 906 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 847 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 846 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 787 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 786 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 727 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 726 gggacatgtgagtcgcgggcgttgcgcttggg 695
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 907 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 848 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 847 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 788 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 787 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 728 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 727 gggacatgtgagtcgcgggcgttgcgcttggg 696
>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1283 Score = 167 bits (84), Expect = 4e-38 Identities = 162/188 (86%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| | |||||||||||||| || ||||||||||| ||||| || || Sbjct: 847 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 788 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||| Sbjct: 787 aggctccgggccgggttgatgccggtgccggtgatggggatggtggccaggtggaccatg 728 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctg 419 ||||| ||||||||||| || | || |||||||| |||||||| ||||| || |||||| Sbjct: 727 aacacggcgaagccgatcgggaggggcgccagcaccgggacgtgagagtcgcgtgcgctg 668 Query: 420 cgcttggg 427 |||||||| Sbjct: 667 cgcttggg 660
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 904 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 845 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 844 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 785 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 784 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 725 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 724 gggacatgtgagtcgcgggcgttgcgcttggg 693
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 498 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 439 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 438 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 379 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 378 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 319 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 318 gggacatgtgagtcgcgggcgttgcgcttggg 287
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 904 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 845 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 844 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 785 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 784 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 725 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 724 gggacatgtgagtcgcgggcgttgcgcttggg 693
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 906 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 847 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 846 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 787 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 786 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 727 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 726 gggacatgtgagtcgcgggcgttgcgcttggg 695
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 907 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 848 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 847 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 788 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 787 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 728 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 727 gggacatgtgagtcgcgggcgttgcgcttggg 696
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||| ||||||||| Sbjct: 894 atggcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcg 835 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| ||||||| |||||| |||||||||||||||||||||||||| Sbjct: 834 ttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatc 775 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || |||||||| ||||||||||| |||||||||||||||| || |||| || Sbjct: 774 gggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggcgccaagacc 715 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 714 gggacatgtgagtcgcgggcgttgcgcttggg 683
>ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 165 bits (83), Expect = 1e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| |||||| |||| ||||||||| |||| ||||| ||||||| | |||| Sbjct: 761 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 702 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| ||||| || |||| ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 701 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggatg 642 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||||||||||||||||||| ||||| ||||| |||| || || ||||| |||||| Sbjct: 641 gtggccaggtgcaccatgaacacggcgaacccgatgggcagcggcgcgagcaccgggacg 582 Query: 402 tgggagtcacgggcgctgcgctt 424 |||||||| ||||| ||||||| Sbjct: 581 tgggagtcgcgggcattgcgctt 559
>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete cds Length = 1268 Score = 165 bits (83), Expect = 1e-37 Identities = 164/191 (85%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| || |||||| |||||||||| | ||| || |||||||||| ||||| || Sbjct: 901 cccacccagaaaatccagtggtcatcccatggcttgtccttgttgtagacgacggcggcg 842 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| ||||||||||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 841 cccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtggacc 782 Query: 357 atgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcg 416 |||||||| ||||||||||| || | |||||||| || |||||||||||||| |||||| Sbjct: 781 atgaacacggcgaagccgatggggaggggagccagaaccgggacgtgggagtcgcgggcg 722 Query: 417 ctgcgcttggg 427 |||||||||| Sbjct: 721 ttgcgcttggg 711
>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full insert sequence Length = 1067 Score = 165 bits (83), Expect = 1e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| |||||| |||| ||||||||| |||| ||||| ||||||| | |||| Sbjct: 747 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 688 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| ||||| || |||| ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 687 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggatg 628 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||||||||||||||||||| ||||| ||||| |||| || || ||||| |||||| Sbjct: 627 gtggccaggtgcaccatgaacacggcgaacccgatgggcagcggcgcgagcaccgggacg 568 Query: 402 tgggagtcacgggcgctgcgctt 424 |||||||| ||||| ||||||| Sbjct: 567 tgggagtcgcgggcattgcgctt 545
>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full insert sequence Length = 1308 Score = 165 bits (83), Expect = 1e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| |||||| |||| ||||||||| |||| ||||| ||||||| | |||| Sbjct: 860 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 801 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| ||||| || |||| ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 800 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggatg 741 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||||||||||||||||||| ||||| ||||| |||| || || ||||| |||||| Sbjct: 740 gtggccaggtgcaccatgaacacggcgaacccgatgggcagcggcgcgagcaccgggacg 681 Query: 402 tgggagtcacgggcgctgcgctt 424 |||||||| ||||| ||||||| Sbjct: 680 tgggagtcgcgggcattgcgctt 658
>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full insert sequence Length = 1309 Score = 165 bits (83), Expect = 1e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| |||||| |||| ||||||||| |||| ||||| ||||||| | |||| Sbjct: 854 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 795 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| ||||| || |||| ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 794 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggatg 735 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||||||||||||||||||| ||||| ||||| |||| || || ||||| |||||| Sbjct: 734 gtggccaggtgcaccatgaacacggcgaacccgatgggcagcggcgcgagcaccgggacg 675 Query: 402 tgggagtcacgggcgctgcgctt 424 |||||||| ||||| ||||||| Sbjct: 674 tgggagtcgcgggcattgcgctt 652
>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full insert sequence Length = 1296 Score = 165 bits (83), Expect = 1e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| |||||| |||| ||||||||| |||| ||||| ||||||| | |||| Sbjct: 848 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 789 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| ||||| || |||| ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 788 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggatg 729 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||||||||||||||||||| ||||| ||||| |||| || || ||||| |||||| Sbjct: 728 gtggccaggtgcaccatgaacacggcgaacccgatgggcagcggcgcgagcaccgggacg 669 Query: 402 tgggagtcacgggcgctgcgctt 424 |||||||| ||||| ||||||| Sbjct: 668 tgggagtcgcgggcattgcgctt 646
>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds Length = 901 Score = 153 bits (77), Expect = 6e-34 Identities = 146/169 (86%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 |||||||| ||||| |||||||| || ||||| || ||||| |||||||||||||||| Sbjct: 795 gcaatggcagctccaatgaatggtccgacccagaacatccaatggtcatcccaggccttg 736 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 |||||||| ||||| || |||||||||||||| || ||||||||||| |||||||||||| Sbjct: 735 tcgttgttatagatgacagcagctccgaagcttctagccgggttgataccggtgccggtg 676 Query: 333 attgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || || || |||||||| |||||||||||||| || ||||| |||| Sbjct: 675 atgggaattgttgccaggtgaaccatgaacaccgcaaatccgatgggca 627
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 149 bits (75), Expect = 9e-33 Identities = 105/115 (91%) Strand = Plus / Minus Query: 267 gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 326 ||||||||||||||| |||| ||||| ||||||| |||||| |||||||||||||||||| Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544 Query: 327 ccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||||||| ||||| || |||||||| ||||||||||| |||||||||||||||| Sbjct: 15355543 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 15355489 Score = 143 bits (72), Expect = 5e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 263 ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 322 ||||||||| | ||||||||||| |||||| | |||| |||||| |||||||||||||| Sbjct: 15306318 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 15306259 Query: 323 ggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 |||||||||||| ||||| || |||||||||||||||||||||||||| |||||||||| Sbjct: 15306258 ggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgattggcag 15306199 Query: 383 aggagcca 390 ||||||| Sbjct: 15306198 cggagcca 15306191 Score = 125 bits (63), Expect = 1e-25 Identities = 96/107 (89%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||| || ||||| || |||| |||||| |||||||||||||||||||||||||| Sbjct: 15316357 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 15316298 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||||||||| ||||| |||| Sbjct: 15316297 cgggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggca 15316251 Score = 109 bits (55), Expect = 7e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||||| ||||| || |||| |||||| ||||||||||||||||||||||||| Sbjct: 15324237 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgac 15324178 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||| ||||| ||||| |||| Sbjct: 15324177 ggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggca 15324131
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 149 bits (75), Expect = 9e-33 Identities = 105/115 (91%) Strand = Plus / Minus Query: 267 gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 326 ||||||||||||||| |||| ||||| ||||||| |||||| |||||||||||||||||| Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543 Query: 327 ccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||||||| ||||| || |||||||| ||||||||||| |||||||||||||||| Sbjct: 62542 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 62488 Score = 143 bits (72), Expect = 5e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 263 ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 322 ||||||||| | ||||||||||| |||||| | |||| |||||| |||||||||||||| Sbjct: 13317 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 13258 Query: 323 ggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 |||||||||||| ||||| || |||||||||||||||||||||||||| |||||||||| Sbjct: 13257 ggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgattggcag 13198 Query: 383 aggagcca 390 ||||||| Sbjct: 13197 cggagcca 13190 Score = 125 bits (63), Expect = 1e-25 Identities = 96/107 (89%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||| || ||||| || |||| |||||| |||||||||||||||||||||||||| Sbjct: 23356 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 23297 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||||||||| ||||| |||| Sbjct: 23296 cgggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggca 23250 Score = 109 bits (55), Expect = 7e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||||| ||||| || |||| |||||| ||||||||||||||||||||||||| Sbjct: 31236 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgac 31177 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||| ||||| ||||| |||| Sbjct: 31176 ggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggca 31130
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 145 bits (73), Expect = 1e-31 Identities = 106/117 (90%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| || Sbjct: 26074218 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccggtgatcgg 26074159 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcac 394 ||| ||||||| ||| ||||||||||||||||| || ||||| | |||||| ||||| Sbjct: 26074158 gatcgtggccaagtgaaccatgaacaccgcgaacccaattggaagaggagcaagcac 26074102 Score = 107 bits (54), Expect = 3e-20 Identities = 108/126 (85%) Strand = Plus / Plus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||| ||||| ||||||| | ||||||||| ||||| || |||| ||||| || |||| Sbjct: 8906896 ggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggt 8906955 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 ||||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||| |||| Sbjct: 8906956 tgatgcccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccga 8907015 Query: 376 ttggca 381 | |||| Sbjct: 8907016 tgggca 8907021 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | |||||| || | |||||| || ||||||||||||||||||||||| | Sbjct: 28020774 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 28020715 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||| ||||||||||| |||| ||||||||| || |||||||||| Sbjct: 28020714 ggatggtggccaggtgaaccaagaacaccgcaaacccgattggca 28020670 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 149 gaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtaggc 208 |||||||| || ||||| ||||||| ||| || |||||||||||||||||| ||||||| Sbjct: 26074856 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 26074797 Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatcca 253 |||||| |||||||| ||||||| ||||||||||| |||||||| Sbjct: 26074796 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 |||||||||||||| |||||| |||||||||| Sbjct: 26073390 gggacgtgggagtcgcgggcgttgcgcttggg 26073359 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 222 gctccgatgaatggccccacccaaaagatcca 253 ||||||||||| |||||| |||| |||||||| Sbjct: 8906779 gctccgatgaacggccccgcccagaagatcca 8906810
>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11, complete sequence Length = 163039 Score = 145 bits (73), Expect = 1e-31 Identities = 106/117 (90%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| || Sbjct: 108545 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccggtgatcgg 108486 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcac 394 ||| ||||||| ||| ||||||||||||||||| || ||||| | |||||| ||||| Sbjct: 108485 gatcgtggccaagtgaaccatgaacaccgcgaacccaattggaagaggagcaagcac 108429 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 149 gaaggaggcagacgagccaagcttgggggcactcgccctcaggacgtactgggggtaggc 208 |||||||| || ||||| ||||||| ||| || |||||||||||||||||| ||||||| Sbjct: 109183 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 109124 Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatcca 253 |||||| |||||||| ||||||| ||||||||||| |||||||| Sbjct: 109123 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 |||||||||||||| |||||| |||||||||| Sbjct: 107717 gggacgtgggagtcgcgggcgttgcgcttggg 107686
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 143 bits (72), Expect = 5e-31 Identities = 114/128 (89%) Strand = Plus / Minus Query: 263 ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 322 ||||||||| | ||||||||||| |||||| | |||| |||||| |||||||||||||| Sbjct: 92331 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 92272 Query: 323 ggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 |||||||||||| ||||| || |||||||||||||||||||||||||| |||||||||| Sbjct: 92271 ggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgattggcag 92212 Query: 383 aggagcca 390 ||||||| Sbjct: 92211 cggagcca 92204 Score = 125 bits (63), Expect = 1e-25 Identities = 96/107 (89%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||| || ||||| || |||| |||||| |||||||||||||||||||||||||| Sbjct: 102370 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 102311 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||||||||| ||||| |||| Sbjct: 102310 cgggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggca 102264 Score = 109 bits (55), Expect = 7e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||||||||| ||||| || |||| |||||| ||||||||||||||||||||||||| Sbjct: 110250 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgac 110191 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| || |||||||||||||||||||| ||||| ||||| |||| Sbjct: 110190 ggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggca 110144
>ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 141 bits (71), Expect = 2e-30 Identities = 170/203 (83%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| ||||| ||||| |||||||| | ||| ||| ||||| |||||||||| Sbjct: 770 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 711 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 | ||||| || |||| |||||| ||||||||||||||||||||||||| ||||| || Sbjct: 710 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggggatggtc 651 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||||||||||||||||||| ||||| ||||| |||| || |||| ||| ||||| ||| Sbjct: 650 gccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacaccgggacatgg 591 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| |||||| |||||||||| Sbjct: 590 gagtcgcgggcgttgcgcttggg 568
>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA Length = 619 Score = 141 bits (71), Expect = 2e-30 Identities = 170/203 (83%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| ||||| ||||| |||||||| | ||| ||| ||||| |||||||||| Sbjct: 328 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 269 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 | ||||| || |||| |||||| ||||||||||||||||||||||||| ||||| || Sbjct: 268 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggggatggtc 209 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||||||||||||||||||| ||||| ||||| |||| || |||| ||| ||||| ||| Sbjct: 208 gccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacaccgggacatgg 149 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| |||||| |||||||||| Sbjct: 148 gagtcgcgggcgttgcgcttggg 126
>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full insert sequence Length = 618 Score = 141 bits (71), Expect = 2e-30 Identities = 170/203 (83%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| ||||| ||||| |||||||| | ||| ||| ||||| |||||||||| Sbjct: 327 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 268 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 | ||||| || |||| |||||| ||||||||||||||||||||||||| ||||| || Sbjct: 267 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggggatggtc 208 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||||||||||||||||||| ||||| ||||| |||| || |||| ||| ||||| ||| Sbjct: 207 gccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacaccgggacatgg 148 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| |||||| |||||||||| Sbjct: 147 gagtcgcgggcgttgcgcttggg 125
>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA, complete cds Length = 1066 Score = 141 bits (71), Expect = 2e-30 Identities = 125/143 (87%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| || ||||| | |||||||||||||||| | |||||||||| Sbjct: 850 atgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttgtagatc 791 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 |||||||||||||| || || || ||||||||||| ||||||||||||||||| |||||| Sbjct: 790 acggcagctccgaaacttctagctgggttgatgccagtgccggtgattgggatggtggcc 731 Query: 348 aggtgcaccatgaacaccgcgaa 370 | ||| ||||||||||||||||| Sbjct: 730 aagtgaaccatgaacaccgcgaa 708
>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA Length = 582 Score = 141 bits (71), Expect = 2e-30 Identities = 125/143 (87%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| || ||||| | |||||||||||||||| | |||||||||| Sbjct: 366 atgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttgtagatc 307 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 |||||||||||||| || || || ||||||||||| ||||||||||||||||| |||||| Sbjct: 306 acggcagctccgaaacttctagctgggttgatgccagtgccggtgattgggatggtggcc 247 Query: 348 aggtgcaccatgaacaccgcgaa 370 | ||| ||||||||||||||||| Sbjct: 246 aagtgaaccatgaacaccgcgaa 224
>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.5 gene) Length = 1094 Score = 137 bits (69), Expect = 3e-29 Identities = 129/149 (86%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 ||||| ||||| || ||||| ||||| ||||| |||||||| |||||||||| ||||| Sbjct: 833 gcaattgcggccccaatgaaaggcccgacccagaagatccaatggtcatcccatgccttg 774 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || | |||||| ||||| |||||||| |||||||| ||||||||||| || || |||||| Sbjct: 773 tcttcgttgtatatcacagcagctccaaagctcctagccgggttgataccagttccggtg 714 Query: 333 attgggatagtggccaggtgcaccatgaa 361 |||||||||||||||||||| |||||||| Sbjct: 713 attgggatagtggccaggtgaaccatgaa 685
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 135 bits (68), Expect = 1e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 |||||||| |||| ||| || || ||||| |||||||| ||| | ||||||||||||| Sbjct: 470 atggcggcgccgacgaacgggccgacccagaagatccattggttgtgccaggccttctcg 411 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| ||||| | |||| | |||| |||||||||||||||||||||||||| Sbjct: 410 ttgttgaagatgacggccggtccggtggtcctggccgggttgatgccggtgccggtgatc 351 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 ||||| || ||||| || ||||||||| ||||||||||||||||| || |||| || Sbjct: 350 gggatcgtcgccagttggaccatgaaccacgcgaagccgattggcagcggcgccaagacc 291 Query: 396 gggacgtgggagtcacgggcgctgcgcttggg 427 ||||| || ||||| |||||| |||||||||| Sbjct: 290 gggacatgtgagtcgcgggcgttgcgcttggg 259
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 133 bits (67), Expect = 5e-28 Identities = 118/135 (87%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||||||||| || ||||||||||| || || | ||| |||||||| ||||||| Sbjct: 25184040 ggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggt 25183981 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 | ||||||||||||||||| ||||| |||||||| || ||||||||||||||||| || | Sbjct: 25183980 taatgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaa 25183921 Query: 376 ttggcaaaggagcca 390 |||| | |||||||| Sbjct: 25183920 ttgggagaggagcca 25183906 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 ||||||||||| | |||||| || | |||||| || ||||||||||| || |||||||| Sbjct: 27065046 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 27064987 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| ||||||||||| |||| ||||||||| || || ||||||| Sbjct: 27064986 gggatggtggccaggtggaccaggaacaccgcaaaaccaattggca 27064941 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| ||||| ||||| || | ||| || |||||| Sbjct: 35369027 gggttgatgccggtgccggtgatggggatggtggcgaggtggacgaggaagacggcgaag 35368968 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 ||||| || | || ||||| | |||||||||||||| | |||| ||||||||| Sbjct: 35368967 ccgatggggagcggcgccaggatggggacgtgggagtccctggcgttgcgcttgg 35368913 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 25184690 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 25184631 Query: 228 atgaatggccccacccaaaagatcca 253 || | || |||||||| |||||||| Sbjct: 25184630 atcagggggcccacccagaagatcca 25184605 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 199 gggggtaggcggcggcaatggcggc 223 ||||| ||||||||||||||||||| Sbjct: 10894075 gggggaaggcggcggcaatggcggc 10894099
>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1469H02 Length = 136602 Score = 133 bits (67), Expect = 5e-28 Identities = 118/135 (87%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||||||||| || ||||||||||| || || | ||| |||||||| ||||||| Sbjct: 84433 ggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggt 84374 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 | ||||||||||||||||| ||||| |||||||| || ||||||||||||||||| || | Sbjct: 84373 taatgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaa 84314 Query: 376 ttggcaaaggagcca 390 |||| | |||||||| Sbjct: 84313 ttgggagaggagcca 84299 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 168 agcttgggggcactcgccctcaggacgtactgggggtaggcggcggcaatggcggctccg 227 ||||||| ||| || |||||||| ||||||||| ||||||||||||| |||||||| ||| Sbjct: 85083 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 85024 Query: 228 atgaatggccccacccaaaagatcca 253 || | || |||||||| |||||||| Sbjct: 85023 atcagggggcccacccagaagatcca 84998
>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds Length = 1216 Score = 131 bits (66), Expect = 2e-27 Identities = 177/214 (82%) Strand = Plus / Minus Query: 196 actgggggtaggcggcggcaatggcggctccgatgaatggccccacccaaaagatccagg 255 ||||| ||||| ||| |||||||| || || ||||| || || |||||||||||||| Sbjct: 868 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 809 Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || |||| Sbjct: 808 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 749 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 |||| |||||||| ||||| || |||||||||| ||| ||||||||||| || || || | Sbjct: 748 tgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggcaaacccaa 689 Query: 376 ttggcaaaggagccagcactgggacgtgggagtc 409 |||| | ||| ||||| || || || |||||||| Sbjct: 688 ttggaagaggtgccagaacaggaacatgggagtc 655
>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc Length = 800 Score = 131 bits (66), Expect = 2e-27 Identities = 162/194 (83%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||| ||||||||| ||||| || ||||| |||||||||| || || |||||||| || Sbjct: 516 ccgaggaatggcccaacccagaaaatccaatggtcatcccaagcttttccgttgttgaag 457 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 |||||||| || ||||||||||| |||||||| || |||||||||||||| || ||||| Sbjct: 456 atcacggcggcgccgaagctcctcgccgggttaatcccggtgccggtgatcggaatagtt 397 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||| ||| |||||||||||||| || || ||||| | ||| |||| ||| || ||||| Sbjct: 396 gccaagtgtaccatgaacaccgcaaaacctattgggagaggcgccaacacgggaacgtga 337 Query: 405 gagtcacgggcgct 418 |||||||| ||||| Sbjct: 336 gagtcacgcgcgct 323
>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1 (PIP2-1) mRNA, complete cds Length = 1300 Score = 131 bits (66), Expect = 2e-27 Identities = 177/214 (82%) Strand = Plus / Minus Query: 196 actgggggtaggcggcggcaatggcggctccgatgaatggccccacccaaaagatccagg 255 ||||| ||||| ||| |||||||| || || ||||| || || |||||||||||||| Sbjct: 864 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 805 Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || |||| Sbjct: 804 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 745 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 |||| |||||||| ||||| || |||||||||| ||| ||||||||||| || || || | Sbjct: 744 tgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggcaaacccaa 685 Query: 376 ttggcaaaggagccagcactgggacgtgggagtc 409 |||| | ||| ||||| || || || |||||||| Sbjct: 684 ttggaagaggtgccagaacaggaacatgggagtc 651
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds Length = 1285 Score = 131 bits (66), Expect = 2e-27 Identities = 168/202 (83%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || |||||||| ||||||||| |||| ||||| |||| || ||||||||| Sbjct: 889 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 830 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || | ||| || |||| | ||| |||||||||||||||||||| ||||| ||||| || Sbjct: 829 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtc 770 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 ||||||||||||| |||||||||||| ||||| || | || |||| | ||||||||| Sbjct: 769 gccaggtgcaccaggaacaccgcgaacccgatcggaagcggcgccaaaatggggacgtgg 710 Query: 405 gagtcacgggcgctgcgcttgg 426 ||||| | |||||||||||||| Sbjct: 709 gagtctctggcgctgcgcttgg 688
>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds Length = 1201 Score = 129 bits (65), Expect = 8e-27 Identities = 119/137 (86%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| |||||||| |||||||| ||||||||||||| |||| | |||| |||| Sbjct: 826 atgaatggtcccacccagaagatccaatggtcatcccaggctttctgttggttgaagata 767 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || |||||||||| ||||| ||||||||||||||||||||||||| |||||| |||||| Sbjct: 766 acagcagctccgagactcctggccgggttgatgccggtgccggtgactgggatggtggcc 707 Query: 348 aggtgcaccatgaacac 364 | ||| ||||||||||| Sbjct: 706 aagtgaaccatgaacac 690
>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane intrinsic protein mRNA, complete cds Length = 1120 Score = 125 bits (63), Expect = 1e-25 Identities = 132/155 (85%) Strand = Plus / Minus Query: 210 gcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggcc 269 ||||||||||| || || | ||||| || ||||| |||||||| |||||||||| ||| Sbjct: 776 gcggcaatggcagcaccaacaaatggtccaacccagaagatccactggtcatcccatgcc 717 Query: 270 ttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccg 329 || || |||||||| || || ||||||||||| ||||| || |||||||| ||||||||| Sbjct: 716 ttgtccttgttgtaaattacagcagctccgaaactcctggctgggttgataccggtgccg 657 Query: 330 gtgattgggatagtggccaggtgcaccatgaacac 364 || |||||||||||||||| ||| ||||||||||| Sbjct: 656 gtaattgggatagtggccaagtgaaccatgaacac 622
>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete cds Length = 1257 Score = 123 bits (62), Expect = 5e-25 Identities = 170/206 (82%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| || |||||||| |||||||| |||| |||||| || ||||||| Sbjct: 875 gctccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgttgttg 816 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 || | ||||| || |||| |||||| ||||||||||| |||||||| ||||| ||||| Sbjct: 815 tacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtgatcgggatc 756 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 || |||||||||||||||||||| ||||| ||||| || | || |||||||| || ||| Sbjct: 755 gtcgccaggtgcaccatgaacacagcgaacccgatcggaagcggcgccagcaccggaacg 696 Query: 402 tgggagtcacgggcgctgcgcttggg 427 |||||||| || ||| |||||||||| Sbjct: 695 tgggagtcgcgagcgttgcgcttggg 670
>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds Length = 1192 Score = 123 bits (62), Expect = 5e-25 Identities = 143/170 (84%) Strand = Plus / Minus Query: 210 gcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggcc 269 |||||||| |||||||| ||| || || |||||||| ||||| | |||||||||||| Sbjct: 843 gcggcaatcgcggctccagcgaacggtccgacccaaaatatccattgatcatcccaggcc 784 Query: 270 ttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccg 329 || ||||||||||| || |||||||||||||| || || |||||||| |||||||| Sbjct: 783 ttagaattgttgtagataaccgcagctccgaagcttctagcggggttgattccggtgcct 724 Query: 330 gtgattgggatagtggccaggtgcaccatgaacaccgcgaagccgattgg 379 ||||||||||| ||||||||||| |||||||| || ||||| |||||||| Sbjct: 723 gtgattgggatggtggccaggtgaaccatgaatacggcgaatccgattgg 674
>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin (OSJNBa0093B11.9), mRNA Length = 729 Score = 121 bits (61), Expect = 2e-24 Identities = 127/149 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||| ||||| || ||||||||||| ||||| |||||||| ||||||||||| || Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 529 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgg 397 ||| ||||| |||||||||| |||||||||||| ||||| ||||| || |||| ||| || Sbjct: 528 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacaccgg 469 Query: 398 gacgtgggagtcacgggcgctgcgcttgg 426 || |||| ||| || ||||||||||||| Sbjct: 468 gatgtggctgtcgcgcgcgctgcgcttgg 440
>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete cds Length = 480 Score = 121 bits (61), Expect = 2e-24 Identities = 142/169 (84%) Strand = Plus / Minus Query: 196 actgggggtaggcggcggcaatggcggctccgatgaatggccccacccaaaagatccagg 255 ||||| ||||| ||| |||||||| || || ||||| || || |||||||||||||| Sbjct: 418 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 359 Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || |||| Sbjct: 358 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 299 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 |||| ||||| || ||||| || |||||||||| ||| ||||||||||| Sbjct: 298 tgataccggtaccagtgataggaatagtggccaagtgaaccatgaacac 250
>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full insert sequence Length = 1232 Score = 121 bits (61), Expect = 2e-24 Identities = 127/149 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||| ||||| || ||||||||||| ||||| |||||||| ||||||||||| || Sbjct: 770 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 711 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgg 397 ||| ||||| |||||||||| |||||||||||| ||||| ||||| || |||| ||| || Sbjct: 710 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacaccgg 651 Query: 398 gacgtgggagtcacgggcgctgcgcttgg 426 || |||| ||| || ||||||||||||| Sbjct: 650 gatgtggctgtcgcgcgcgctgcgcttgg 622
>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 119 bits (60), Expect = 8e-24 Identities = 129/152 (84%) Strand = Plus / Minus Query: 275 gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 334 ||||| |||||| | ||| || |||| |||||| || ||||||||||||||||||||||| Sbjct: 969 gttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgat 910 Query: 335 tgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcac 394 ||||| ||||| |||||||||| ||| || ||||||||||| |||| || |||||| | Sbjct: 909 ggggatggtggcgaggtgcaccaggaatacggcgaagccgatgggcagcggggccagcgc 850 Query: 395 tgggacgtgggagtcacgggcgctgcgcttgg 426 |||||||||||||| | |||| ||||||||| Sbjct: 849 ggggacgtgggagtccctggcggtgcgcttgg 818
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds Length = 1262 Score = 119 bits (60), Expect = 8e-24 Identities = 126/148 (85%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | ||||||||| | ||||||||| ||||||||||||||||||||||| | Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactg 396 |||| || |||| |||||||| ||||||||| || ||||| ||||| || |||| | | Sbjct: 770 ggatcgtcgccaagtgcaccaagaacaccgcaaacccgatgggcaacggggccaagatag 711 Query: 397 ggacgtgggagtcacgggcgctgcgctt 424 | ||||||||||| | |||||||||||| Sbjct: 710 gaacgtgggagtccctggcgctgcgctt 683
>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA, complete cds Length = 1143 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 833 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 775 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 774 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 715 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 714 agtggccaaatgtaccataaacaccgc 688
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein Length = 1225 Score = 117 bits (59), Expect = 3e-23 Identities = 137/163 (84%) Strand = Plus / Minus Query: 219 gcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttg 278 ||||| |||||||| || || ||||| ||||||||| |||| |||||| | ||| || Sbjct: 876 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 817 Query: 279 ttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggg 338 |||||||| | ||| || |||| |||||| |||||||||||||||||||||||||| ||| Sbjct: 816 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 757 Query: 339 atagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || ||||||||||| |||| |||||| ||||| ||||| |||| Sbjct: 756 atggtggccaggtggaccaggaacacggcgaacccgatgggca 714
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1 (PIP1-1) mRNA, complete cds Length = 1115 Score = 117 bits (59), Expect = 3e-23 Identities = 158/191 (82%) Strand = Plus / Minus Query: 219 gcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttg 278 ||||| || |||||||| |||||||| ||||||||| |||| ||||| || | || ||| Sbjct: 831 gcggccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttg 772 Query: 279 ttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggg 338 |||||||| | ||| || || | ||||| || |||||||||||||| ||||| || ||| Sbjct: 771 ttgtagatgatggccgcacccaggctccgagctgggttgatgccggttccggttatgggg 712 Query: 339 atagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactggg 398 || ||||||| |||||||| |||||| ||||| ||||||||||| || ||||| | ||| Sbjct: 711 atggtggccaagtgcaccaagaacactgcgaacccgattggcaacggtgccagtataggg 652 Query: 399 acgtgggagtc 409 ||||||||||| Sbjct: 651 acgtgggagtc 641
>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB17ZB02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1041 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 700 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 699 agtggccaaatgtaccataaacaccgc 673
>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1079 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 700 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 699 agtggccaaatgtaccataaacaccgc 673
>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 809 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 751 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 750 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 691 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 690 agtggccaaatgtaccataaacaccgc 664
>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1074 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 700 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 699 agtggccaaatgtaccataaacaccgc 673
>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1095 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 700 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 699 agtggccaaatgtaccataaacaccgc 673
>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS38ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 821 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 510 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 452 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 451 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 392 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 391 agtggccaaatgtaccataaacaccgc 365
>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1083 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 819 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 761 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 760 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 701 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 700 agtggccaaatgtaccataaacaccgc 674
>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence Length = 1104 Score = 117 bits (59), Expect = 3e-23 Identities = 127/147 (86%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 834 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 776 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 775 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatcggaat 716 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 715 agtggccaaatgtaccataaacaccgc 689
>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.3 gene) Length = 1187 Score = 115 bits (58), Expect = 1e-22 Identities = 106/122 (86%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| || |||||| |||||||||| ||||| || |||||||||||||| ||||||||| Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 |||||||| || |||||||| || || ||||||||||| || ||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 360 aa 361 || Sbjct: 680 aa 679
>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.2 gene) Length = 978 Score = 115 bits (58), Expect = 1e-22 Identities = 151/182 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 |||||||| ||||| || ||||| | ||||||||||| || || |||||| |||| || Sbjct: 835 aatggcccaacccagaaaatccaatgatcatcccaggctttttcattgttgaagatgaca 776 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 ||||| || |||||||| || ||||||||||| || || || || ||||| ||||||| | Sbjct: 775 gcagcgccaaagctcctggcagggttgatgccagttccagttatagggattgtggccaag 716 Query: 351 tgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtca 410 || ||||||||||| ||||| |||||||| | |||||||| ||| |||| |||||||||| Sbjct: 715 tgtaccatgaacacagcgaacccgattggaagaggagccaacacagggatgtgggagtca 656 Query: 411 cg 412 || Sbjct: 655 cg 654
>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic protein 1 (mip1 gene) Length = 1187 Score = 115 bits (58), Expect = 1e-22 Identities = 106/122 (86%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| || |||||| |||||||||| ||||| || |||||||||||||| ||||||||| Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 |||||||| || |||||||| || || ||||||||||| || ||||||| ||| |||||| Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681 Query: 360 aa 361 || Sbjct: 680 aa 679
>gb|AY107589.1| Zea mays PCO085320 mRNA sequence Length = 569 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 302 gctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 ||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| Sbjct: 126 gctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgcaccatgaa 67 Query: 362 caccgcgaagccgattggcaaaggagccagcactgggacgtg 403 ||||||||| ||||| |||| || ||||| || |||||||| Sbjct: 66 caccgcgaatccgatgggcagcggcgccaggaccgggacgtg 25
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds Length = 1248 Score = 115 bits (58), Expect = 1e-22 Identities = 166/202 (82%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || || ||||| ||||||||| |||| ||||| |||| || ||||||||| Sbjct: 874 ccgatgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 815 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || | ||| || |||| | ||| ||||||||||||||||| || ||||| ||||| || Sbjct: 814 atgatggcggcgccgagggacctcgccgggttgatgccggtccccgtgatggggatcgtc 755 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 ||||||||||||| |||||||||||| ||||| || | || |||| | ||||||||| Sbjct: 754 gccaggtgcaccaggaacaccgcgaacccgatgggaagcggcgccaaaatggggacgtgg 695 Query: 405 gagtcacgggcgctgcgcttgg 426 ||||| | |||||||||||||| Sbjct: 694 gagtctctggcgctgcgcttgg 673
>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA, complete cds Length = 1277 Score = 113 bits (57), Expect = 5e-22 Identities = 126/149 (84%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||||||||| ||||| || |||||| | |||||||| ||||| ||| |||| Sbjct: 843 gctccgatgaatggcccgacccagaaaatccagtgttcatcccacgccttgtcgccgttg 784 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 | |||||||| || ||||| ||||| ||||||||||| ||||| |||||||| || ||| Sbjct: 783 aaaatcacggccgccccgaaactcctcgccgggttgattccggtaccggtgatcggaata 724 Query: 342 gtggccaggtgcaccatgaacaccgcgaa 370 ||||| ||||| |||||||| || ||||| Sbjct: 723 gtggcaaggtgaaccatgaatacggcgaa 695
>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2 Length = 1214 Score = 113 bits (57), Expect = 5e-22 Identities = 126/149 (84%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||||||||| ||||| || |||||| | || ||||| ||||| ||| |||| Sbjct: 809 gctccgatgaatggcccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttg 750 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 | |||||||| || ||||| ||||| ||||||||||| ||||| ||||||||||| ||| Sbjct: 749 aaaatcacggccgccccgaaactcctcgccgggttgattccggtaccggtgattggaata 690 Query: 342 gtggccaggtgcaccatgaacaccgcgaa 370 ||||| ||||| |||||||| || ||||| Sbjct: 689 gtggcaaggtgaaccatgaatacggcgaa 661
>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein 2;3, complete cds Length = 1218 Score = 113 bits (57), Expect = 5e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| |||||||| |||||||| | | ||||||||| |||| | |||| ||||| Sbjct: 865 atgaatggtcccacccagaagatccaatgtttatcccaggctttctgttggttgaagatc 806 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || ||||||||||| ||||| |||||||| |||||||| ||||||| |||||| |||||| Sbjct: 805 acagcagctccgaaactcctggccgggttaatgccggtaccggtgactgggatggtggcc 746 Query: 348 aggtgcaccatgaacac 364 | ||| ||||||||||| Sbjct: 745 aagtgaaccatgaacac 729
>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c, complete cds Length = 1065 Score = 113 bits (57), Expect = 5e-22 Identities = 162/197 (82%) Strand = Plus / Minus Query: 216 atggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcg 275 ||||||||||| |||||||| |||||||| || |||||| |||||||||| | ||| Sbjct: 812 atggcggctccaatgaatggtcccacccagaatatccagtggtcatcccacggcttggac 753 Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 | ||||||||| || || |||||||| ||||| |||||||| || ||||| |||||||| Sbjct: 752 tcgttgtagataaccgcggctccgaaactcctggccgggttaataccggttccggtgatc 693 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 || |||||||||| ||| |||||||||||||| || || || || | || |||| ||| Sbjct: 692 ggaatagtggccaagtgaaccatgaacaccgcaaatccaatcggaagtggcgccaacacg 633 Query: 396 gggacgtgggagtcacg 412 || |||||||||||||| Sbjct: 632 ggaacgtgggagtcacg 616
>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2), complete cds Length = 1126 Score = 113 bits (57), Expect = 5e-22 Identities = 158/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| || ||||| ||||||||||| |||||| |||||||||||| ||| ||| | ||| Sbjct: 822 gctccaataaatggtcccacccaaaatatccagtggtcatcccagggcttgctc-tcgtt 764 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 | |||| ||||| |||||||| |||||||||||||| || || || |||||||| || || Sbjct: 763 gaagatgacggctgctccgaaactccttgccgggttaataccagttccggtgatgggaat 704 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| |||||||||||||||||| || || ||||| | || |||| |||||| || Sbjct: 703 ggtagccaagtgcaccatgaacaccgcaaatccaattggaagtggcgccaacactggaac 644 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 643 gtgggagtc 635
>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA, complete cds Length = 1260 Score = 111 bits (56), Expect = 2e-21 Identities = 149/180 (82%) Strand = Plus / Minus Query: 230 gaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcac 289 |||||| || |||||||| ||||| |||||||||||| ||| || | ||||||||| || Sbjct: 853 gaatggtccaacccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794 Query: 290 ggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccag 349 |||||||| |||||||| || ||||||||||| || |||||||| ||||| ||||| || Sbjct: 793 agcagctccaaagctcctagcagggttgatgccagttccggtgatggggatggtggcaag 734 Query: 350 gtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtc 409 ||| ||||||||||| || || ||||| || | ||||||| || ||||| |||||||| Sbjct: 733 gtgaaccatgaacacagcaaatccgatgggaagtggagccaagacagggacatgggagtc 674
>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b, complete cds Length = 1087 Score = 111 bits (56), Expect = 2e-21 Identities = 155/188 (82%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 |||||||||||||| |||||||| || |||||| |||||||||| | ||| | |||| Sbjct: 807 gctccgatgaatggtcccacccagaaaatccagtggtcatcccacggcttggactcgttg 748 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| || || ||||| || ||||| |||||||| || ||||| ||||||||||| ||| Sbjct: 747 tagataaccgcggctccaaaactcctggccgggttaatcccggttccggtgattggaata 688 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacg 401 ||||||| ||| ||||||||||| || || || ||||| | || |||| ||| |||||| Sbjct: 687 gtggccaagtgaaccatgaacacggcaaatccaattggaagtggcgccaacacggggacg 628 Query: 402 tgggagtc 409 |||||||| Sbjct: 627 tgggagtc 620
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 107 bits (54), Expect = 3e-20 Identities = 120/142 (84%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| ||||||||||||| | | |||||||||| | |||||| || Sbjct: 767 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 708 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||||||||||||||| ||||| ||||||||||| |||| | Sbjct: 707 aggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtgaaccaag 648 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || |||||||||| Sbjct: 647 aacaccgcaaacccgattggca 626
>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06, complete sequence Length = 127420 Score = 107 bits (54), Expect = 3e-20 Identities = 108/126 (85%) Strand = Plus / Plus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||| ||||| ||||||| | ||||||||| ||||| || |||| ||||| || |||| Sbjct: 91205 ggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggt 91264 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 ||||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||| |||| Sbjct: 91265 tgatgcccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccga 91324 Query: 376 ttggca 381 | |||| Sbjct: 91325 tgggca 91330 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 222 gctccgatgaatggccccacccaaaagatcca 253 ||||||||||| |||||| |||| |||||||| Sbjct: 91088 gctccgatgaacggccccgcccagaagatcca 91119
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full insert sequence Length = 1163 Score = 107 bits (54), Expect = 3e-20 Identities = 120/142 (84%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| ||||||||||||| | | |||||||||| | |||||| || Sbjct: 844 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 785 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||||||||||||||| ||||| ||||||||||| |||| | Sbjct: 784 aggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtgaaccaag 725 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || |||||||||| Sbjct: 724 aacaccgcaaacccgattggca 703
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full insert sequence Length = 1164 Score = 107 bits (54), Expect = 3e-20 Identities = 120/142 (84%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| ||||||||||||| | | |||||||||| | |||||| || Sbjct: 845 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 786 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||||||||||||||| ||||| ||||||||||| |||| | Sbjct: 785 aggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtgaaccaag 726 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || |||||||||| Sbjct: 725 aacaccgcaaacccgattggca 704
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full insert sequence Length = 1167 Score = 107 bits (54), Expect = 3e-20 Identities = 120/142 (84%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| ||||||||||||| | | |||||||||| | |||||| || Sbjct: 847 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 788 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||||||||||||||| ||||| ||||||||||| |||| | Sbjct: 787 aggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtgaaccaag 728 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || |||||||||| Sbjct: 727 aacaccgcaaacccgattggca 706
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full insert sequence Length = 1462 Score = 107 bits (54), Expect = 3e-20 Identities = 120/142 (84%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| ||||||||||||| | | |||||||||| | |||||| || Sbjct: 1143 acccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggcagcgcca 1084 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||||||||||||||| ||||| ||||||||||| |||| | Sbjct: 1083 aggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtgaaccaag 1024 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || |||||||||| Sbjct: 1023 aacaccgcaaacccgattggca 1002
>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A) transcript variant AT3G53420.1 mRNA, complete cds Length = 1347 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 1035 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 977 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 976 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 917 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 916 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 857 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 856 gtgggagtc 848
>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant AT3G53420.2 mRNA, complete cds Length = 1278 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 985 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 927 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 926 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 867 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 866 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 807 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 806 gtgggagtc 798
>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a Length = 1112 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 815 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 757 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 756 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 697 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 696 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 637 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 636 gtgggagtc 628
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11, complete sequence Length = 147806 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | |||||| || | |||||| || ||||||||||||||||||||||| | Sbjct: 28000 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 27941 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||| ||||||||||| |||| ||||||||| || |||||||||| Sbjct: 27940 ggatggtggccaggtgaaccaagaacaccgcaaacccgattggca 27896
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin Length = 1291 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | ||| || |||| |||||| |||||||||||||||||||||||||| | Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||| ||||||||||| |||| |||||| ||||| ||||| |||| Sbjct: 597 ggatggtggccaggtggaccaggaacacggcgaacccgatgggca 553
>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete sequence Length = 178692 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||| ||||| || ||||||||||| ||||| |||||||| ||||||||||| || Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 ||| ||||| |||||||||| |||||||||||| ||||| ||||| Sbjct: 47713 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaa 47757
>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2 (PIP2-2) mRNA, complete cds Length = 1171 Score = 105 bits (53), Expect = 1e-19 Identities = 161/197 (81%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| |||| ||||| | || || ||||||||||| ||| Sbjct: 793 aatggtccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacg 734 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 || || ||||||||||| || ||||||||||||||||||||||| ||||| ||||| ||| Sbjct: 733 gcggcgccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggcaagg 674 Query: 351 tgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtca 410 || |||||||| || || || || || |||| ||||||| || ||||||||||| || Sbjct: 673 tggaccatgaagacagcaaacccaatgggcagtggagccaaaacagggacgtgggaatct 614 Query: 411 cgggcgctgcgcttggg 427 | |||||| | |||||| Sbjct: 613 ctggcgcttctcttggg 597
>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (At3g53420) mRNA, complete cds Length = 1122 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 827 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 769 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 768 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 709 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 708 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 649 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 648 gtgggagtc 640
>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1112 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 835 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 777 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 776 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 717 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 716 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 657 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 656 gtgggagtc 648
>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 864 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 776 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 718 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 717 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 658 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 657 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 598 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 597 gtgggagtc 589
>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a (F4P12.12) mRNA, complete cds Length = 956 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 776 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 718 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 717 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 658 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 657 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 598 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 597 gtgggagtc 589
>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds Length = 1129 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 835 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 777 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 776 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 717 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 716 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 657 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 656 gtgggagtc 648
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||| ||||| || ||||||||||| ||||| |||||||| ||||||||||| || Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 ||| ||||| |||||||||| |||||||||||| ||||| ||||| Sbjct: 17626918 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaa 17626874
>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1056 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 818 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 760 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 759 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 700 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 699 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 640 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 639 gtgggagtc 631
>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1071 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 823 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 765 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 764 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 705 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 704 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 645 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 644 gtgggagtc 636
>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS52ZB11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1117 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 819 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 761 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 760 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 701 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 700 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 641 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 640 gtgggagtc 632
>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence Length = 1352 Score = 105 bits (53), Expect = 1e-19 Identities = 157/189 (83%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 1037 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 979 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 978 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 919 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 918 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 859 Query: 401 gtgggagtc 409 ||||||||| Sbjct: 858 gtgggagtc 850
>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1093 Score = 105 bits (53), Expect = 1e-19 Identities = 151/181 (83%), Gaps = 2/181 (1%) Strand = Plus / Minus Query: 230 gaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgttgtagatca 288 |||||| ||||||||||| |||||| |||||||||| | ||| ||| | |||| |||| | Sbjct: 778 gaatggtcccacccaaaatatccagtggtcatcccatggcttgctc-tcgttgaagataa 720 Query: 289 cggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcca 348 |||| |||||||| ||||||||||||||||| || || || ||||| || || || |||| Sbjct: 719 cggctgctccgaaactccttgccgggttgattccagttccagtgatgggaatggtagcca 660 Query: 349 ggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagt 408 |||||||||||||||||| || || || || | || |||| ||||||||||||||||| Sbjct: 659 agtgcaccatgaacaccgcaaatccaatgggaagtggcgccaacactgggacgtgggagt 600 Query: 409 c 409 | Sbjct: 599 c 599
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||||| ||||| || ||||||||||| ||||| |||||||| ||||||||||| || Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaa 382 ||| ||||| |||||||||| |||||||||||| ||||| ||||| Sbjct: 17635958 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaa 17635914
>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1035 Score = 103 bits (52), Expect = 5e-19 Identities = 156/188 (82%), Gaps = 2/188 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 815 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 757 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| || || || Sbjct: 756 gtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatgggaat 697 Query: 341 agtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggac 400 || |||| || ||||||||||| || || |||||||| | || |||| ||| || || Sbjct: 696 ggtagccaaatgtaccatgaacacggcaaatccgattggaagtggcgccaacaccggaac 637 Query: 401 gtgggagt 408 |||||||| Sbjct: 636 gtgggagt 629
>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3); water channel AT4G35100 (PIP3) mRNA, complete cds Length = 1182 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 726 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 667 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 666 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 608
>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b Length = 1095 Score = 101 bits (51), Expect = 2e-18 Identities = 125/147 (85%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 785 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 727 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 ||||| |||| |||||||| ||||| ||||||||||||||||| |||||||| || || Sbjct: 726 atagattacggacgctccgaaactcctagccgggttgatgccggttccggtgatcggaat 667 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 666 agtggccaaatgtaccataaacaccgc 640
>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA, partial cds Length = 495 Score = 101 bits (51), Expect = 2e-18 Identities = 111/131 (84%) Strand = Plus / Minus Query: 251 ccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgc 310 |||| |||| ||||||||||| || |||||||||||||| |||||||| | ||| ||||| Sbjct: 495 ccagtggtcgtcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgc 436 Query: 311 cgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaa 370 ||||| ||||| ||||| ||||||||||| ||||| |||||||| || ||||| || || Sbjct: 435 tgggtttatgccagtgccagtgattgggattgtggcaaggtgcacaataaacacagcaaa 376 Query: 371 gccgattggca 381 || ||||||| Sbjct: 375 cccaattggca 365
>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP) (At4g35100) mRNA, complete cds Length = 946 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 678 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 677 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 618 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 617 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 559
>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP) (At4g35100; M4E13.150) mRNA, complete cds Length = 1036 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 724 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 665 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 664 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 606
>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds Length = 1026 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 726 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 667 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 666 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 608
>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP) mRNA, complete cds Length = 1030 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 706 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 705 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 646 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 645 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 587
>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1036 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 718 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 717 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 658 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 657 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 599
>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB11ZA04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 999 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 716 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 715 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 656 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 655 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 597
>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1019 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 715 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 714 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 655 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 654 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 596
>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS11ZH09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 985 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 710 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 709 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 650 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 649 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 591
>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds Length = 909 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || ||||| || || || ||||| || |||||||| |||| ||||||||| Sbjct: 680 aagcttctcgctgggttaattccagttccggtaatggggatagtagccaaatgcaccatg 621 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| ||||| || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 620 aacacagcgaatccaattggaagtggagccaaaacagggatgtgagagtcacgagcgct 562
>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence Length = 1033 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 726 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 667 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 666 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 608
>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds Length = 748 Score = 101 bits (51), Expect = 2e-18 Identities = 147/179 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 417 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || |||||||| |||| ||||||||| Sbjct: 416 aagcttctagctgggttgataccagttccagtaatggggatagtagccaaatgcaccatg 357 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 356 aacacagcaaatccaattggaagtggagccacaacggggatgtgagagtcacgagcgct 298
>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017, complete sequence Length = 121127 Score = 101 bits (51), Expect = 2e-18 Identities = 120/143 (83%) Strand = Plus / Minus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 |||||| |||| || ||||| |||||||||||||| ||||| |||||||| || ||||| Sbjct: 35106 ttgttgaagataacagcagcaccgaagctccttgcagggttaatgccggtaccagtgatg 35047 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcact 395 || || ||||||||||| |||||||| || ||||| || || ||||| || ||||| ||| Sbjct: 35046 ggtatggtggccaggtgaaccatgaaaacagcgaaaccaataggcaacggtgccagtact 34987 Query: 396 gggacgtgggagtcacgggcgct 418 || ||||| |||||||| ||||| Sbjct: 34986 ggcacgtgagagtcacgcgcgct 34964
>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete cds Length = 1255 Score = 101 bits (51), Expect = 2e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 |||||||| ||||| || ||||| || |||||||||||||| ||||||||||||||||| Sbjct: 875 gcaatggctgctccaataaatggtccaacccaaaagatccaatggtcatcccaggccttc 816 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 | | |||||| || || |||||||| | |||||| || ||||| ||||| ||||| || Sbjct: 815 tgttggttgtacatgacagcagctcctaggctcctagcagggttaatgccagtgcctgtt 756 Query: 333 attgggatagtggccaggtgcaccatgaacaccgcgaagccgattgg 379 | |||||| |||||| ||| ||||||||||| || ||||| ||||| Sbjct: 755 actgggatgttggccaagtgaaccatgaacacagcaaagccaattgg 709
>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds Length = 1147 Score = 99.6 bits (50), Expect = 7e-18 Identities = 113/134 (84%) Strand = Plus / Minus Query: 237 cccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagct 296 |||||||| |||||||| |||||| |||||| | || |||||||||| | |||||| Sbjct: 873 cccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggcagcc 814 Query: 297 ccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcacc 356 || | |||||| || ||||||||||||||||||||||| || || ||||||||||| ||| Sbjct: 813 ccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtggacc 754 Query: 357 atgaacaccgcgaa 370 | |||||||||||| Sbjct: 753 aggaacaccgcgaa 740
>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic protein, complete cds Length = 1223 Score = 97.6 bits (49), Expect = 3e-17 Identities = 151/185 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| || |||||| ||||||||||||| | | ||||||||||| | |||||| ||| Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| || ||||||||||| || ||||||| ||||| ||||||| |||||||| | Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 755 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctg 419 ||||| ||||| || |||||||| ||||||| | || ||||||||||| | |||||| Sbjct: 754 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggagtctctggcgcta 695 Query: 420 cgctt 424 ||||| Sbjct: 694 cgctt 690
>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic protein, complete cds Length = 1260 Score = 97.6 bits (49), Expect = 3e-17 Identities = 151/185 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| || |||||| ||||||||||||| | || ||||||||||| | |||||| || Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | || ||||| ||||||||||| || ||||||| ||||| ||||||| |||||||| | Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 759 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctg 419 ||||| ||||| || |||||||| ||||||| | || ||||||||||| | |||||| Sbjct: 758 aacacggcgaacccaattggcaacggagccaaaatcggaacgtgggagtctctggcgcta 699 Query: 420 cgctt 424 ||||| Sbjct: 698 cgctt 694
>gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquaporin mRNA, partial cds Length = 607 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 |||||||| || || |||||||| || |||||||||||||| |||||||||||| ||| Sbjct: 181 gcaatggctgccccaatgaatggtcctacccaaaagatccaatggtcatcccagggcttg 122 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || | |||| |||| || |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 121 tcttggttgaagataacagcagctccaaaactccttgcagggttaatgccagttccagtg 62 Query: 333 attgggatagtggccaggtgcaccatgaacac 364 | |||||| ||||||| || ||||||||||| Sbjct: 61 actgggatggtggccaaatgaaccatgaacac 30
>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete sequence Length = 80736 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 ||||| ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||| Sbjct: 25095 ttgttatagattacggcagctccgaaactcctagccgggttgatgccggttccggtgatc 25036 Query: 336 gggatagtggccaggtgcaccatgaacaccgc 367 || |||||||||| || ||||| |||||||| Sbjct: 25035 ggaatagtggccaaatgtaccataaacaccgc 25004 Score = 73.8 bits (37), Expect = 4e-10 Identities = 73/85 (85%) Strand = Plus / Plus Query: 283 agatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatag 342 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 20260 agattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaatag 20319 Query: 343 tggccaggtgcaccatgaacaccgc 367 |||||| || ||||| |||||||| Sbjct: 20320 tggccaaatgtaccataaacaccgc 20344
>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete cds Length = 1153 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 302 gctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 |||||| |||||||||||||||||||||||||| ||||| ||||| ||||| |||| ||| Sbjct: 835 gctcctagccgggttgatgccggtgccggtgatggggatggtggcaaggtggaccaggaa 776 Query: 362 caccgcgaagccgattggca 381 ||||||||| || ||||||| Sbjct: 775 caccgcgaacccaattggca 756
>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete cds Length = 1296 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 302 gctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 |||||| |||||||||||||||||||||||||| ||||| ||||| ||||| |||| ||| Sbjct: 830 gctcctagccgggttgatgccggtgccggtgatggggatggtggcaaggtggaccaggaa 771 Query: 362 caccgcgaagccgattggca 381 ||||||||| || ||||||| Sbjct: 770 caccgcgaacccaattggca 751
>gb|AY103580.1| Zea mays PCO072544 mRNA sequence Length = 1633 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 302 gctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 |||||| |||||||||||||||||||||||||| ||||| ||||| ||||| |||| ||| Sbjct: 1159 gctcctagccgggttgatgccggtgccggtgatggggatggtggcaaggtggaccaggaa 1100 Query: 362 caccgcgaagccgattggca 381 ||||||||| || ||||||| Sbjct: 1099 caccgcgaacccaattggca 1080
>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA, complete cds Length = 1143 Score = 93.7 bits (47), Expect = 4e-16 Identities = 124/147 (84%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || || Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaat 719 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 718 agtggccaaatgtaccataaacaccgc 692
>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA, complete cds Length = 889 Score = 93.7 bits (47), Expect = 4e-16 Identities = 124/147 (84%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 770 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 712 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || || Sbjct: 711 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaat 652 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 651 agtggccaaatgtaccataaacaccgc 625
>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic protein 2C (At2g37180) mRNA, complete cds Length = 1151 Score = 93.7 bits (47), Expect = 4e-16 Identities = 124/147 (84%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || || Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaat 719 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 718 agtggccaaatgtaccataaacaccgc 692
>dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane intrinsic protein 2a, partial cds, clone: RAFL22-59-G07 Length = 420 Score = 93.7 bits (47), Expect = 4e-16 Identities = 97/111 (87%), Gaps = 2/111 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| || |||||||| |||||| |||||||||| | ||| ||| ||||| Sbjct: 117 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 59 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 331 |||||| |||||||||||||| |||||||||||||| || ||||| ||||| Sbjct: 58 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 8
>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence Length = 1060 Score = 93.7 bits (47), Expect = 4e-16 Identities = 124/147 (84%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || || Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaat 719 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 718 agtggccaaatgtaccataaacaccgc 692
>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel protein Length = 1121 Score = 93.7 bits (47), Expect = 4e-16 Identities = 124/147 (84%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggcctt-ctcgttgtt 280 ||||| |||||||| |||||||| || |||||| |||||||||| | ||| ||| ||||| Sbjct: 820 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 762 Query: 281 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggat 340 |||| ||||| |||||||| ||||| ||||||||||| ||||| |||||||| || || Sbjct: 761 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgatcggaat 702 Query: 341 agtggccaggtgcaccatgaacaccgc 367 |||||||| || ||||| |||||||| Sbjct: 701 agtggccaaatgtaccataaacaccgc 675
>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA, complete cds Length = 1026 Score = 93.7 bits (47), Expect = 4e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 ||||| || ||||| |||||||| || ||||| || |||||| |||||||||| | ||| Sbjct: 804 gcaatcgcagctccaatgaatggtccaacccagaatatccagtggtcatcccacggcttg 745 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 | ||||||||| || ||||||||||| |||||||||||||| || || || |||||| Sbjct: 744 gactcgttgtagataaccgcagctccgaaactccttgccgggttaattcctgttccggtg 685 Query: 333 attgggatagtggccaggtgcaccatgaacaccgc 367 || || |||||||||| ||| |||||||| ||||| Sbjct: 684 atcggaatagtggccaagtgaaccatgaagaccgc 650
>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA, complete cds Length = 1046 Score = 93.7 bits (47), Expect = 4e-16 Identities = 146/179 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| || || |||||||| || || || || || || ||||| |||| ||||||||| Sbjct: 724 aagcttctagctgggttgataccagttccagtaatgggaatagtagccaaatgcaccatg 665 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 ||||| || || || ||||| | ||||||| || |||| ||| |||||||| ||||| Sbjct: 664 aacacagcaaatccaattggaagtggagccaaaacggggatgtgagagtcacgagcgct 606
>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA, complete cds Length = 1179 Score = 93.7 bits (47), Expect = 4e-16 Identities = 134/163 (82%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 ||||||||||| ||||| | ||||| |||| || ||||| ||||| ||||| || |||| Sbjct: 855 ggtcatcccagttcttcttgctgttgaagataacagcagcaccgaaactcctagcagggt 796 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 ||||||||||||| ||||| ||||| ||||||| || ||||||||||| || || || | Sbjct: 795 tgatgccggtgccagtgatggggatggtggccaaatgaaccatgaacacagcaaaaccaa 736 Query: 376 ttggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 | || | ||| || |||||||| ||||| |||||||| ||||| Sbjct: 735 tgggaagaggggcaagcactggcacgtgagagtcacgcgcgct 693
>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog (mipE) mRNA, partial cds Length = 963 Score = 93.7 bits (47), Expect = 4e-16 Identities = 134/163 (82%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 ||||||||||| ||||| | ||||| |||| || ||||| ||||| ||||| || |||| Sbjct: 639 ggtcatcccagttcttcttgctgttgaagataacagcagcaccgaaactcctagcagggt 580 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 ||||||||||||| ||||| ||||| ||||||| || ||||||||||| || || || | Sbjct: 579 tgatgccggtgccagtgatggggatggtggccaaatgaaccatgaacacagcaaaaccaa 520 Query: 376 ttggcaaaggagccagcactgggacgtgggagtcacgggcgct 418 | || | ||| || |||||||| ||||| |||||||| ||||| Sbjct: 519 tgggaagaggggcaagcactggcacgtgagagtcacgcgcgct 477
>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like protein mRNA, complete cds Length = 1086 Score = 91.7 bits (46), Expect = 2e-15 Identities = 130/158 (82%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||| || |||||| |||||||||| |||| || |||||| Sbjct: 833 gctccaatgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgttg 774 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || |||||||| || || |||||||||||||| Sbjct: 773 tagatgatagcagctccaagactcctggcagggttgataccagttccggtgattgggatg 714 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 ||||||| || |||| |||||||||||| || ||||| Sbjct: 713 gtggccaaatgaaccaagaacaccgcgaatccaattgg 676
>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS Length = 1139 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 693 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 692 aacaccgcaaaaccaattggca 671
>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full insert sequence Length = 1128 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 725 aacaccgcaaaaccaattggca 704
>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full insert sequence Length = 1205 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 781 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 780 aacaccgcaaaaccaattggca 759
>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full insert sequence Length = 1136 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 725 aacaccgcaaaaccaattggca 704
>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like protein mRNA, complete cds Length = 1153 Score = 91.7 bits (46), Expect = 2e-15 Identities = 130/158 (82%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||| ||||||||| |||||| ||| |||| || |||||| Sbjct: 843 gctccaatgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttg 784 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || |||||||| || || |||||||||||||| Sbjct: 783 tagatgatagcagctccaagactcctggcagggttgataccagttccggtgattgggatg 724 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 ||||||| || |||| |||||||||||| || ||||| Sbjct: 723 gtggccaaatgaaccaagaacaccgcgaatccaattgg 686
>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds Length = 1140 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 721 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 720 aacaccgcaaaaccaattggca 699
>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein 2-2, complete cds Length = 1051 Score = 91.7 bits (46), Expect = 2e-15 Identities = 145/178 (81%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 ||||| || ||||| ||||| || || ||||| || ||||| |||||||||| ||||| Sbjct: 859 gcaattgctgctccaatgaagggtcctacccagaaaatccattggtcatcccaagccttg 800 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || ||||||||||| || |||||||| | || || || ||||||||||| ||||| ||| Sbjct: 799 tctttgttgtagataacagcagctccaagacttctagcggggttgatgccagtgccagtg 740 Query: 333 attgggatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagcca 390 |||||||| ||||||| ||| || |||||||| || || || ||||||| ||||||| Sbjct: 739 attgggatggtggccaagtggacaatgaacacagcaaacccaattggcagtggagcca 682
>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel protein, complete cds Length = 1116 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | || ||||||||||| | |||||| || Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| || |||||||| ||||| ||||||||||| |||| | Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 724 Query: 360 aacaccgcgaagccgattggca 381 |||||||| || || ||||||| Sbjct: 723 aacaccgcaaaaccaattggca 702
>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660 (PIP2;4/PIP2F) mRNA, complete cds Length = 1139 Score = 89.7 bits (45), Expect = 7e-15 Identities = 141/173 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||| ||||| |||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| | ||||||||||| ||||| |||||||| || || ||||| | || |||||| Sbjct: 748 aagctacgagccgggttgataccggttccggtgatgggaatggtggctaaatgaaccatg 689 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacg 412 || || || ||||| || || | ||||||| ||||| ||||| |||||||| Sbjct: 688 aagacggcaaagccaatgggaagtggagccaaaactggcacgtgagagtcacg 636
>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds Length = 1278 Score = 89.7 bits (45), Expect = 7e-15 Identities = 123/149 (82%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 |||||||| ||||| || ||||| || | ||| |||||||| |||||||||| || || Sbjct: 797 gcaatggcagctccaataaatggtccaagccagaagatccattggtcatcccaagctttg 738 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || |||||||||||||| |||||||| || || || || |||||||| || || || ||| Sbjct: 737 tccttgttgtagatcacagcagctccaaaacttctagcagggttgataccagttccagtg 678 Query: 333 attgggatagtggccaggtgcaccatgaa 361 |||||||| ||||||||||| || ||||| Sbjct: 677 attgggatggtggccaggtgaacgatgaa 649
>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence Length = 1120 Score = 89.7 bits (45), Expect = 7e-15 Identities = 141/173 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||| ||||| |||| ||||||||||| ||||||||||| || ||||||||||| Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 ||||| | ||||||||||| ||||| |||||||| || || ||||| | || |||||| Sbjct: 748 aagctacgagccgggttgataccggttccggtgatgggaatggtggctaaatgaaccatg 689 Query: 360 aacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtcacg 412 || || || ||||| || || | ||||||| ||||| ||||| |||||||| Sbjct: 688 aagacggcaaagccaatgggaagtggagccaaaactggcacgtgagagtcacg 636
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 21009498 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 21009439 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 21009438 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 21009395
>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1274F11 Length = 171257 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 101587 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 101528 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 101527 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 101484
>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full insert sequence Length = 1247 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 760 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 701 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 700 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 657
>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full insert sequence Length = 1066 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 658 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 599 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 598 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 555
>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full insert sequence Length = 1249 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 758 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 699 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 698 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 655
>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full insert sequence Length = 1302 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 753 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 694 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 693 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 650
>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0478E02 Length = 140715 Score = 87.7 bits (44), Expect = 3e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 |||||| | |||||| || |||| |||||| |||||||||||||| ||||||||||| || Sbjct: 30798 gttgtacagcacggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcgg 30739 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || || ||||||||||| | |||||||||||| ||||| |||| Sbjct: 30738 aatcgtcgccaggtgcacgacgaacaccgcgaacccgatcggca 30695
>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein 1-1, complete cds Length = 1351 Score = 87.7 bits (44), Expect = 3e-14 Identities = 116/140 (82%) Strand = Plus / Minus Query: 251 ccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgc 310 |||| ||||||||||||| | || ||||||||||| | |||||| || | ||||| || Sbjct: 1004 ccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgccaagactcctggc 945 Query: 311 cgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaa 370 ||||||||||| || ||||||| ||||| ||||||| |||||||| |||||| ||||| Sbjct: 944 tgggttgatgccagttccggtgacggggatggtggccaagtgcaccaagaacacggcgaa 885 Query: 371 gccgattggcaaaggagcca 390 || |||||||| ||||||| Sbjct: 884 cccaattggcaacggagcca 865
>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds Length = 1071 Score = 85.7 bits (43), Expect = 1e-13 Identities = 166/207 (80%) Strand = Plus / Minus Query: 218 ggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgtt 277 |||||| |||||||| || || ||||| |||||||| |||| ||||| ||||| || Sbjct: 793 ggcggcgccgatgaacgggccaacccagaagatccactggtcgtcccaagccttgccgcc 734 Query: 278 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 337 ||||| | |||||| || || ||||||||||| || ||||| ||||| ||||||| || Sbjct: 733 attgtacaccacggcggcgccaaagctccttgctggattgatcccggttccggtgacggg 674 Query: 338 gatagtggccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgg 397 ||||||||| |||||| |||||| ||| ||||| ||||| ||| || |||||||| || Sbjct: 673 gatagtggcgaggtgcgccatgagcacggcgaacccgatgagcagcggcgccagcaccgg 614 Query: 398 gacgtgggagtcacgggcgctgcgctt 424 |||||| | || |||||| ||||||| Sbjct: 613 gacgtgtggatcccgggcgatgcgctt 587
>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds Length = 1116 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||||||||||||| |||| ||||| || | |||| |||| Sbjct: 865 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcatgttcgtcgttg 806 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || ||||||||||| || |||||||| || || Sbjct: 805 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgatgggaatg 746 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgat 376 ||||||| || |||| |||||||||||| ||||| Sbjct: 745 gtggccaaatgaaccaagaacaccgcgaatccgat 711
>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence Length = 1154 Score = 83.8 bits (42), Expect = 4e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| ||||| ||||| |||| |||||||||||| Sbjct: 675 gggttgatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaac 616 Query: 372 ccgattggca 381 || ||||||| Sbjct: 615 ccaattggca 606
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein Length = 1179 Score = 83.8 bits (42), Expect = 4e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 |||||||| |||||||||||||| ||||| ||||||||||| |||| ||||||||| || Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacaccgcaaac 719 Query: 372 ccgattggca 381 |||||||||| Sbjct: 718 ccgattggca 709
>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB75ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1128 Score = 83.8 bits (42), Expect = 4e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 825 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 766 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| |||||||| || ||||| | Sbjct: 765 gcagctccaaaactcctagccgggtttattccggtgccagtgattggaattgtggctaaa 706 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 705 tgaaccatgaacac 692
>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds Length = 423 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| |||||||| |||||| |||||| | ||| |||||||||| | |||||| || Sbjct: 341 acccagaagatccaatggtcattccaggcgtgctccctgttgtagatgatggcagcgcca 282 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||| || ||||||||||| ||||| || || ||||| ||||| ||||| |||| | Sbjct: 281 aggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtggaccaag 222 Query: 360 aacaccgcgaagccgattggca 381 ||||||||||| || ||||||| Sbjct: 221 aacaccgcgaacccaattggca 200
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1486_E07 Length = 110494 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 ||||||||||| | |||||| || | |||||| || ||||||||||| || |||||||| Sbjct: 36695 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 36636 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| ||||||||||| |||| ||||||||| || || ||||||| Sbjct: 36635 gggatggtggccaggtggaccaggaacaccgcaaaaccaattggca 36590
>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461B08 Length = 153743 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 ||||||||||| | |||||| || | |||||| || ||||||||||| || |||||||| Sbjct: 118248 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 118189 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 ||||| ||||||||||| |||| ||||||||| || || ||||||| Sbjct: 118188 gggatggtggccaggtggaccaggaacaccgcaaaaccaattggca 118143
>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene), clone pR450-4 Length = 452 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||||||||| || | |||||| || || |||||||| || |||||||| |||| Sbjct: 430 ggtcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctgggt 371 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 ||||||| ||||| |||||||| || || |||| ||| |||||||| Sbjct: 370 tgatgccagtgccagtgattggaatggtagccaagtgaaccatgaa 325
>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene), clone pR450-3 Length = 452 Score = 83.8 bits (42), Expect = 4e-13 Identities = 69/78 (88%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||| Sbjct: 430 ggtcatcccatgccttctccttgttgtagattacagcagctccgaaactccttgctgggt 371 Query: 316 tgatgccggtgccggtga 333 |||| || ||||| |||| Sbjct: 370 tgattccagtgccagtga 353
>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds Length = 1179 Score = 83.8 bits (42), Expect = 4e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 |||||||| |||||||||||||| ||||| ||||||||||| |||| ||||||||| || Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacaccgcaaac 719 Query: 372 ccgattggca 381 |||||||||| Sbjct: 718 ccgattggca 709
>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence Length = 514 Score = 81.8 bits (41), Expect = 2e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||||||||| |||||||||||||||||||| || ||||| || Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagataacagcagcacca 104 Query: 300 aagctccttgccgggtt 316 ||||| ||||| ||||| Sbjct: 103 aagcttcttgctgggtt 87
>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds Length = 1278 Score = 81.8 bits (41), Expect = 2e-12 Identities = 131/161 (81%) Strand = Plus / Minus Query: 219 gcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttg 278 ||||| || ||||| || || ||||| || ||||| |||||||||| ||||| || ||| Sbjct: 910 gcggcaccaatgaagggtccgacccagaaaatccattggtcatcccatgccttatccttg 851 Query: 279 ttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggg 338 |||||||| |||||||||||||| | ||||| || || || || ||||||||||| Sbjct: 850 ccatagatcacagcagctccgaagcttcgagccggattaataccagttccggtgattgga 791 Query: 339 atagtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || ||||||||||| ||||||||||| || || |||||||| Sbjct: 790 atggtggccaggtgaaccatgaacacggcaaatccgattgg 750
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||| Sbjct: 164523 ggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctgggt 164464 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 |||| || || || || || |||||||| |||| |||||||||||||| Sbjct: 164463 tgataccagttccagtaatggggatagtagccaaatgcaccatgaacac 164415
>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone T12J5 (ESSAII project) Length = 84499 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||| Sbjct: 34601 ggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctgggt 34542 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 |||| || || || || || |||||||| |||| |||||||||||||| Sbjct: 34541 tgataccagttccagtaatggggatagtagccaaatgcaccatgaacac 34493
>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project) Length = 80346 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||| Sbjct: 65556 ggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctgggt 65497 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 |||| || || || || || |||||||| |||| |||||||||||||| Sbjct: 65496 tgataccagttccagtaatggggatagtagccaaatgcaccatgaacac 65448
>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24 Length = 77999 Score = 81.8 bits (41), Expect = 2e-12 Identities = 128/157 (81%) Strand = Plus / Plus Query: 256 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 315 |||| ||||||||||| ||||||||||| || ||||||||||| ||||| | ||||||| Sbjct: 19104 ggtcgtcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccgggt 19163 Query: 316 tgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaagccga 375 |||| ||||| |||||||| || || ||||| | || |||||||| || || ||||| | Sbjct: 19164 tgataccggttccggtgatgggaatggtggctaaatgaaccatgaagacggcaaagccaa 19223 Query: 376 ttggcaaaggagccagcactgggacgtgggagtcacg 412 | || | ||||||| ||||| ||||| |||||||| Sbjct: 19224 tgggaagtggagccaaaactggcacgtgagagtcacg 19260
>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds Length = 1064 Score = 81.8 bits (41), Expect = 2e-12 Identities = 122/149 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||| ||||||||| | |||||||| |||| |||| |||| Sbjct: 833 gctccaatgaatggtccaacccagaagatccagtgatcatcccatgcctggtcgtggttg 774 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 |||| | |||||||| | ||||| || |||||||||||||| || ||||| ||||| Sbjct: 773 aagatgatagcagctccaaggctccgggcggggttgatgccggttccagtgatagggatg 714 Query: 342 gtggccaggtgcaccatgaacaccgcgaa 370 ||||||| || |||| |||||||||||| Sbjct: 713 gtggccaaatgaaccaagaacaccgcgaa 685
>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence Length = 1260 Score = 79.8 bits (40), Expect = 7e-12 Identities = 115/140 (82%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 |||||||| |||||||| ||||| || |||||| | || ||||| ||||| || |||| Sbjct: 872 gctccgataaatggcccgacccagaaaatccagtgttcgtcccacgccttatcaccgttg 813 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 | ||||| || || ||||| ||||| ||||||||||| ||||| |||||||| || ||| Sbjct: 812 aaaatcacagctgccccgaaactcctcgccgggttgattccggtaccggtgatcggaata 753 Query: 342 gtggccaggtgcaccatgaa 361 ||||| ||||| |||||||| Sbjct: 752 gtggcaaggtgaaccatgaa 733
>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein 2;4, complete cds Length = 1263 Score = 79.8 bits (40), Expect = 7e-12 Identities = 151/188 (80%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 ||||| || |||||||||||||||||| |||||||||| |||| |||||||| || Sbjct: 807 atgaaaggtcccacccaaaagatccagtggtcatcccatgcctcaaaattgttgtacatg 748 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 || ||||| || |||||||| ||||||||||| || ||||| ||||| || || |||| Sbjct: 747 actgcagccccaaagctcctggccgggttgataccagtgccagtgatgggaatggtggtt 688 Query: 348 aggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggag 407 ||||| |||||||| || || || || || || | |||||||| || |||||||| ||| Sbjct: 687 aggtgaaccatgaaaacggcaaatccaataggaagaggagccaatacggggacgtgagag 628 Query: 408 tcacgggc 415 || ||||| Sbjct: 627 tctcgggc 620
>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH) mRNA, complete cds Length = 1347 Score = 79.8 bits (40), Expect = 7e-12 Identities = 127/156 (81%) Strand = Plus / Minus Query: 209 ggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggc 268 |||||| ||||| || || ||||| || || ||||| || ||||| | ||||||||||| Sbjct: 873 ggcggcgatggcagccccaatgaacggtccgacccagaaaatccactgatcatcccaggc 814 Query: 269 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 328 ||| | ||||||||||||||| ||||| || | || | || |||||||| || ||||| Sbjct: 813 cttgttgttgttgtagatcacagcagcaccaagactacgagcagggttgatacctgtgcc 754 Query: 329 ggtgattgggatagtggccaggtgcaccatgaacac 364 ||| |||||||| ||||||| ||| ||||||||||| Sbjct: 753 ggtaattgggatggtggccaagtgaaccatgaacac 718
>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12 Length = 144628 Score = 79.8 bits (40), Expect = 7e-12 Identities = 88/104 (84%) Strand = Plus / Plus Query: 276 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgatt 335 ||||||||||| |||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 44808 ttgttgtagattacggcagctccgaaactccttgccgggttaattccggttccggtaatg 44867 Query: 336 gggatagtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || || || |||| || ||||||||||| || || |||||||| Sbjct: 44868 ggaatggtagccaaatgtaccatgaacacggcaaatccgattgg 44911
>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein 2-1, complete cds Length = 1311 Score = 79.8 bits (40), Expect = 7e-12 Identities = 124/152 (81%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 |||||||| ||||| ||||| || || | ||| |||||||| |||||||||| || || Sbjct: 841 gcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaagctttg 782 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || ||||| ||||| || |||||||| || ||||| || ||||||||||| || || ||| Sbjct: 781 tccttgttatagatgacagcagctcctaaactcctagcagggttgatgccagttccagtg 722 Query: 333 attgggatagtggccaggtgcaccatgaacac 364 || || |||||||||| ||| || |||||||| Sbjct: 721 atgggaatagtggccaagtgaacaatgaacac 690
>ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1319 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| ||||| ||||| || | ||| || |||||| Sbjct: 865 gggttgatgccggtgccggtgatggggatggtggcgaggtggacgaggaagacggcgaag 806 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 ||||| || | || ||||| | |||||||||||||| | |||| ||||||||| Sbjct: 805 ccgatggggagcggcgccaggatggggacgtgggagtccctggcgttgcgcttgg 751
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence Length = 698 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || || ||||| ||||||||| ||||| ||||||| | | | |||||| Sbjct: 369 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 310 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || ||||| || || | ||||| || ||||||||||||||||||||||| ||||| ||| Sbjct: 309 attacggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggatggtg 250 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattgg 379 |||||||| || | |||||| || || |||||||| Sbjct: 249 gccaggtggacgaggaacacggcaaacccgattgg 215
>gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partial cds Length = 859 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 ||||| || |||||||| |||||||| |||||||||||||| || ||||| || || ||| Sbjct: 422 atcactgcggctccgaaactccttgcagggttgatgccggtcccagtgatgggaatggtg 363 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||| |||||||||||| || || || || || ||||| ||||||| || || || ||| Sbjct: 362 gccaagtgcaccatgaaaacagcaaacccaataggcaatggagccaaaacaggaacatgg 303 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| | || ||||||||||| Sbjct: 302 gagtccctagcactgcgcttggg 280
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete cds Length = 1086 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || || ||||| ||||||||| ||||| ||||||| | | | |||||| Sbjct: 800 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 741 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || ||||| || || | ||||| || ||||||||||||||||||||||| ||||| ||| Sbjct: 740 attacggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggatggtg 681 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattgg 379 |||||||| || | |||||| || || |||||||| Sbjct: 680 gccaggtggacgaggaacacggcaaacccgattgg 646
>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 Length = 1204 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||||||||||||| |||| ||||| |||| || ||||| Sbjct: 872 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttg 813 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || ||||||||||| || |||||||| || || Sbjct: 812 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgatgggaatg 753 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgat 376 ||||||| || |||| ||| |||||||| ||||| Sbjct: 752 gtggccaaatgaaccaagaaaaccgcgaatccgat 718
>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip2.4 gene) Length = 1135 Score = 77.8 bits (39), Expect = 3e-11 Identities = 123/151 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| ||||||||| ||| ||||||||||| || | ||||||||| || || ||||| Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| || ||||||||||| || || ||||| ||||| ||||||| ||| |||||| Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaaccatg 652 Query: 360 aacaccgcgaagccgattggcaaaggagcca 390 ||||| || || || ||||| | |||||||| Sbjct: 651 aacacagcaaatccaattggaagaggagcca 621
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene) Length = 1364 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| || ||||||||||| | ||| || |||||| Sbjct: 794 gggttgatgccggtgccggtgatggggatggtcgccaggtgcacgaggaagacggcgaag 735 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || || || | || || || | || ||||||||||| |||||||||||||||| Sbjct: 734 cctatggggagcggcgcgaggatgggcacgtgggagtcgcgggcgctgcgcttgg 680
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete cds Length = 1338 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| || ||||||||||| | ||| || |||||| Sbjct: 785 gggttgatgccggtgccggtgatggggatggtcgccaggtgcacgaggaagacggcgaag 726 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || || || | || || || | || ||||||||||| |||||||||||||||| Sbjct: 725 cctatggggagcggcgcgaggatgggcacgtgggagtcgcgggcgctgcgcttgg 671
>dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane intrinsic protein 1;1, complete cds Length = 1096 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 |||||||| ||||| |||||||||||||| || |||| ||| |||| ||||| ||||| Sbjct: 792 gggttgataccggttccggtgattgggatggtagccaagtgaaccaaaaacacagcgaac 733 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || || ||||| || |||| | ||||||||||||||||||||||| ||||||| Sbjct: 732 ccaataggcaatggtgccaaaatggggacgtgggagtcacgggcgctacgcttgg 678
>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1136_C04 Length = 103194 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| ||||| ||||| || | ||| || |||||| Sbjct: 29575 gggttgatgccggtgccggtgatggggatggtggcgaggtggacgaggaagacggcgaag 29516 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 ||||| || | || ||||| | |||||||||||||| | |||| ||||||||| Sbjct: 29515 ccgatggggagcggcgccaggatggggacgtgggagtccctggcgttgcgcttgg 29461
>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full insert sequence Length = 1318 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| ||||| ||||| || | ||| || |||||| Sbjct: 864 gggttgatgccggtgccggtgatggggatggtggcgaggtggacgaggaagacggcgaag 805 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 ||||| || | || ||||| | |||||||||||||| | |||| ||||||||| Sbjct: 804 ccgatggggagcggcgccaggatggggacgtgggagtccctggcgttgcgcttgg 750
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence Length = 791 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 ||||||||||||||||||||||| ||||| || ||||||||||| | ||| || |||||| Sbjct: 218 gggttgatgccggtgccggtgatggggatggtcgccaggtgcacgaggaagacggcgaag 159 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || || || | || || || | || ||||||||||| |||||||||||||||| Sbjct: 158 cctatggggagcggcgcgaggatgggcacgtgggagtcgcgggcgctgcgcttgg 104
>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds Length = 1298 Score = 77.8 bits (39), Expect = 3e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 |||||||||||||| |||||||| ||||| ||||||| ||| |||| ||||| ||||| Sbjct: 774 gggttgatgccggttccggtgatggggatggtggccaagtgaaccaaaaacacagcgaac 715 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || || ||||| || |||| | ||||||||||||||||| ||||| ||||||| Sbjct: 714 ccaataggcaacggcgccaaaatggggacgtgggagtcacgagcgctacgcttgg 660
>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds Length = 1158 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||||||||||||| |||| ||||| |||| || ||||| Sbjct: 872 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttg 813 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || ||||||||||| || |||||||| || || Sbjct: 812 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgatgggaatg 753 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgat 376 ||||||| || |||| ||| |||||||| ||||| Sbjct: 752 gtggccaaatgaaccaagaaaaccgcgaatccgat 718
>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010 (PIP2;6/PIP2E) mRNA, complete cds Length = 1245 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 851 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 792 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| || ||||| || ||||| | Sbjct: 791 gcagctccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaa 732 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 731 tgaaccatgaacac 718
>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA, complete cds Length = 1254 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 980 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 921 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 920 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 861 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 860 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 823
>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400 (PIP1;5/PIP1D) mRNA, complete cds Length = 1128 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 783 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 724 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 723 aagtgcacca 714
>ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channel AT2G16850 (PIP2;8/PIP3B) mRNA, complete cds Length = 1160 Score = 75.8 bits (38), Expect = 1e-10 Identities = 149/186 (80%) Strand = Plus / Minus Query: 230 gaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcac 289 |||||| || |||||||||||||| |||| ||||| || ||||| ||||||||||| || Sbjct: 807 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 748 Query: 290 ggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccag 349 ||||| || ||||| || || || || || || || || || || |||||||| |||| Sbjct: 747 agcagcaccaaagcttctggctggattaatcccagttccagttatggggatagtagccaa 688 Query: 350 gtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtc 409 |||||||||||||| || || || || || || ||||||| || |||||||| ||||| Sbjct: 687 atgcaccatgaacacagcaaaccctataggtaacggagccaaaaccgggacgtgagagtc 628 Query: 410 acgggc 415 |||||| Sbjct: 627 acgggc 622
>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c Length = 986 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||| || |||||| |||| ||||| || | || |||||| Sbjct: 829 gctccaatgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttg 770 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||||| || |||||||| || || |||||||||||||| Sbjct: 769 tagatgattgcagctccaagactcctagctgggttgattcctgttccggtgattgggatg 710 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 | |||| ||| |||| |||||||||||| |||||||| Sbjct: 709 ctcgccaagtgaaccaagaacaccgcgaatccgattgg 672
>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) Length = 995 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 884 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 825 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 824 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 765 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 764 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 727
>gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic protein (mip1) mRNA, partial cds Length = 495 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 251 ccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgc 310 |||| ||||||||||||| || ||||||||| | ||||| |||| || ||||||||||| Sbjct: 495 ccagtggtcatcccaggctttttcgttgttgaaaatcacagcaggaccaaagctccttgc 436 Query: 311 cgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaa 370 |||||||| || || || ||||| ||||| || ||| |||||| |||||||| || || Sbjct: 435 tgggttgattccagtaccagtgatggggattgtahccaagtgcacaatgaacacagcaaa 376 Query: 371 gccgattggcaaaggagccagcactgggacgtgggagtcacg 412 || || |||| ||||||| || || |||||||||||||| Sbjct: 375 cccaataggcagtggagccaaaacaggcacgtgggagtcacg 334
>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds Length = 861 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 797 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 738 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 737 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 678 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 677 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 640
>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA, complete cds Length = 956 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 794 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 735 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 734 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 675 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 674 aagtgcacca 665
>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400; F16G20.100) mRNA, complete cds Length = 1125 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 783 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 724 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 723 aagtgcacca 714
>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds Length = 1092 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 864 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 805 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 804 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 745 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 744 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 707
>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1201 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 846 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 787 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| || ||||| || ||||| | Sbjct: 786 gcagctccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaa 727 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 726 tgaaccatgaacac 713
>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 870 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 764 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 705 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| || ||||| || ||||| | Sbjct: 704 gcagctccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaa 645 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 644 tgaaccatgaacac 631
>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds Length = 1169 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 848 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 789 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| || ||||| || ||||| | Sbjct: 788 gcagctccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaa 729 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 728 tgaaccatgaacac 715
>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1160 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || ||||| |||||||| | |||||||| ||||| | ||||||||||| ||| Sbjct: 835 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 776 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| || ||||| |||||||| || |||||||| || ||||| || ||||| | Sbjct: 775 gcagctccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaa 716 Query: 351 tgcaccatgaacac 364 || ||||||||||| Sbjct: 715 tgaaccatgaacac 702
>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS55ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1059 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 843 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 784 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 783 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 724 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 723 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 686
>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 454 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 167 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 108 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 107 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 48 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 47 aagtgcacca 38
>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB51ZF11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 710 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 426 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 367 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 366 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 307 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 306 aagtgcacca 297
>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS16ZB08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1066 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 772 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 713 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 712 aagtgcacca 703
>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS21ZB06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1078 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 807 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 748 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 747 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 688 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 687 aagtgcacca 678
>gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds Length = 837 Score = 75.8 bits (38), Expect = 1e-10 Identities = 149/186 (80%) Strand = Plus / Minus Query: 230 gaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcac 289 |||||| || |||||||||||||| |||| ||||| || ||||| ||||||||||| || Sbjct: 741 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 682 Query: 290 ggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccag 349 ||||| || ||||| || || || || || || || || || || |||||||| |||| Sbjct: 681 agcagcaccaaagcttctggctggattaatcccagttccagttatggggatagtagccaa 622 Query: 350 gtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtc 409 |||||||||||||| || || || || || || ||||||| || |||||||| ||||| Sbjct: 621 atgcaccatgaacacagcaaaccctataggtaacggagccaaaaccgggacgtgagagtc 562 Query: 410 acgggc 415 |||||| Sbjct: 561 acgggc 556
>gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete sequence Length = 1152 Score = 75.8 bits (38), Expect = 1e-10 Identities = 149/186 (80%) Strand = Plus / Minus Query: 230 gaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcac 289 |||||| || |||||||||||||| |||| ||||| || ||||| ||||||||||| || Sbjct: 803 gaatggtccaacccaaaagatccaatggtcgtcccaagctttctcattgttgtagataac 744 Query: 290 ggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccag 349 ||||| || ||||| || || || || || || || || || || |||||||| |||| Sbjct: 743 agcagcaccaaagcttctagctggattaatcccagttccagttatggggatagtagccaa 684 Query: 350 gtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtc 409 |||||||||||||| || || || || || || ||||||| || |||||||| ||||| Sbjct: 683 atgcaccatgaacacagcaaatcctataggtaacggagccaaaaccgggacgtgagagtc 624 Query: 410 acgggc 415 |||||| Sbjct: 623 acgggc 618
>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence Length = 1234 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 980 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 921 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 920 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 861 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 860 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 823
>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence Length = 1089 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 228 atgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatc 287 |||||||| || ||||| |||||||| |||||||||| || | || ||||||||||| Sbjct: 841 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 782 Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 | ||||||||||| ||||| |||||||| ||||| || || || |||||||| || ||| Sbjct: 781 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 722 Query: 348 aggtgcacca 357 | |||||||| Sbjct: 721 aagtgcacca 712
>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds Length = 920 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| ||||| || || |||||||| | |||| |||||||||||| | || |||||| Sbjct: 843 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 784 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 ||||| | |||||||| | ||| || || ||||||||||| ||||| ||||||||||| Sbjct: 783 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatg 724 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 || |||| ||| |||| ||| ||||| || |||||||| Sbjct: 723 gttgccaagtgaaccaagaaaaccgcaaacccgattgg 686
>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA, complete cds Length = 1172 Score = 75.8 bits (38), Expect = 1e-10 Identities = 129/158 (81%), Gaps = 1/158 (0%) Strand = Plus / Minus Query: 223 ctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgt 282 |||| |||||||| || ||||| ||||||||| |||||| ||| |||| || ||||||| Sbjct: 832 ctccaatgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgt 773 Query: 283 agatcacggcagctccgaagctccttgccggg-ttgatgccggtgccggtgattgggata 341 |||| | |||||||| | ||||| || ||| ||||| || || |||||||||||||| Sbjct: 772 agatgatagcagctccaagactcctggcaggggttgataccagttccggtgattgggatg 713 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattgg 379 ||||||| || |||| |||||||||||| || ||||| Sbjct: 712 gtggccaaatgaaccaagaacaccgcgaatccaattgg 675
>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like protein mRNA, partial cds Length = 474 Score = 73.8 bits (37), Expect = 4e-10 Identities = 115/141 (81%) Strand = Plus / Minus Query: 208 cggcggcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccagg 267 ||||||||| || ||||| ||||| || |||||||||||||||||| |||||||||||| Sbjct: 472 cggcggcaagagcagctccaatgaaaggtcccacccaaaagatccagtggtcatcccagg 413 Query: 268 ccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgc 327 | | || ||||| || | ||| ||||| | |||||| || ||||||||||| |||| Sbjct: 412 catggtctcgattgtaaataatggctgctccaaggctcctggcagggttgatgccagtgc 353 Query: 328 cggtgattgggatagtggcca 348 ||||||| || || ||||||| Sbjct: 352 cggtgataggtatggtggcca 332
>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA, partial cds Length = 495 Score = 73.8 bits (37), Expect = 4e-10 Identities = 85/101 (84%) Strand = Plus / Minus Query: 261 tcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatg 320 |||||||| || || |||||||||||||| |||||||| || || || || |||||||| Sbjct: 485 tcccaggctttgtccttgttgtagatcacagcagctccaaaacttctagcagggttgata 426 Query: 321 ccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 || || || ||||||||||| ||||||||||| || ||||| Sbjct: 425 ccagttccagtgattgggatggtggccaggtgaacaatgaa 385
>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete cds Length = 1279 Score = 73.8 bits (37), Expect = 4e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 |||||||||||||| |||| | ||| || || || | |||| |||| ||||||||||| Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | |||||||| |||||||||||||||||||| || || || ||||| | ||| |||||| Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggctaagtgaaccatg 678 Query: 360 aacac 364 ||||| Sbjct: 677 aacac 673
>gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein (PIP2;1) mRNA, complete cds Length = 1168 Score = 73.8 bits (37), Expect = 4e-10 Identities = 148/185 (80%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 ||||| || |||||||||||||| ||||||||||| | || || |||||||| || || Sbjct: 797 aatggtccaacccaaaagatccaatggtcatcccagactttgtcattgttgtaaatgaca 738 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 |||||||| |||||||| || ||||| || || || || || || || ||||| |||| Sbjct: 737 gcagctccaaagctcctagcagggttaataccagttccagtaataggaatagtagccaaa 678 Query: 351 tgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtca 410 || |||||||| || || || || ||||| | ||| |||| ||| ||||| ||||||||| Sbjct: 677 tgaaccatgaatacagcaaatccaattggaagaggggccaacacagggacatgggagtca 618 Query: 411 cgggc 415 ||||| Sbjct: 617 cgggc 613
>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds Length = 534 Score = 73.8 bits (37), Expect = 4e-10 Identities = 148/185 (80%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || |||||||| || ||||| | ||||||||||| | || ||||||||| Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || | || || || | |||||| || |||||||| ||||| || ||||||||||| ||| Sbjct: 413 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 354 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||| ||||| | |||||| ||||| || || ||||| || |||| | |||||||||| Sbjct: 353 gccaaatgcactaagaacactgcgaatccaataggcaatggtgccaatattgggacgtgg 294 Query: 405 gagtc 409 ||||| Sbjct: 293 gagtc 289
>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds Length = 867 Score = 73.8 bits (37), Expect = 4e-10 Identities = 148/185 (80%) Strand = Plus / Minus Query: 225 ccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtag 284 |||||||| || |||||||| || ||||| | ||||||||||| | || ||||||||| Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744 Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 || | || || || | |||||| || |||||||| ||||| || ||||||||||| ||| Sbjct: 743 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 684 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||| ||||| | |||||| ||||| || || ||||| || |||| | |||||||||| Sbjct: 683 gccaaatgcactaagaacactgcgaatccaataggcaatggtgccaatattgggacgtgg 624 Query: 405 gagtc 409 ||||| Sbjct: 623 gagtc 619
>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein 2;5, complete cds Length = 1126 Score = 73.8 bits (37), Expect = 4e-10 Identities = 157/197 (79%) Strand = Plus / Minus Query: 231 aatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacg 290 |||||||||||||| |||||||| |||||||||| ||||| | |||||||| || || Sbjct: 795 aatggccccacccagaagatccaatggtcatcccaagccttgccattgttgtaaataaca 736 Query: 291 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggccagg 350 || || || || ||||| |||||||| || || || || ||||| || || || |||| | Sbjct: 735 gccgcaccaaaactcctagccgggttaatcccagttccagtgatgggaatggtagccaag 676 Query: 351 tgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgggagtca 410 || |||||||| || || || || || ||||| ||||||| || || ||||| |||||| Sbjct: 675 tgaaccatgaaaacagcaaatccaataggcaatggagccaaaacgggaacgtgagagtca 616 Query: 411 cgggcgctgcgcttggg 427 || ||||| |||||||| Sbjct: 615 cgtgcgctacgcttggg 599
>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds Length = 539 Score = 73.8 bits (37), Expect = 4e-10 Identities = 88/105 (83%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | |||||| || | |||||| || ||||||||||| ||||| || || | Sbjct: 236 tgttgtagatgatggcagcgccaaggctcctagctgggttgatgccagtgccagtaatgg 177 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||| ||||| ||||| |||| |||||||||||| || ||||||| Sbjct: 176 ggatggtggcaaggtggaccaggaacaccgcgaacccaattggca 132
>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds Length = 1280 Score = 73.8 bits (37), Expect = 4e-10 Identities = 88/105 (83%) Strand = Plus / Minus Query: 277 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 336 |||||||||| | |||||| || | |||||| || ||||||||||| ||||| || || | Sbjct: 811 tgttgtagatgatggcagcgccaaggctcctagctgggttgatgccagtgccagtaatgg 752 Query: 337 ggatagtggccaggtgcaccatgaacaccgcgaagccgattggca 381 |||| ||||| ||||| |||| |||||||||||| || ||||||| Sbjct: 751 ggatggtggcaaggtggaccaggaacaccgcgaacccaattggca 707
>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds Length = 1070 Score = 71.9 bits (36), Expect = 2e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 258 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 317 |||||||| || || || ||||||||||| ||||| ||||||||||| || || ||||| Sbjct: 728 tcatcccaagctttgtctttgttgtagattacggcggctccgaagcttctggcggggtta 669 Query: 318 atgccggtgccggtgattgggatagtggccaggtgcaccatgaa 361 || |||||||||||||| || || ||||| | ||| |||||||| Sbjct: 668 attccggtgccggtgatcggaatggtggctaagtgaaccatgaa 625
>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds Length = 1217 Score = 71.9 bits (36), Expect = 2e-09 Identities = 129/160 (80%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||||||||| || || ||||| || |||||| | |||||||| || | | |||||| Sbjct: 823 gctccgatgaagggtccaacccagaaaatccagtgatcatcccaagcgtggcccttgttg 764 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 |||| | ||||| |||| |||||||| |||||||||||||| || ||||||||||| Sbjct: 763 aagatgatagcagcaccgagactccttgctgggttgatgccggttccagtgattgggatg 704 Query: 342 gtggccaggtgcaccatgaacaccgcgaagccgattggca 381 || |||| ||| |||| |||||| ||||| || ||||||| Sbjct: 703 gttgccaagtgaaccaagaacactgcgaacccaattggca 664
>gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic protein (PIP) mRNA, complete cds Length = 1254 Score = 69.9 bits (35), Expect = 6e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 312 gggttgatgccggtgccggtgattgggatagtggccaggtgcaccatgaacaccgcgaag 371 |||||||| || || |||||||||||||| ||||||| | |||||| |||||| ||||| Sbjct: 803 gggttgataccagttccggtgattgggatggtggccaagcgcaccaagaacacagcgaac 744 Query: 372 ccgattggcaaaggagccagcactgggacgtgggagtcacgggcgctgcgcttgg 426 || |||||||| || |||| | |||||||| ||||| | |||||| ||||||| Sbjct: 743 ccaattggcaacggtgccaaaatagggacgtgagagtctctggcgctacgcttgg 689
>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence Length = 1159 Score = 69.9 bits (35), Expect = 6e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| ||||||||| |||||| ||| || | ||||| ||||||||| | |||||||| Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| || ||||||||||| || |||||||| ||||| ||||||| || |||| | Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 735 Query: 360 aacaccgcgaa 370 ||||| ||||| Sbjct: 734 aacactgcgaa 724
>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds Length = 1278 Score = 69.9 bits (35), Expect = 6e-09 Identities = 134/167 (80%) Strand = Plus / Minus Query: 213 gcaatggcggctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttc 272 ||||| || ||||| |||||||| || ||||| || ||||| |||||| ||| ||||| Sbjct: 865 gcaatagcagctccaatgaatggtccaacccagaaaatccattggtcattccatgccttg 806 Query: 273 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 332 || ||| |||||| || |||||||||||||| | ||||| ||||| || || |||||| Sbjct: 805 tccttgccgtagatgacagcagctccgaagcttcgagccggattgataccagttccggtg 746 Query: 333 attgggatagtggccaggtgcaccatgaacaccgcgaagccgattgg 379 ||||| || || ||||| || ||||| ||||| || || |||||||| Sbjct: 745 attggaatggtagccagatgaaccataaacacagcaaacccgattgg 699
>emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein Length = 1406 Score = 69.9 bits (35), Expect = 6e-09 Identities = 116/143 (81%) Strand = Plus / Minus Query: 285 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtg 344 ||||| || ||||| ||||||||||| || ||||||||||| || ||||| || || ||| Sbjct: 837 atcactgctgctccaaagctccttgcaggattgatgccggttccagtgataggaatggtg 778 Query: 345 gccaggtgcaccatgaacaccgcgaagccgattggcaaaggagccagcactgggacgtgg 404 |||| |||||||||||| || || || || |||||||| || |||| || || || ||| Sbjct: 777 gccaagtgcaccatgaaaacagcaaatccaattggcaatggggccaagacaggaacatgg 718 Query: 405 gagtcacgggcgctgcgcttggg 427 ||||| | || ||||||||||| Sbjct: 717 gagtccctagcactgcgcttggg 695
>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone pNY507 Length = 1107 Score = 69.9 bits (35), Expect = 6e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| ||||||||| |||||| ||| || | ||||| ||||||||| | |||||||| Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| || ||||||||||| || |||||||| ||||| ||||||| || |||| | Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 675 Query: 360 aacaccgcgaa 370 ||||| ||||| Sbjct: 674 aacactgcgaa 664
>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone pTOM75 Length = 859 Score = 69.9 bits (35), Expect = 6e-09 Identities = 107/131 (81%) Strand = Plus / Minus Query: 240 acccaaaagatccaggggtcatcccaggccttctcgttgttgtagatcacggcagctccg 299 ||||| ||||||||| |||||| ||| || | ||||| ||||||||| | |||||||| Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546 Query: 300 aagctccttgccgggttgatgccggtgccggtgattgggatagtggccaggtgcaccatg 359 | ||||| || ||||||||||| || |||||||| ||||| ||||||| || |||| | Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 486 Query: 360 aacaccgcgaa 370 ||||| ||||| Sbjct: 485 aacactgcgaa 475
>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete sequence Length = 96827 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 258 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 317 |||||||| ||||| | ||||||||||| ||||||||||| || ||||| |||||||| Sbjct: 65642 tcatcccaagccttttgattgttgtagatgacggcagctccaaaactcctagccgggttt 65583 Query: 318 atgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 || |||||||| || ||||| || ||||| | || ||||||||||| Sbjct: 65582 attccggtgccagtaattggaattgtggctaaatgaaccatgaacac 65536
>gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, complete cds Length = 973 Score = 69.9 bits (35), Expect = 6e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 258 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 317 ||||||||||| |||||||| ||| |||| ||||| | |||||| ||||| || ||||| Sbjct: 766 tcatcccaggctttctcgttattgaagataacggctggtccgaaactcctagcggggtta 707 Query: 318 atgccggtgccggtgattgggatagtggccaggtgcaccatgaacac 364 ||||| || ||||| | |||||||| |||| ||| ||||||||||| Sbjct: 706 atgcccgtaccggtaacggggatagtagccaagtgaaccatgaacac 660
>gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds Length = 1101 Score = 69.9 bits (35), Expect = 6e-09 Identities = 116/143 (81%) Strand = Plus / Minus Query: 222 gctccgatgaatggccccacccaaaagatccaggggtcatcccaggccttctcgttgttg 281 ||||| |||||||| || ||||| || ||||| |||||||||| |||| | | ||||| Sbjct: 812 gctccaatgaatggtccgacccagaatatccattggtcatcccaaaccttgttgctgttg 753 Query: 282 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggata 341 |||| || ||||| || ||||| || || |||||||| || ||||| ||||| || ||| Sbjct: 752 aagataacagcagcgccaaagcttctagcagggttgataccagtgccagtgatgggaata 693 Query: 342 gtggccaggtgcaccatgaacac 364 ||||||| ||| ||||||||||| Sbjct: 692 gtggccaagtgaaccatgaacac 670
>gb|U60147.1|BVU60147 Beta vulgaris plasma membrane major intrinsic protein 1 mRNA, complete cds Length = 1210 Score = 69.9 bits (35), Expect = 6e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 288 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattgggatagtggcc 347 ||||||||||| || ||||| || ||||||||||| || || ||||||||||| || ||| Sbjct: 749 acggcagctccaaaactcctagcagggttgatgccagttccagtgattgggatggtagcc 690 Query: 348 aggtgcaccatgaacaccgcgaa 370 | ||| |||||||| |||||||| Sbjct: 689 aagtgaaccatgaataccgcgaa 667 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,420,060 Number of Sequences: 3902068 Number of extensions: 3420060 Number of successful extensions: 75016 Number of sequences better than 10.0: 400 Number of HSP's better than 10.0 without gapping: 398 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 74078 Number of HSP's gapped (non-prelim): 900 length of query: 427 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 405 effective length of database: 17,147,199,772 effective search space: 6944615907660 effective search space used: 6944615907660 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
