ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart33b05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II g... 68 3e-08
2dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhi... 62 2e-06
3emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chr... 50 0.006
4ref|NM_193094.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.024
5emb|AJ422119.1|TAE422119 Triticum aestivum mRNA for xylanase inh... 48 0.024
6dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
7dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
8dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
9gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (L... 46 0.093
10gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosom... 44 0.37
11emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA 44 0.37
12ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 ... 42 1.5
13gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 42 1.5
14gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, comp... 42 1.5
15gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, c... 42 1.5
16gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome... 42 1.5
17gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosom... 42 1.5
18gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, co... 42 1.5
19gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 42 1.5
20gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, comp... 42 1.5
21gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, com... 42 1.5
22gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 42 1.5
23gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, com... 42 1.5
24gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, comp... 42 1.5
25gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Can... 42 1.5
26gb|AC168276.3| Mus musculus BAC RP24-485I12 (Roswell Park Cance... 42 1.5
27gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 42 1.5
28gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, c... 42 1.5
29gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, c... 42 1.5
30gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome 42 1.5
31gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosom... 42 1.5
32gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosom... 42 1.5
33gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosom... 42 1.5
34gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, c... 42 1.5
35gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complet... 42 1.5
36gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, com... 42 1.5
37gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, comp... 42 1.5
38gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome... 42 1.5
39gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, com... 42 1.5
40gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, comp... 42 1.5
41gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 42 1.5
42gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 42 1.5
43emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 i... 42 1.5
44gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 ... 42 1.5
45gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosom... 42 1.5
46gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosom... 42 1.5
47gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 42 1.5
48gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome... 42 1.5
49gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... 42 1.5
50gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete... 42 1.5
51gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, compl... 42 1.5
52gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, comp... 42 1.5
53gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete seq... 42 1.5
54gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete se... 42 1.5
55gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosom... 42 1.5
56emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on ch... 42 1.5
57gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, comp... 42 1.5
58gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome... 42 1.5
59emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenici... 42 1.5
60emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mito... 42 1.5
61gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 42 1.5
62gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, co... 42 1.5
63gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, com... 42 1.5
64gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete se... 42 1.5
65emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in ... 42 1.5
66gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswel... 42 1.5
67gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytans... 42 1.5
68gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell ... 42 1.5
69gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, com... 42 1.5
70gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, comple... 42 1.5
71gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Ho... 42 1.5
72gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56... 42 1.5
73gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, co... 42 1.5
74gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, com... 42 1.5
75gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 1.5
76dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
77gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence 42 1.5
78gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-... 42 1.5
79gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, co... 42 1.5
80gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana... 42 1.5
81gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-... 42 1.5
82gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, com... 42 1.5
83gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, comple... 42 1.5
84emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on ch... 42 1.5
85gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Can... 42 1.5
86gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57... 42 1.5
87emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-8... 42 1.5
88gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 ... 42 1.5
89emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-4... 42 1.5
90gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 42 1.5
91dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.5
92dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.5
93gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, comp... 42 1.5
94gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, com... 42 1.5
95gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, co... 42 1.5
96gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome... 42 1.5
97gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
98emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chro... 42 1.5
99gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s... 42 1.5
100emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003... 42 1.5
101emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chro... 42 1.5
102gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complet... 42 1.5
103gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, compl... 42 1.5
104gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, compl... 42 1.5
105emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chr... 42 1.5
106emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chr... 42 1.5
107gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, com... 42 1.5
108emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on ch... 42 1.5
109emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chrom... 42 1.5
110gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, co... 42 1.5
111gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome ... 42 1.5
112emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 12... 42 1.5
113gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, com... 40 5.7
114gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, com... 40 5.7
115gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, comp... 40 5.7
116gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 40 5.7
117gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, comp... 40 5.7
118gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, com... 40 5.7
119gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, com... 40 5.7
120gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellit... 40 5.7
121gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome 40 5.7
122gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, co... 40 5.7
123gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's H... 40 5.7
124gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome 40 5.7
125gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome... 40 5.7
126gb|AE006511.1| Streptococcus pyogenes M1 GAS, section 40 of 167 ... 40 5.7
127gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 5.7
128gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-... 40 5.7
129gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome... 40 5.7
130gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome 40 5.7
131gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome 40 5.7
132gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome 40 5.7
133gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome 40 5.7
134gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, com... 40 5.7
135gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, comp... 40 5.7
136gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, com... 40 5.7
137gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome... 40 5.7
138gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome... 40 5.7
139gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, com... 40 5.7
140gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, co... 40 5.7
141gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, co... 40 5.7
142gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, com... 40 5.7
143emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chro... 40 5.7
144emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 ... 40 5.7
145emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi... 40 5.7
146gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosom... 40 5.7
147gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosom... 40 5.7
148emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in... 40 5.7
149gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome... 40 5.7
150gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome... 40 5.7
151gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 40 5.7
152gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, compl... 40 5.7
153emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, com... 40 5.7
154emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chr... 40 5.7
155gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, co... 40 5.7
156gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complet... 40 5.7
157gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, c... 40 5.7
158gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, com... 40 5.7
159gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 40 5.7
160gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, comp... 40 5.7
161emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in... 40 5.7
162emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 o... 40 5.7
163emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chr... 40 5.7
164emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on c... 40 5.7
165emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on ch... 40 5.7
166emb|AL445984.6| Human DNA sequence from clone RP11-360A9 on chro... 40 5.7
167emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on ch... 40 5.7
168gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, com... 40 5.7
169gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, com... 40 5.7
170gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's ... 40 5.7
171gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell... 40 5.7
172emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 5.7
173gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:10627... 40 5.7
174gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:348... 40 5.7
175gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:366... 40 5.7
176gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:515... 40 5.7
177gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:402... 40 5.7
178gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, com... 40 5.7
179emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 i... 40 5.7
180emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chr... 40 5.7
181gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Ca... 40 5.7
182emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313... 40 5.7
183emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on c... 40 5.7
184emb|CR450726.6| Zebrafish DNA sequence from clone CH211-149F21 i... 40 5.7
185emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on ch... 40 5.7
186emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in ... 40 5.7
187gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, co... 40 5.7
188emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chr... 40 5.7
189emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chr... 40 5.7
190gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Can... 40 5.7
191emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on ch... 40 5.7
192emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86... 40 5.7
193gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell ... 40 5.7
194gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence 40 5.7
195gb|AE009996.1| Streptococcus pyogenes strain MGAS8232, section 4... 40 5.7
196gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, comp... 40 5.7
197gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, co... 40 5.7
198gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, compl... 40 5.7
199gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, com... 40 5.7
200gb|CP000249.1| Frankia sp. CcI3, complete genome 40 5.7
201gb|DP000052.1| Sus scrofa target 126 genomic scaffold 40 5.7
202gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O... 40 5.7
203gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N... 40 5.7
204gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome... 40 5.7
205gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosom... 40 5.7
206gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome... 40 5.7
207gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosom... 40 5.7
208gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.7
209gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.7
210dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 5.7
211dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
212gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, co... 40 5.7
213gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 40 5.7
214gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A... 40 5.7
215gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome... 40 5.7
216gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome... 40 5.7
217gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complet... 40 5.7
218gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complet... 40 5.7
219gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome 40 5.7
220gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O... 40 5.7
221gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome... 40 5.7
222dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome 40 5.7
223gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, comp... 40 5.7
224dbj|AP004732.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
225emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chr... 40 5.7
226emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on ch... 40 5.7
227emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, ... 40 5.7
228gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, compl... 40 5.7
229gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, compl... 40 5.7
230gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome... 40 5.7
231gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complet... 40 5.7
232gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, comple... 40 5.7
233gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, compl... 40 5.7
234emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e... 40 5.7
235gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, co... 40 5.7
236gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosom... 40 5.7
237emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene 40 5.7
238gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41... 40 5.7
239emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence 40 5.7
240gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, comp... 40 5.7
241emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chr... 40 5.7
242gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome... 40 5.7
243emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chro... 40 5.7
244gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, c... 40 5.7
245emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21... 40 5.7
246emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa... 40 5.7
247gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete se... 40 5.7
248gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 40 5.7
249gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complet... 40 5.7
250gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, compl... 40 5.7
251gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complet... 40 5.7
252emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 i... 40 5.7
253emb|CT025838.2| Medicago truncatula chromosome 5 clone mth2-124f... 40 5.7
254gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, com... 40 5.7
255gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome... 40 5.7
256gb|DQ221252.1| Tetraodon nigroviridis voltage-gated sodium chann... 40 5.7
257gb|AC167022.4| Mus musculus BAC clone RP23-183A4 from chromosome... 40 5.7
258emb|AL844900.3| Mouse DNA sequence from clone RP23-301L16 on chr... 40 5.7
259emb|AL626774.23| Mouse DNA sequence from clone RP23-198O15 on ch... 40 5.7
260gb|M23926.1|MUSIFN6A Mus musculus (clone pKK22) interferon-alpha... 40 5.7
261emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 40 5.7
262emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chro... 40 5.7
263emb|AL772170.14| Mouse DNA sequence from clone RP23-322G9 on chr... 40 5.7
264emb|AL806523.14| Mouse DNA sequence from clone RP23-423O7 on chr... 40 5.7
265emb|AL590963.11| Mouse DNA sequence from clone RP23-395E10 on ch... 40 5.7
266dbj|AB065476.1| Homo sapiens gene for seven transmembrane helix ... 40 5.7

>emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II gene for putative xylanase
            inhibitor protein
          Length = 2143

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 231  tcccagaccatgaccccgccatagttggccgccttctgcacc 272
            |||||||||||||||||||||||||||  |||||||||||||
Sbjct: 1886 tcccagaccatgaccccgccatagttgttcgccttctgcacc 1845



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 367  acgccgccgtccacttgtcccactgc 392
            |||||||||||||||| |||||||||
Sbjct: 1729 acgccgccgtccacttctcccactgc 1704



to top

>dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhibitor XIP-III,
           complete cds
          Length = 934

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 tcccagaccatgaccccgccatagttggccgccttctgcaccacctgtatgacgccgtag 290
           ||||||| |||||||||||| |||||| ||  ||||||||||||| |  ||| |||||||
Sbjct: 877 tcccagagcatgaccccgccgtagttgtccttcttctgcaccaccggcgtgatgccgtag 818

                      
Query: 291 tagaggttctt 301
           |||| ||||||
Sbjct: 817 tagacgttctt 807



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 366 tacgccgccgtccacttgtcccac 389
           ||||||||||||||| ||||||||
Sbjct: 742 tacgccgccgtccacctgtcccac 719



to top

>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete
            sequence
          Length = 43009

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 98   gcaagcacatgcacatgcacatgca 122
            |||||||||||||||||||||||||
Sbjct: 8647 gcaagcacatgcacatgcacatgca 8623



to top

>ref|NM_193094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 951

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 231 tcccagaccatgaccccgccatagttggccgccttctgca 270
           ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 896 tcccagatcatgaagccgccgtagttggccgccttctgca 857



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 366 tacgccgccgtccacttgtcccac 389
           ||||||||||||||| ||||||||
Sbjct: 737 tacgccgccgtccacctgtcccac 714



to top

>emb|AJ422119.1|TAE422119 Triticum aestivum mRNA for xylanase inhibitor protein I (xipI gene)
          Length = 915

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 366 tacgccgccgtccacttgtcccac 389
           ||||||||||||||||||||||||
Sbjct: 725 tacgccgccgtccacttgtcccac 702



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 85/106 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 agctgctgtaatttgtccgcttgtcctcgtaacgttcccagaccatgaccccgccatagt 255
           |||||||||| || ||| |||||||   ||| || ||||||| |||||  ||||| ||||
Sbjct: 895 agctgctgtagttggtctgcttgtcgaagtatcggtcccagagcatgatgccgccgtagt 836

                                                         
Query: 256 tggccgccttctgcaccacctgtatgacgccgtagtagaggttctt 301
           || ||  ||||||| ||||| |   |||||||||||||| ||||||
Sbjct: 835 tgtccttcttctgcgccaccggcgcgacgccgtagtagacgttctt 790



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                        
Query: 231      tcccagaccatgaccccgccatagttggccgccttctgca 270
                ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 26162457 tcccagatcatgaagccgccgtagttggccgccttctgca 26162418



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 366      tacgccgccgtccacttgtcccac 389
                ||||||||||||||| ||||||||
Sbjct: 26162298 tacgccgccgtccacctgtcccac 26162275



to top

>dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022A01, full
           insert sequence
          Length = 1165

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 231 tcccagaccatgaccccgccatagttggccgccttctgca 270
           ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 944 tcccagatcatgaagccgccgtagttggccgccttctgca 905



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 366 tacgccgccgtccacttgtcccac 389
           ||||||||||||||| ||||||||
Sbjct: 785 tacgccgccgtccacctgtcccac 762



to top

>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0519E12
          Length = 152448

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 231   tcccagaccatgaccccgccatagttggccgccttctgca 270
             ||||||| |||||  ||||| |||||||||||||||||||
Sbjct: 54315 tcccagatcatgaagccgccgtagttggccgccttctgca 54276



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 366   tacgccgccgtccacttgtcccac 389
             ||||||||||||||| ||||||||
Sbjct: 54156 tacgccgccgtccacctgtcccac 54133



to top

>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter
            region and partial cds
          Length = 5236

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 102  gcacatgcacatgcacatgcagt 124
            |||||||||||||||||||||||
Sbjct: 3181 gcacatgcacatgcacatgcagt 3203



to top

>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete sequence
          Length = 187121

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 99     caagcacatgcacatgcacatg 120
              ||||||||||||||||||||||
Sbjct: 101713 caagcacatgcacatgcacatg 101734



to top

>emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA
          Length = 952

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 102 gcacatgcacatgcacatgcag 123
           ||||||||||||||||||||||
Sbjct: 451 gcacatgcacatgcacatgcag 472



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 103 cacatgcacatgcacatgca 122
           ||||||||||||||||||||
Sbjct: 446 cacatgcacatgcacatgca 465



to top

>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds
          Length = 1308

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 1101 gcacatgcacatgcacatgca 1121



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 102  gcacatgcacatgcacatgc 121
            ||||||||||||||||||||
Sbjct: 1107 gcacatgcacatgcacatgc 1126



to top

>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence
          Length = 186266

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 168582 gcacatgcacatgcacatgca 168602



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 168576 gcacatgcacatgcacatgca 168596



to top

>gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, complete sequence
          Length = 171048

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 65280 gcacatgcacatgcacatgca 65300



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 65274 gcacatgcacatgcacatgca 65294



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 65268 gcacatgcacatgcacatgca 65288



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 65262 gcacatgcacatgcacatgca 65282



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 65256 gcacatgcacatgcacatgca 65276



to top

>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence
          Length = 171409

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 118959 gcacatgcacatgcacatgca 118979



to top

>gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome 12, complete sequence
          Length = 176261

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109047 gcacatgcacatgcacatgca 109027



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109041 gcacatgcacatgcacatgca 109021



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109035 gcacatgcacatgcacatgca 109015



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109029 gcacatgcacatgcacatgca 109009



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109023 gcacatgcacatgcacatgca 109003



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 109017 gcacatgcacatgcacatgca 108997



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 109052 cacatgcacatgcacatgca 109033



to top

>gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosome 12, complete
             sequence
          Length = 158341

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12885 gcacatgcacatgcacatgca 12865



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12879 gcacatgcacatgcacatgca 12859



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12873 gcacatgcacatgcacatgca 12853



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12867 gcacatgcacatgcacatgca 12847



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12861 gcacatgcacatgcacatgca 12841



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 12855 gcacatgcacatgcacatgca 12835



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 12890 cacatgcacatgcacatgca 12871



to top

>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence
          Length = 224193

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 96469 gcacatgcacatgcacatgca 96449



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 3539276 gcacatgcacatgcacatgca 3539256



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 3539270 gcacatgcacatgcacatgca 3539250



to top

>gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, complete sequence
          Length = 175586

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   cacatgcacatgcacatgcag 123
             |||||||||||||||||||||
Sbjct: 54154 cacatgcacatgcacatgcag 54174



to top

>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence
          Length = 203230

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 103    cacatgcacatgcacatgcag 123
              |||||||||||||||||||||
Sbjct: 181556 cacatgcacatgcacatgcag 181536



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 859544 gcacatgcacatgcacatgca 859564



to top

>gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, complete sequence
          Length = 203566

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 158681 gcacatgcacatgcacatgca 158701



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 158687 gcacatgcacatgcacatgc 158706



to top

>gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, complete sequence
          Length = 229959

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 29909 gcacatgcacatgcacatgca 29929



to top

>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 188458

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   cacatgcacatgcacatgcag 123
             |||||||||||||||||||||
Sbjct: 45613 cacatgcacatgcacatgcag 45633



to top

>gb|AC168276.3| Mus musculus  BAC RP24-485I12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 186675

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 103    cacatgcacatgcacatgcag 123
              |||||||||||||||||||||
Sbjct: 159516 cacatgcacatgcacatgcag 159536



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 183297 gcacatgcacatgcacatgca 183317



to top

>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 90180 gcacatgcacatgcacatgca 90160



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 90185 cacatgcacatgcacatgca 90166



to top

>gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, complete sequence
          Length = 166650

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 129383 gcacatgcacatgcacatgca 129363



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 129377 gcacatgcacatgcacatgca 129357



to top

>gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome
          Length = 17364

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16787 gcacatgcacatgcacatgca 16807



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16781 gcacatgcacatgcacatgca 16801



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16775 gcacatgcacatgcacatgca 16795



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16769 gcacatgcacatgcacatgca 16789



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16763 gcacatgcacatgcacatgca 16783



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16757 gcacatgcacatgcacatgca 16777



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16649 gcacatgcacatgcacatgca 16669



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16643 gcacatgcacatgcacatgca 16663



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16637 gcacatgcacatgcacatgca 16657



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16631 gcacatgcacatgcacatgca 16651



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16625 gcacatgcacatgcacatgca 16645



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16619 gcacatgcacatgcacatgca 16639



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16613 gcacatgcacatgcacatgca 16633



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16607 gcacatgcacatgcacatgca 16627



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16601 gcacatgcacatgcacatgca 16621



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16595 gcacatgcacatgcacatgca 16615



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16589 gcacatgcacatgcacatgca 16609



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16583 gcacatgcacatgcacatgca 16603



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16577 gcacatgcacatgcacatgca 16597



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16571 gcacatgcacatgcacatgca 16591



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16565 gcacatgcacatgcacatgca 16585



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16559 gcacatgcacatgcacatgca 16579



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16553 gcacatgcacatgcacatgca 16573



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 16752 cacatgcacatgcacatgca 16771



to top

>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence
          Length = 183218

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 68833 gcacatgcacatgcacatgca 68853



to top

>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete
             sequence
          Length = 182371

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 11344 gcacatgcacatgcacatgca 11324



to top

>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence
          Length = 170870

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 42080 gcacatgcacatgcacatgca 42060



to top

>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence
          Length = 214580

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59875 gcacatgcacatgcacatgca 59855



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59869 gcacatgcacatgcacatgca 59849



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59863 gcacatgcacatgcacatgca 59843



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59857 gcacatgcacatgcacatgca 59837



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59851 gcacatgcacatgcacatgca 59831



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59845 gcacatgcacatgcacatgca 59825



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 59880 cacatgcacatgcacatgca 59861



to top

>gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complete sequence
          Length = 240260

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 226264 gcacatgcacatgcacatgca 226244



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 226269 cacatgcacatgcacatgca 226250



to top

>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence
          Length = 191700

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 155892 gcacatgcacatgcacatgca 155912



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 155887 cacatgcacatgcacatgca 155906



to top

>gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, complete sequence
          Length = 228046

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 88701 gcacatgcacatgcacatgca 88721



to top

>gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome 8, complete sequence
          Length = 200605

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 179708 gcacatgcacatgcacatgca 179728



to top

>gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, complete sequence
          Length = 172617

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59989 gcacatgcacatgcacatgca 59969



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59983 gcacatgcacatgcacatgca 59963



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59977 gcacatgcacatgcacatgca 59957



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59971 gcacatgcacatgcacatgca 59951



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59965 gcacatgcacatgcacatgca 59945



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59959 gcacatgcacatgcacatgca 59939



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 59953 gcacatgcacatgcacatgca 59933



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 59994 cacatgcacatgcacatgca 59975



to top

>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence
          Length = 171263

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 4155 gcacatgcacatgcacatgca 4135



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 4149 gcacatgcacatgcacatgca 4129



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 149713 gcacatgcacatgcacatgca 149733



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 149707 gcacatgcacatgcacatgca 149727



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 149702 cacatgcacatgcacatgca 149721



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137950 gcacatgcacatgcacatgca 137930



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137944 gcacatgcacatgcacatgca 137924



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137938 gcacatgcacatgcacatgca 137918



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137932 gcacatgcacatgcacatgca 137912



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137926 gcacatgcacatgcacatgca 137906



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137920 gcacatgcacatgcacatgca 137900



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137914 gcacatgcacatgcacatgca 137894



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137908 gcacatgcacatgcacatgca 137888



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137902 gcacatgcacatgcacatgca 137882



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137896 gcacatgcacatgcacatgca 137876



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137890 gcacatgcacatgcacatgca 137870



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 137884 gcacatgcacatgcacatgca 137864



to top

>emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 in linkage group 18,
              complete sequence
          Length = 151872

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 140340 gcacatgcacatgcacatgca 140320



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 140334 gcacatgcacatgcacatgca 140314



to top

>gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 map q33, complete
             sequence
          Length = 118946

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 91027 gcacatgcacatgcacatgca 91007



to top

>gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosome 9, complete sequence
          Length = 192991

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 96817 gcacatgcacatgcacatgca 96837



to top

>gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosome 8, complete sequence
          Length = 205875

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113309 gcacatgcacatgcacatgca 113329



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113303 gcacatgcacatgcacatgca 113323



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113297 gcacatgcacatgcacatgca 113317



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113291 gcacatgcacatgcacatgca 113311



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113285 gcacatgcacatgcacatgca 113305



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113279 gcacatgcacatgcacatgca 113299



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 113273 gcacatgcacatgcacatgca 113293



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 113268 cacatgcacatgcacatgca 113287



to top

>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete
             sequence
          Length = 181828

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16975 gcacatgcacatgcacatgca 16955



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 16980 cacatgcacatgcacatgca 16961



to top

>gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome 3, complete sequence
          Length = 209378

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 164877 gcacatgcacatgcacatgca 164897



to top

>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
          Length = 203855

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 107689 gcacatgcacatgcacatgca 107669



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 107683 gcacatgcacatgcacatgca 107663



to top

>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence
          Length = 171124

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 157732 gcacatgcacatgcacatgca 157752



to top

>gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, complete sequence
          Length = 141866

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 116030 gcacatgcacatgcacatgca 116010



to top

>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence
          Length = 171006

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 40198 gcacatgcacatgcacatgca 40178



to top

>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence
          Length = 121648

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 68485 gcacatgcacatgcacatgca 68465



to top

>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence
          Length = 114519

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51403 gcacatgcacatgcacatgca 51423



to top

>gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosome 3, complete sequence
          Length = 228648

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 23710 gcacatgcacatgcacatgca 23730



to top

>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a
              novel pseudogene, the MRPL50 gene for mitochondrial
              ribosomal protein L50, the ZNF189 gene for zinc finger
              protein 189, the ALDOB gene for aldolase B,
              fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1
              alpha subcomplex (NDUFA4) pseudogene, three novel genes,
              the 5' end of the RNF20 gene for ring finger protein 20 and
              three CpG islands, complete sequence
          Length = 164115

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 138236 gcacatgcacatgcacatgca 138216



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 138241 cacatgcacatgcacatgca 138222



to top

>gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, complete sequence
          Length = 176916

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145466 gcacatgcacatgcacatgca 145486



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145460 gcacatgcacatgcacatgca 145480



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145454 gcacatgcacatgcacatgca 145474



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145448 gcacatgcacatgcacatgca 145468



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145442 gcacatgcacatgcacatgca 145462



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145436 gcacatgcacatgcacatgca 145456



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 145430 gcacatgcacatgcacatgca 145450



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 145425 cacatgcacatgcacatgca 145444



to top

>gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome 9, complete sequence
          Length = 183012

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 19626 gcacatgcacatgcacatgca 19606



to top

>emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenicity island (YAPI),
             complete sequence, strain 32777
          Length = 102752

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 64731 gcacatgcacatgcacatgca 64751



to top

>emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mitochondrial genome
          Length = 17036

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16410 gcacatgcacatgcacatgca 16430



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16404 gcacatgcacatgcacatgca 16424



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16398 gcacatgcacatgcacatgca 16418



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16392 gcacatgcacatgcacatgca 16412



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16386 gcacatgcacatgcacatgca 16406



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16380 gcacatgcacatgcacatgca 16400



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16374 gcacatgcacatgcacatgca 16394



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16368 gcacatgcacatgcacatgca 16388



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16362 gcacatgcacatgcacatgca 16382



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16356 gcacatgcacatgcacatgca 16376



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16350 gcacatgcacatgcacatgca 16370



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16344 gcacatgcacatgcacatgca 16364



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16338 gcacatgcacatgcacatgca 16358



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16332 gcacatgcacatgcacatgca 16352



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16326 gcacatgcacatgcacatgca 16346



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16320 gcacatgcacatgcacatgca 16340



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16314 gcacatgcacatgcacatgca 16334



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16308 gcacatgcacatgcacatgca 16328



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16302 gcacatgcacatgcacatgca 16322



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16296 gcacatgcacatgcacatgca 16316



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16290 gcacatgcacatgcacatgca 16310



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16284 gcacatgcacatgcacatgca 16304



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16278 gcacatgcacatgcacatgca 16298



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16272 gcacatgcacatgcacatgca 16292



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16266 gcacatgcacatgcacatgca 16286



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16260 gcacatgcacatgcacatgca 16280



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16254 gcacatgcacatgcacatgca 16274



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16248 gcacatgcacatgcacatgca 16268



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 16242 gcacatgcacatgcacatgca 16262



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 94992 gcacatgcacatgcacatgca 95012



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 94986 gcacatgcacatgcacatgca 95006



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 94981 cacatgcacatgcacatgca 95000



to top

>gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, complete sequence
          Length = 159617

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 69413 gcacatgcacatgcacatgca 69393



to top

>gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, complete sequence
          Length = 163180

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 99803 gcacatgcacatgcacatgca 99783



to top

>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence
          Length = 33456

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13356 gcacatgcacatgcacatgca 13336



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13350 gcacatgcacatgcacatgca 13330



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13344 gcacatgcacatgcacatgca 13324



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13338 gcacatgcacatgcacatgca 13318



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13332 gcacatgcacatgcacatgca 13312



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13326 gcacatgcacatgcacatgca 13306



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13320 gcacatgcacatgcacatgca 13300



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13314 gcacatgcacatgcacatgca 13294



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13308 gcacatgcacatgcacatgca 13288



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13302 gcacatgcacatgcacatgca 13282



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13296 gcacatgcacatgcacatgca 13276



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13290 gcacatgcacatgcacatgca 13270



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13284 gcacatgcacatgcacatgca 13264



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13278 gcacatgcacatgcacatgca 13258



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13272 gcacatgcacatgcacatgca 13252



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13266 gcacatgcacatgcacatgca 13246



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13260 gcacatgcacatgcacatgca 13240



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13254 gcacatgcacatgcacatgca 13234



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13248 gcacatgcacatgcacatgca 13228



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13242 gcacatgcacatgcacatgca 13222



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13236 gcacatgcacatgcacatgca 13216



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13230 gcacatgcacatgcacatgca 13210



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13224 gcacatgcacatgcacatgca 13204



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 13218 gcacatgcacatgcacatgca 13198



to top

>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11,
             complete sequence
          Length = 252675

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 10592 gcacatgcacatgcacatgca 10612



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 10587 cacatgcacatgcacatgca 10606



to top

>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 187438

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 70416 gcacatgcacatgcacatgca 70436



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 70410 gcacatgcacatgcacatgca 70430



to top

>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent
             ansamitocin biosynthetic gene cluster I, partial sequence
          Length = 82746

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 407   ggcgcagtcggcgtcgtcgta 427
             |||||||||||||||||||||
Sbjct: 48835 ggcgcagtcggcgtcgtcgta 48855



to top

>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 177096

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 48160 gcacatgcacatgcacatgca 48140



to top

>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence
          Length = 193569

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 103   cacatgcacatgcacatgcag 123
             |||||||||||||||||||||
Sbjct: 96146 cacatgcacatgcacatgcag 96126



to top

>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence
          Length = 112615

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 28613 gcacatgcacatgcacatgca 28593



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 28607 gcacatgcacatgcacatgca 28587



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 28618 cacatgcacatgcacatgca 28599



to top

>gb|AC112031.4| Rattus norvegicus  BAC CH230-99K18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 242158

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 103    cacatgcacatgcacatgcag 123
              |||||||||||||||||||||
Sbjct: 121225 cacatgcacatgcacatgcag 121245



to top

>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone
             BACR23F24, complete sequence
          Length = 183592

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 31529 gcacatgcacatgcacatgca 31549



to top

>gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, complete sequence
          Length = 146978

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51702 gcacatgcacatgcacatgca 51722



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51696 gcacatgcacatgcacatgca 51716



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51690 gcacatgcacatgcacatgca 51710



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51684 gcacatgcacatgcacatgca 51704



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 51678 gcacatgcacatgcacatgca 51698



to top

>gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, complete sequence
          Length = 157519

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 89387 gcacatgcacatgcacatgca 89367



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 89381 gcacatgcacatgcacatgca 89361



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 2058901 gcacatgcacatgcacatgca 2058881



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 2058895 gcacatgcacatgcacatgca 2058875



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 102     gcacatgcacatgcacatgc 121
               ||||||||||||||||||||
Sbjct: 2058889 gcacatgcacatgcacatgc 2058870



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgca 1349867



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 104      acatgcacatgcacatgcag 123
                ||||||||||||||||||||
Sbjct: 13094744 acatgcacatgcacatgcag 13094763



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 103     cacatgcacatgcacatgca 122
               ||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgca 1349861



to top

>gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence
          Length = 224

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 102 gcacatgcacatgcacatgca 122
           |||||||||||||||||||||
Sbjct: 194 gcacatgcacatgcacatgca 214



to top

>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete
            sequence
          Length = 141898

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 2916 gcacatgcacatgcacatgca 2896



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 2910 gcacatgcacatgcacatgca 2890



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 102  gcacatgcacatgcacatgc 121
            ||||||||||||||||||||
Sbjct: 2904 gcacatgcacatgcacatgc 2885



to top

>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence
          Length = 186063

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   cacatgcacatgcacatgcag 123
             |||||||||||||||||||||
Sbjct: 43146 cacatgcacatgcacatgcag 43166



to top

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
              complete sequence
          Length = 143879

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 111625 gcacatgcacatgcacatgca 111605



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 111619 gcacatgcacatgcacatgc 111600



to top

>gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-580N24, complete
             sequence
          Length = 87280

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 77034 gcacatgcacatgcacatgca 77014



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 77028 gcacatgcacatgcacatgca 77008



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 77022 gcacatgcacatgcacatgc 77003



to top

>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence
          Length = 193119

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 119858 gcacatgcacatgcacatgca 119838



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 119863 cacatgcacatgcacatgca 119844



to top

>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence
          Length = 194103

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 58117 gcacatgcacatgcacatgca 58097



to top

>emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on chromosome 16, complete
             sequence
          Length = 136128

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 60753 gcacatgcacatgcacatgca 60773



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 60747 gcacatgcacatgcacatgca 60767



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 60741 gcacatgcacatgcacatgca 60761



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 60735 gcacatgcacatgcacatgca 60755



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 60729 gcacatgcacatgcacatgca 60749



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 60724 cacatgcacatgcacatgca 60743



to top

>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 230270

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 103  cacatgcacatgcacatgcag 123
            |||||||||||||||||||||
Sbjct: 7462 cacatgcacatgcacatgcag 7482



to top

>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete
              sequence
          Length = 271902

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 125790 gcacatgcacatgcacatgca 125810



to top

>emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-855C23 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 196698

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 135322 gcacatgcacatgcacatgca 135342



to top

>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete
              sequence
          Length = 318699

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 194964 gcacatgcacatgcacatgca 194984



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 194958 gcacatgcacatgcacatgca 194978



to top

>emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-497E19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181433

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 99     caagcacatgcacatgcacat 119
              |||||||||||||||||||||
Sbjct: 123883 caagcacatgcacatgcacat 123863



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
              sequence
          Length = 304204

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 110470 gcacatgcacatgcacatgca 110450



to top

>dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-264L21, complete
              sequence
          Length = 151939

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 105911 gcacatgcacatgcacatgca 105891



to top

>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete
             sequence
          Length = 171738

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 28586 gcacatgcacatgcacatgca 28566



to top

>gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, complete sequence
          Length = 193884

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 103   cacatgcacatgcacatgcag 123
             |||||||||||||||||||||
Sbjct: 19626 cacatgcacatgcacatgcag 19606



to top

>gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, complete sequence
          Length = 200031

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 139469 gcacatgcacatgcacatgca 139489



to top

>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence
          Length = 181287

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 158851 gcacatgcacatgcacatgca 158871



to top

>gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome 8, complete sequence
          Length = 219376

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 155969 gcacatgcacatgcacatgca 155949



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 102     gcacatgcacatgcacatgca 122
               |||||||||||||||||||||
Sbjct: 1349847 gcacatgcacatgcacatgca 1349867



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 104      acatgcacatgcacatgcag 123
                ||||||||||||||||||||
Sbjct: 13049018 acatgcacatgcacatgcag 13049037



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 103     cacatgcacatgcacatgca 122
               ||||||||||||||||||||
Sbjct: 1349842 cacatgcacatgcacatgca 1349861



to top

>emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chromosome 11, complete
            sequence
          Length = 131385

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 8084 gcacatgcacatgcacatgca 8104



to top

>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499
             (D217), and DS08132 (D174)), complete sequence
          Length = 173970

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 37904 gcacatgcacatgcacatgca 37924



to top

>emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003_C01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 157453

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 79322 gcacatgcacatgcacatgca 79302



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 79327 cacatgcacatgcacatgca 79308



to top

>emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chromosome 12, complete
            sequence
          Length = 197822

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3935 gcacatgcacatgcacatgca 3955



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3929 gcacatgcacatgcacatgca 3949



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3923 gcacatgcacatgcacatgca 3943



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3917 gcacatgcacatgcacatgca 3937



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3911 gcacatgcacatgcacatgca 3931



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 102  gcacatgcacatgcacatgca 122
            |||||||||||||||||||||
Sbjct: 3905 gcacatgcacatgcacatgca 3925



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 3900 cacatgcacatgcacatgca 3919



to top

>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence
          Length = 201762

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 161188 gcacatgcacatgcacatgca 161168



to top

>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence
          Length = 171340

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 116938 gcacatgcacatgcacatgca 116958



to top

>gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, complete sequence
          Length = 186273

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 98905 gcacatgcacatgcacatgca 98885



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 98910 cacatgcacatgcacatgca 98891



to top

>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete
             sequence
          Length = 163330

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 11303 gcacatgcacatgcacatgca 11323



to top

>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete
              sequence
          Length = 129293

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 120165 gcacatgcacatgcacatgca 120185



to top

>gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, complete sequence
          Length = 190466

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 155791 gcacatgcacatgcacatgca 155771



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 155785 gcacatgcacatgcacatgca 155765



to top

>emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on chromosome 4, complete
             sequence
          Length = 183416

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 70527 gcacatgcacatgcacatgca 70507



to top

>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete
             sequence
          Length = 242502

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 81189 gcacatgcacatgcacatgca 81169



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 81183 gcacatgcacatgcacatgca 81163



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 81177 gcacatgcacatgcacatgca 81157



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 81171 gcacatgcacatgcacatgca 81151



to top

>gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, complete sequence
          Length = 209748

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gcacatgcacatgcacatgca 122
             |||||||||||||||||||||
Sbjct: 18836 gcacatgcacatgcacatgca 18816



to top

>gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome 13, complete sequence
          Length = 242910

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 102    gcacatgcacatgcacatgca 122
              |||||||||||||||||||||
Sbjct: 169818 gcacatgcacatgcacatgca 169798



to top

>emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 123F11
          Length = 23109

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 102 gcacatgcacatgcacatgca 122
           |||||||||||||||||||||
Sbjct: 488 gcacatgcacatgcacatgca 468



to top

>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence
          Length = 162962

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     caagcacatgcacatgcaca 118
              ||||||||||||||||||||
Sbjct: 154838 caagcacatgcacatgcaca 154857



to top

>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence
          Length = 156067

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 2462 cacatgcacatgcacatgca 2481



to top

>gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, complete sequence
          Length = 207176

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 128882 gcacatgcacatgcacatgc 128901



to top

>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 53534 cacatgcacatgcacatgca 53553



to top

>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence
          Length = 167871

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 107712 cacatgcacatgcacatgca 107731



to top

>gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, complete sequence
          Length = 176315

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 96798 gcacatgcacatgcacatgc 96779



to top

>gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, complete sequence
          Length = 182151

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 151531 cacatgcacatgcacatgca 151512



to top

>gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellite sequences
          Length = 687

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 103 cacatgcacatgcacatgca 122
           ||||||||||||||||||||
Sbjct: 99  cacatgcacatgcacatgca 80



to top

>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 442767 tggcgtagctgctgtaattt 442748



to top

>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence
          Length = 187202

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 157568 cacatgcacatgcacatgca 157587



to top

>gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 59971

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 41983 cacatgcacatgcacatgca 42002



to top

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 475367 tggcgtagctgctgtaattt 475348



to top

>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence
          Length = 238060

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 234459 cacatgcacatgcacatgca 234478



to top

>gb|AE006511.1| Streptococcus pyogenes M1 GAS, section 40 of 167 of the complete
            genome
          Length = 11131

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 190  tggcgtagctgctgtaattt 209
            ||||||||||||||||||||
Sbjct: 6815 tggcgtagctgctgtaattt 6796



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 102     gcacatgcacatgcacatgc 121
               ||||||||||||||||||||
Sbjct: 2104564 gcacatgcacatgcacatgc 2104583



to top

>gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-536L14, complete
             sequence
          Length = 148631

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 39531 gcacatgcacatgcacatgc 39550



to top

>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete
            sequence
          Length = 202934

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 5745 cacatgcacatgcacatgca 5726



to top

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 457540 tggcgtagctgctgtaattt 457521



to top

>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome
          Length = 1860355

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 447756 tggcgtagctgctgtaattt 447737



to top

>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 444861 tggcgtagctgctgtaattt 444842



to top

>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome
          Length = 1836467

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 445846 tggcgtagctgctgtaattt 445827



to top

>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence
          Length = 248320

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 99     caagcacatgcacatgcacatgca 122
              |||||||||||||| |||||||||
Sbjct: 218760 caagcacatgcacaggcacatgca 218737



to top

>gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, complete sequence
          Length = 141045

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 84001 gcacatgcacatgcacatgc 84020



to top

>gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, complete sequence
          Length = 245496

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 5695 cacatgcacatgcacatgca 5676



to top

>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence
          Length = 193532

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 119761 cacatgcacatgcacatgca 119742



to top

>gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome 9, complete sequence
          Length = 242229

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 69671 gcacatgcacatgcacatgc 69690



to top

>gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, complete sequence
          Length = 171181

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 43169 cacatgcacatgcacatgca 43188



to top

>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence
          Length = 212183

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 33272 cacatgcacatgcacatgca 33291



to top

>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence
          Length = 123569

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 74233 cacatgcacatgcacatgca 74252



to top

>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence
          Length = 229632

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 106204 cacatgcacatgcacatgca 106185



to top

>emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chromosome 17, complete
             sequence
          Length = 210326

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 26450 cacatgcacatgcacatgca 26431



to top

>emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 in linkage group 24,
             complete sequence
          Length = 181023

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    caagcacatgcacatgcaca 118
             ||||||||||||||||||||
Sbjct: 53191 caagcacatgcacatgcaca 53210



to top

>emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi-IMBB05
          Length = 374

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 103 cacatgcacatgcacatgca 122
           ||||||||||||||||||||
Sbjct: 39  cacatgcacatgcacatgca 58



to top

>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence
          Length = 183845

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 141307 cacatgcacatgcacatgca 141326



to top

>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete
             sequence
          Length = 158065

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 51571 cacatgcacatgcacatgca 51552



to top

>emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in linkage group 15,
              complete sequence
          Length = 173535

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tcgttttattattgtatata 52
              ||||||||||||||||||||
Sbjct: 146686 tcgttttattattgtatata 146667



to top

>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence
          Length = 168858

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 153982 cacatgcacatgcacatgca 154001



to top

>gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome 5, complete sequence
          Length = 134272

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 15578 gcacatgcacatgcacatgc 15597



to top

>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence
          Length = 189936

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 15523 cacatgcacatgcacatgca 15504



to top

>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence
          Length = 182135

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 147254 cacatgcacatgcacatgca 147273



to top

>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence
          Length = 146757

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 94    gtaagcaagcacatgcacatgcacatgc 121
             ||||||| ||||||||||| ||||||||
Sbjct: 84905 gtaagcatgcacatgcacacgcacatgc 84932



to top

>emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chromosome 6, complete
            sequence
          Length = 67632

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  catgcacatgcacatgcagt 124
            ||||||||||||||||||||
Sbjct: 2471 catgcacatgcacatgcagt 2452



to top

>gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, complete sequence
          Length = 247892

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 165924 cacatgcacatgcacatgca 165943



to top

>gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complete sequence
          Length = 159482

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 27288 cacatgcacatgcacatgca 27269



to top

>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence
          Length = 137137

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 76350 cacatgcacatgcacatgca 76331



to top

>gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, complete sequence
          Length = 190345

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 57942 cacatgcacatgcacatgca 57961



to top

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 445356 tggcgtagctgctgtaattt 445337



to top

>gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, complete sequence
          Length = 160383

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 64270 cacatgcacatgcacatgca 64289



to top

>emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in linkage group 14,
             complete sequence
          Length = 79737

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 99    caagcacatgcacatgcaca 118
             ||||||||||||||||||||
Sbjct: 32759 caagcacatgcacatgcaca 32740



to top

>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part of
              the ODZ1 gene for odz, odd Oz/ten-m homolog 1(Drosophila),
              complete sequence
          Length = 110180

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 107146 cacatgcacatgcacatgca 107165



to top

>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the
             GPR53P pseudogene for G protein-coupled receptor 53, the
             OR2I1P pseudogene for olfactory receptor, family 2,
             subfamily I, member 1, the UBD gene for ubiquitin D, the
             OR2H5P pseudogene for olfactory receptor, family 2,
             subfamily H, member 5, the RPL13AP pseudogene for
             ribosomal protein L13a, the OR2H2 gene for olfactory
             receptor, family 2, subfamily H, member 2, the GABBR1 gene
             for gamma-aminobutyric acid (GABA) B receptor, 1, and 3
             CpG islands, complete sequence
          Length = 102684

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 75647 catgcacatgcacatgcagt 75628



to top

>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a
             MAS1 oncogene pseudogene, a olfactory receptor, family 2,
             subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the
             UBD gene for ubiquitin D (FAT10), a olfactory receptor,
             family 2, subfamily H, member 5 pseudogene (OR2H5P,
             HS6M1-13P), a 60S ribosomal protein L13A (RPL13A)
             pseudogene, the OR2H2 gene for olfactory receptor, family
             2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for
             gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A,
             GABABR1), the 5' end of the MOG gene for myelin
             oligodendrocyte protein and three CpG islands, complete
             sequence
          Length = 145431

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 82068 catgcacatgcacatgcagt 82049



to top

>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the
             OR2H2 gene for olfactory receptor, family 2, subfamily H,
             member 2, the OR2I1P and OR2H5P pseudogenes for olfactory
             receptor, family 2, subfamily I, member 1 and subfamily H,
             member 5, the UBD gene for ubiquitin D, a 60S ribosomal
             protein L13A (RPL13A) pseudogene, the GABBR1 gene for
             gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3
             suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the
             MOG gene for myelin oligodendrocyte glycoprotein, the gene
             for a novel KRAB box-containing C2H2 type zinc finger
             protein and four CpG islands, complete sequence
          Length = 155874

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 58940 catgcacatgcacatgcagt 58921



to top

>emb|AL445984.6| Human DNA sequence from clone RP11-360A9 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 181419

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     aacctccacagaggtctctc 34
              ||||||||||||||||||||
Sbjct: 151939 aacctccacagaggtctctc 151958



to top

>emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on chromosome 13, complete
             sequence
          Length = 89264

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    tttattattgtatataaagcacac 60
             ||||||||| ||||||||||||||
Sbjct: 37818 tttattattatatataaagcacac 37795



to top

>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence
          Length = 197545

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 156696 cacatgcacatgcacatgca 156715



to top

>gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, complete sequence
          Length = 221489

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 37710 cacatgcacatgcacatgca 37691



to top

>gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133392

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 65791 gcacatgcacatgcacatgc 65772



to top

>gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 128765

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 102  gcacatgcacatgcacatgc 121
            ||||||||||||||||||||
Sbjct: 4839 gcacatgcacatgcacatgc 4820



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 266151 gcacatgcacatgcacatgc 266170



to top

>gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:106271 IMAGE:5341608),
            complete cds
          Length = 3092

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 2251 cacatgcacatgcacatgca 2232



to top

>gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3489729)
          Length = 2096

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 1254 cacatgcacatgcacatgca 1235



to top

>gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3666894)
          Length = 2070

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 1230 cacatgcacatgcacatgca 1211



to top

>gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:5150458), with apparent
            retained intron
          Length = 2194

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 1354 cacatgcacatgcacatgca 1335



to top

>gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:4024476), partial cds
          Length = 2433

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 1593 cacatgcacatgcacatgca 1574



to top

>gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, complete sequence
          Length = 180209

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 30422 cacatgcacatgcacatgca 30403



to top

>emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 in linkage group 1,
              complete sequence
          Length = 161017

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 110167 cacatgcacatgcacatgca 110186



to top

>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the
             5' end of the Scpep1 gene for serine carboxypeptidase 1,
             two transcription elongation factor B (SIII) polypeptide 2
             (Tceb2) pseudogenes, four novel genes (incl.
             A930013B10Rik), the Coil gene for coilin, the Trim25 gene
             for tripartite motif protein 25 and the Dgke gene for
             diacylglycerol kinase epsilon, complete sequence
          Length = 171512

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 96100 cacatgcacatgcacatgca 96081



to top

>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153284

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 115612 cacatgcacatgcacatgca 115593



to top

>emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313K1416 (from clone
           DKFZp313K1416)
          Length = 2410

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 103 cacatgcacatgcacatgca 122
           ||||||||||||||||||||
Sbjct: 430 cacatgcacatgcacatgca 411



to top

>emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on chromosome 6, complete
             sequence
          Length = 127280

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 53966 catgcacatgcacatgcagt 53947



to top

>emb|CR450726.6| Zebrafish DNA sequence from clone CH211-149F21 in linkage group 5,
             complete sequence
          Length = 93211

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    tcgttttattattgtatata 52
             ||||||||||||||||||||
Sbjct: 19088 tcgttttattattgtatata 19069



to top

>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a
             novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 196097

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 14871 cacatgcacatgcacatgca 14852



to top

>emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in linkage group 14,
             complete sequence
          Length = 213600

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 99    caagcacatgcacatgcaca 118
             ||||||||||||||||||||
Sbjct: 41131 caagcacatgcacatgcaca 41112



to top

>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence
          Length = 223809

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 99     caagcacatgcacatgcacatgca 122
              |||||||||||||| |||||||||
Sbjct: 182132 caagcacatgcacaggcacatgca 182155



to top

>emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chromosome 6, complete
             sequence
          Length = 57743

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 30792 catgcacatgcacatgcagt 30773



to top

>emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chromosome 6, complete
             sequence
          Length = 64196

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 20317 catgcacatgcacatgcagt 20298



to top

>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 192550

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 35938 cacatgcacatgcacatgca 35919



to top

>emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on chromosome 4, complete
              sequence
          Length = 209024

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 186478 cacatgcacatgcacatgca 186497



to top

>emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86L3, complete sequence
          Length = 154099

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 85284 cacatgcacatgcacatgca 85265



to top

>gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 188653

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 131326 gcacatgcacatgcacatgc 131307



to top

>gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence
          Length = 156998

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 35047 cacatgcacatgcacatgca 35066



to top

>gb|AE009996.1| Streptococcus pyogenes strain MGAS8232, section 44 of 173 of the
            complete genome
          Length = 11130

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 190  tggcgtagctgctgtaattt 209
            ||||||||||||||||||||
Sbjct: 6816 tggcgtagctgctgtaattt 6797



to top

>gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, complete sequence
          Length = 190692

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 27347 cacatgcacatgcacatgca 27328



to top

>gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, complete sequence
          Length = 170605

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 15011 cacatgcacatgcacatgca 15030



to top

>gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, complete sequence
          Length = 177978

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, complete sequence
          Length = 210074

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 58663 cacatgcacatgcacatgca 58644



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 398     ccagttggcggcgcagtcggcgtc 421
               ||||||||||||| ||||||||||
Sbjct: 3877672 ccagttggcggcgaagtcggcgtc 3877695



to top

>gb|DP000052.1| Sus scrofa target 126 genomic scaffold
          Length = 432382

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   agcacatgcacatgcacatg 120
             ||||||||||||||||||||
Sbjct: 71903 agcacatgcacatgcacatg 71922



to top

>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence
          Length = 226416

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 15947 cacatgcacatgcacatgca 15928



to top

>gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N02) from 6p21, complete
             sequence
          Length = 129806

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 49256 catgcacatgcacatgcagt 49275



to top

>gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome 17, complete sequence
          Length = 220526

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 52103 cacatgcacatgcacatgca 52122



to top

>gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosome 13, complete
             sequence
          Length = 185090

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 49079 cacatgcacatgcacatgca 49060



to top

>gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome 13, complete sequence
          Length = 199707

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 105689 cacatgcacatgcacatgca 105708



to top

>gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosome 9, complete sequence
          Length = 185878

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 158441 gcacatgcacatgcacatgc 158460



to top

>gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex BAC MMU268P23, complete
             sequence
          Length = 185838

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   catgcacatgcacatgcagt 124
             ||||||||||||||||||||
Sbjct: 34025 catgcacatgcacatgcagt 34006



to top

>gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex BAC MMU222I18, complete
              sequence
          Length = 174202

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    catgcacatgcacatgcagt 124
              ||||||||||||||||||||
Sbjct: 131087 catgcacatgcacatgcagt 131068



to top

>dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830014N07 product:unclassifiable, full
            insert sequence
          Length = 2863

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 1025 cacatgcacatgcacatgca 1006



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                        
Query: 214      gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 269
                ||||||| | ||| || ||||||| |||||  ||||| |||||| |||||||||||
Sbjct: 14484682 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 14484737



to top

>gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, complete sequence
          Length = 128950

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 58627 cacatgcacatgcacatgca 58646



to top

>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 102     gcacatgcacatgcacatgc 121
               ||||||||||||||||||||
Sbjct: 1244995 gcacatgcacatgcacatgc 1245014



to top

>gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A17, complete sequence
          Length = 151801

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 88742 cacatgcacatgcacatgca 88723



to top

>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence
          Length = 159497

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 29950 cacatgcacatgcacatgca 29931



to top

>gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome 16, complete sequence
          Length = 154624

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 50006 cacatgcacatgcacatgca 49987



to top

>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence
          Length = 197652

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 168710 gcacatgcacatgcacatgc 168691



to top

>gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complete sequence
          Length = 152996

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 79453 cacatgcacatgcacatgca 79434



to top

>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome
          Length = 1900521

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    tggcgtagctgctgtaattt 209
              ||||||||||||||||||||
Sbjct: 427887 tggcgtagctgctgtaattt 427868



to top

>gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O11, complete sequence
          Length = 177978

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 15885 cacatgcacatgcacatgca 15866



to top

>gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome 7, complete sequence
          Length = 189942

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 30858 cacatgcacatgcacatgca 30839



to top

>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome
          Length = 1894275

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 190     tggcgtagctgctgtaattt 209
               ||||||||||||||||||||
Sbjct: 1468855 tggcgtagctgctgtaattt 1468874



to top

>gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, complete sequence
          Length = 188226

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   gcacatgcacatgcacatgc 121
             ||||||||||||||||||||
Sbjct: 37172 gcacatgcacatgcacatgc 37153



to top

>dbj|AP004732.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0021M10
          Length = 163416

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 214   gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 269
             ||||||| | ||| || ||||||| |||||  ||||| |||||| |||||||||||
Sbjct: 77856 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 77911



to top

>emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chromosome X, complete
             sequence
          Length = 225082

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 82307 cacatgcacatgcacatgca 82326



to top

>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete
             sequence
          Length = 103290

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 42287 cacatgcacatgcacatgca 42268



to top

>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence
          Length = 162077

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 59327 cacatgcacatgcacatgca 59308



to top

>gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, complete sequence
          Length = 199709

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 62321 cacatgcacatgcacatgca 62302



to top

>gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, complete sequence
          Length = 172093

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 50462 cacatgcacatgcacatgca 50443



to top

>gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome 6, complete sequence
          Length = 212275

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 191335 cacatgcacatgcacatgca 191316



to top

>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence
          Length = 185649

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 124609 cacatgcacatgcacatgca 124628



to top

>gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, complete sequence
          Length = 175838

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 129905 cacatgcacatgcacatgca 129886



to top

>gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, complete sequence
          Length = 149905

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 103  cacatgcacatgcacatgca 122
            ||||||||||||||||||||
Sbjct: 2869 cacatgcacatgcacatgca 2888



to top

>emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e2, COMPLETE SEQUENCE
          Length = 122895

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 99   caagcacatgcacatgcacatgca 122
            |||||||| |||||||||||||||
Sbjct: 9247 caagcacaagcacatgcacatgca 9224



to top

>gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, complete sequence
          Length = 171789

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 63343 cacatgcacatgcacatgca 63362



to top

>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete
           sequence
          Length = 217169

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 103 cacatgcacatgcacatgca 122
           ||||||||||||||||||||
Sbjct: 814 cacatgcacatgcacatgca 795



to top

>emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene
          Length = 4787

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 102  gcacatgcacatgcacatgc 121
            ||||||||||||||||||||
Sbjct: 4003 gcacatgcacatgcacatgc 4022



to top

>gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41 of 83 of the complete
              sequence
          Length = 280378

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    gcacatgcacatgcacatgc 121
              ||||||||||||||||||||
Sbjct: 149774 gcacatgcacatgcacatgc 149755



to top

>emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence
          Length = 139693

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 109011 cacatgcacatgcacatgca 109030



to top

>gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, complete sequence
          Length = 278172

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 254552 cacatgcacatgcacatgca 254571



to top

>emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chromosome 14, complete
              sequence
          Length = 178159

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     caagcacatgcacatgcaca 118
              ||||||||||||||||||||
Sbjct: 150708 caagcacatgcacatgcaca 150727



to top

>gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome 14, complete sequence
          Length = 186187

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 65805 cacatgcacatgcacatgca 65824



to top

>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete
             sequence
          Length = 181372

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 37404 cacatgcacatgcacatgca 37385



to top

>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence
          Length = 162290

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 22263 cacatgcacatgcacatgca 22282



to top

>emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21 on chromosome 6p21.31-22.2
              Contains a MAS1 oncogene pseudogene, the OR2H2 gene for
              olfactory receptor 2H2, olfactory receptor 2I1 and 2H5
              pseudogenes OR2I1P and OR2H5P, the gene for diubiquitin, an
              RPL13A (60S Ribosomal Protein L13A) pseudogene, the GABBR1
              gene for gamma-aminobutyric acid (GABA) B receptor 1 and an
              SMT3H1 or SMT3H2 (SMT3 (suppressor of mif two 3, yeast)
              homolog) pseudogene and three CpG islands, complete
              sequence
          Length = 134292

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    catgcacatgcacatgcagt 124
              ||||||||||||||||||||
Sbjct: 104348 catgcacatgcacatgcagt 104329



to top

>emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa0037L20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 178827

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   acatgcacatgcacatgcag 123
             ||||||||||||||||||||
Sbjct: 83947 acatgcacatgcacatgcag 83966



to top

>gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete sequence
          Length = 40293

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 22052 cacatgcacatgcacatgca 22071



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 103     cacatgcacatgcacatgca 122
               ||||||||||||||||||||
Sbjct: 1995856 cacatgcacatgcacatgca 1995875



to top

>gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complete sequence
          Length = 205543

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   cacatgcacatgcacatgca 122
             ||||||||||||||||||||
Sbjct: 66199 cacatgcacatgcacatgca 66180



to top

>gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, complete sequence
          Length = 186190

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    cacatgcacatgcacatgca 122
              ||||||||||||||||||||
Sbjct: 178171 cacatgcacatgcacatgca 178152


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,295,738
Number of Sequences: 3902068
Number of extensions: 3295738
Number of successful extensions: 78288
Number of sequences better than 10.0: 266
Number of HSP's better than 10.0 without gapping: 268
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76767
Number of HSP's gapped (non-prelim): 1355
length of query: 428
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 406
effective length of database: 17,147,199,772
effective search space: 6961763107432
effective search space used: 6961763107432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top