Clone Name | rbart32g11 |
---|---|
Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 1929001 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 1929060 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 1929061 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 1929120 Query: 414 ccctc 418 ||||| Sbjct: 1929121 ccctc 1929125 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 322 ctgcatcttgaccacctgcttcca 345 |||||||||||||||||||||||| Sbjct: 1933021 ctgcatcttgaccacctgcttcca 1933044 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 220 aagattcatgcatgcatgcatgcatg 245 ||||| |||||||||||||||||||| Sbjct: 15347883 aagatgcatgcatgcatgcatgcatg 15347858 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 24914564 catgcatgcatgcatgcatgc 24914584 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 15347858 catgcatgcatgcatgcatgc 15347878 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 3538608 catgcatgcatgcatgcatgc 3538628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068032 catgcatgcatgcatgcatgc 1068052 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068051 catgcatgcatgcatgcatgc 1068031 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068028 catgcatgcatgcatgcatgc 1068048 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068047 catgcatgcatgcatgcatgc 1068027 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068024 catgcatgcatgcatgcatgc 1068044 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068043 catgcatgcatgcatgcatgc 1068023 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 30839955 atgcatgcatgcatgcatgc 30839936 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 24914583 catgcatgcatgcatgcatg 24914564 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 23282486 catgcatgcatgcatgcatg 23282505 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 23282505 catgcatgcatgcatgcatg 23282486 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 15347880 atgcatgcatgcatgcatgc 15347861 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 8062239 atgcatgcatgcatgcatgc 8062220 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tttatttgttgaactgaaag 37 |||||||||||||||||||| Sbjct: 6716929 tttatttgttgaactgaaag 6716948 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3538627 catgcatgcatgcatgcatg 3538608 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgc 249 |||||||||||||||||||| Sbjct: 200598 catgcatgcatgcatgctgc 200579
>gb|AC099399.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1006F06, complete sequence Length = 122218 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Minus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 46410 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 46351 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 46350 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 46291 Query: 414 ccctc 418 ||||| Sbjct: 46290 ccctc 46286 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 322 ctgcatcttgaccacctgcttcca 345 |||||||||||||||||||||||| Sbjct: 42390 ctgcatcttgaccacctgcttcca 42367
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 1928999 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 1929058 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 1929059 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 1929118 Query: 414 ccctc 418 ||||| Sbjct: 1929119 ccctc 1929123 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 322 ctgcatcttgaccacctgcttcca 345 |||||||||||||||||||||||| Sbjct: 1933019 ctgcatcttgaccacctgcttcca 1933042 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 220 aagattcatgcatgcatgcatgcatg 245 ||||| |||||||||||||||||||| Sbjct: 15342417 aagatgcatgcatgcatgcatgcatg 15342392 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 25005839 catgcatgcatgcatgcatgc 25005859 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 15342392 catgcatgcatgcatgcatgc 15342412 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 3538719 catgcatgcatgcatgcatgc 3538739 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068030 catgcatgcatgcatgcatgc 1068050 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068049 catgcatgcatgcatgcatgc 1068029 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068026 catgcatgcatgcatgcatgc 1068046 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068045 catgcatgcatgcatgcatgc 1068025 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068022 catgcatgcatgcatgcatgc 1068042 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1068041 catgcatgcatgcatgcatgc 1068021 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 30930478 atgcatgcatgcatgcatgc 30930459 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 25005858 catgcatgcatgcatgcatg 25005839 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 23275533 catgcatgcatgcatgcatg 23275514 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 23275514 catgcatgcatgcatgcatg 23275533 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 15342414 atgcatgcatgcatgcatgc 15342395 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 8060074 atgcatgcatgcatgcatgc 8060055 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tttatttgttgaactgaaag 37 |||||||||||||||||||| Sbjct: 6716142 tttatttgttgaactgaaag 6716161 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3538738 catgcatgcatgcatgcatg 3538719 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgc 249 |||||||||||||||||||| Sbjct: 200598 catgcatgcatgcatgctgc 200579
>dbj|AK059955.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-D02, full insert sequence Length = 951 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Minus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 787 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 728 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 727 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 668 Query: 414 ccctc 418 ||||| Sbjct: 667 ccctc 663
>ref|XM_470191.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 678 Score = 143 bits (72), Expect = 6e-31 Identities = 111/124 (89%) Strand = Plus / Minus Query: 295 tcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggcg 354 ||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 678 tcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgcg 619 Query: 355 gctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgcc 414 | ||||||| | ||||||||||| || ||||||||||||||||||||||||||| |||| Sbjct: 618 gttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgcc 559 Query: 415 cctc 418 |||| Sbjct: 558 cctc 555
>gb|AY533123.1| Oryza sativa (japonica cultivar-group) glutathione S-transferase GSTF15 mRNA, complete cds Length = 678 Score = 143 bits (72), Expect = 6e-31 Identities = 111/124 (89%) Strand = Plus / Minus Query: 295 tcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggcg 354 ||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 678 tcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgcg 619 Query: 355 gctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgcc 414 | ||||||| | ||||||||||| || ||||||||||||||||||||||||||| |||| Sbjct: 618 gttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgcc 559 Query: 415 cctc 418 |||| Sbjct: 558 cctc 555
>gb|AF244677.1|AF244677 Zea mays glutathione S-transferase GST 12 mRNA, complete cds Length = 1198 Score = 111 bits (56), Expect = 2e-21 Identities = 107/124 (86%) Strand = Plus / Minus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | |||||||||||| ||||||||| | |||||| |||||||| || Sbjct: 782 atcactcgaacgcgccggggtgctccctctgcatcttcatgacctgcctccaggagtcgc 723 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| Sbjct: 722 gggtggagatcttgtcgtaccacctggccacgtgcttcctggcggtgaagagcttcctgc 663 Query: 414 ccct 417 |||| Sbjct: 662 ccct 659
>gb|AY103863.1| Zea mays PCO132785 mRNA sequence Length = 959 Score = 111 bits (56), Expect = 2e-21 Identities = 107/124 (86%) Strand = Plus / Minus Query: 294 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 353 |||||||||| | |||||||||||| ||||||||| | |||||| |||||||| || Sbjct: 805 atcactcgaacgcgccggggtgctccctctgcatcttcatgacctgcctccaggagtcgc 746 Query: 354 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 413 || ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| Sbjct: 745 gggtggagatcttgtcgtaccacctggccacgtgcttcctggcggtgaagagcttcctgc 686 Query: 414 ccct 417 |||| Sbjct: 685 ccct 682
>gb|AF244678.1|AF244678 Zea mays glutathione S-transferase GST 13 mRNA, complete cds Length = 1134 Score = 101 bits (51), Expect = 2e-18 Identities = 108/127 (85%) Strand = Plus / Minus Query: 291 ccgatcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggagg 350 ||||||||||||| | |||||||||||| ||||||||||| |||||| |||| ||| Sbjct: 742 ccgatcactcgaacgcgccggggtgctccctctgcatcttgatgacctgcctccacgagt 683 Query: 351 ggcggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcc 410 |||| ||||||| ||||||||||||||| ||||||||| ||| |||||||||||| | Sbjct: 682 cgcgggtggagatcttgtcgtaccacctggcgacgtgcttcctggcggtgaagagctttc 623 Query: 411 tgcccct 417 ||||||| Sbjct: 622 tgcccct 616 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 761 atgcatgcatgcatgcatgc 780
>emb|AL732484.13| Mouse DNA sequence from clone RP23-37B7 on chromosome 2, complete sequence Length = 201265 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgctg 248 |||||||||||||||||||||||||| Sbjct: 168004 attcatgcatgcatgcatgcatgctg 168029 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 168026 catgcatgcatgcatgcatg 168007 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 168000 attcattcatgcatgcatgcatgc 168023
>gb|AC158236.2| Mus musculus BAC clone RP23-132B15 from chromosome 8, complete sequence Length = 209957 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgct 247 ||||||||||||||||||||||||| Sbjct: 78696 attcatgcatgcatgcatgcatgct 78720 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 78718 catgcatgcatgcatgcatg 78699 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 78692 attcattcatgcatgcatgcatgc 78715
>dbj|AK089473.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730037C07 product:lipoprotein lipase, full insert sequence Length = 2424 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgct 247 ||||||||||||||||||||||||| Sbjct: 713 attcatgcatgcatgcatgcatgct 737 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 735 catgcatgcatgcatgcatg 716 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 709 attcattcatgcatgcatgcatgc 732
>gb|DQ323045.1| Phaseolus vulgaris clone BAC-71F18, complete sequence Length = 157468 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgctgcc 250 ||||||||||||||||||||||||| Sbjct: 88346 catgcatgcatgcatgcatgctgcc 88322 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgcc 250 ||||||||||||||||||||| Sbjct: 97711 catgcatgcatgcatgctgcc 97691 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgcc 250 ||||||||||||||||||||| Sbjct: 91739 catgcatgcatgcatgctgcc 91719 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 88327 catgcatgcatgcatgcatg 88346
>gb|AC166108.4| Mus musculus BAC clone RP23-192E10 from chromosome 1, complete sequence Length = 188836 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 3227 attcatgcatgcatgcatgcatgc 3250 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 3252 atgcatgcatgcatgcatgc 3233 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3249 catgcatgcatgcatgcatg 3230
>ref|XM_470192.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 531 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 322 ctgcatcttgaccacctgcttcca 345 |||||||||||||||||||||||| Sbjct: 504 ctgcatcttgaccacctgcttcca 481
>gb|AC112962.15| Mus musculus chromosome 19, clone RP24-74N6, complete sequence Length = 182999 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 51484 attcatgcatgcatgcatgcatgc 51461 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 51458 catgcatgcatgcatgcatgc 51478 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 51477 catgcatgcatgcatgcatgc 51457 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 51488 attcattcatgcatgcatgcatgc 51465 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 51462 catgcatgcatgcatgcatg 51481
>gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, complete sequence Length = 212395 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgcat 244 |||||||||||||||||||||||| Sbjct: 89797 agattcatgcatgcatgcatgcat 89774 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcat 240 |||||||||||||||||||| Sbjct: 192788 agattcatgcatgcatgcat 192769
>gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosome 14, complete sequence Length = 215802 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 120444 attcatgcatgcatgcatgcatgc 120467 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 120451 catgcatgcatgcatgcatgc 120471 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 120470 catgcatgcatgcatgcatgc 120450 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 120473 atgcatgcatgcatgcatgc 120454 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 120466 catgcatgcatgcatgcatg 120447
>gb|AC097832.7| Rattus norvegicus 11 BAC CH230-68C19 (Children's Hospital Oakland Research Institute) complete sequence Length = 262323 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 245990 attcatgcatgcatgcatgcatgc 246013 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 246015 atgcatgcatgcatgcatgc 245996 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 246012 catgcatgcatgcatgcatg 245993 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 245986 attcattcatgcatgcatgcatgc 246009
>gb|AF130357.2| Mus musculus chromosome X clone CT7-148C10, complete sequence Length = 106724 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 23305 attcatgcatgcatgcatgcatgc 23328 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 23312 catgcatgcatgcatgcatgc 23332 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 23331 catgcatgcatgcatgcatgc 23311 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 23327 catgcatgcatgcatgcatg 23308
>gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosome 6, complete sequence Length = 182673 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 56693 attcatgcatgcatgcatgcatgc 56670 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 56667 catgcatgcatgcatgcatgc 56687 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 56686 catgcatgcatgcatgcatgc 56666 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 56671 catgcatgcatgcatgcatg 56690 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 56664 atgcatgcatgcatgcatgc 56683
>gb|AC124211.2| Mus musculus chromosome X clone CT7-497M13 map qA7.1, complete sequence Length = 114873 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 70805 attcatgcatgcatgcatgcatgc 70828 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 70812 catgcatgcatgcatgcatgc 70832 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 70831 catgcatgcatgcatgcatgc 70811 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 70827 catgcatgcatgcatgcatg 70808
>gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosome 18, complete sequence Length = 204165 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 18206 attcatgcatgcatgcatgcatgc 18183 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 18180 catgcatgcatgcatgcatgc 18200 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 18199 catgcatgcatgcatgcatgc 18179 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 18210 attcattcatgcatgcatgcatgc 18187 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 18184 catgcatgcatgcatgcatg 18203 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 18177 atgcatgcatgcatgcatgc 18196
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 56908 attcatgcatgcatgcatgcatgc 56885 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 56912 attcattcatgcatgcatgcatgc 56889 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 56886 catgcatgcatgcatgcatg 56905 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 56883 atgcatgcatgcatgcatgc 56902
>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence Length = 177193 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 33322 attcatgcatgcatgcatgcatgc 33299 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33296 catgcatgcatgcatgcatgc 33316 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33315 catgcatgcatgcatgcatgc 33295 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33292 catgcatgcatgcatgcatgc 33312 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33311 catgcatgcatgcatgcatgc 33291 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33288 catgcatgcatgcatgcatgc 33308 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 33300 catgcatgcatgcatgcatg 33319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 33307 catgcatgcatgcatgcatg 33288
>gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, complete sequence Length = 186120 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 128051 attcatgcatgcatgcatgcatgc 128028 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 128055 attcattcatgcatgcatgcatgc 128032 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 128029 catgcatgcatgcatgcatg 128048 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 128026 atgcatgcatgcatgcatgc 128045
>emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chromosome 17, complete sequence Length = 228057 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 111465 attcatgcatgcatgcatgcatgc 111442 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 111439 catgcatgcatgcatgcatgc 111459 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 111458 catgcatgcatgcatgcatgc 111438 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 111443 catgcatgcatgcatgcatg 111462 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 111436 atgcatgcatgcatgcatgc 111455
>emb|CT025643.4| Mouse DNA sequence from clone RP24-386L23 on chromosome 13, complete sequence Length = 148821 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 76464 attcatgcatgcatgcatgcatgc 76487 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 76428 attcatgcatgcatgcatgcatgc 76451 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 76344 attcatgcatgcatgcatgcatgc 76367 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 76396 attcatgcatgcatgcatgcat 76417 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76351 catgcatgcatgcatgcatgc 76371 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76370 catgcatgcatgcatgcatgc 76350 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 76489 atgcatgcatgcatgcatgc 76470 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 76486 catgcatgcatgcatgcatg 76467 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 76460 attcattcatgcatgcatgcatgc 76483 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 76453 atgcatgcatgcatgcatgc 76434 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 76450 catgcatgcatgcatgcatg 76431 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 76424 attcattcatgcatgcatgcatgc 76447 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 76373 atgcatgcatgcatgcatgc 76354 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 76366 catgcatgcatgcatgcatg 76347 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 76340 attcattcatgcatgcatgcatgc 76363
>gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complete sequence Length = 235023 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 110948 attcatgcatgcatgcatgcatgc 110971 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 110973 atgcatgcatgcatgcatgc 110954 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 110970 catgcatgcatgcatgcatg 110951 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 110944 attcattcatgcatgcatgcatgc 110967
>gb|AC108812.9| Mus musculus chromosome 18, clone RP23-417M2, complete sequence Length = 202340 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 125508 attcatgcatgcatgcatgcatgc 125485 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125482 catgcatgcatgcatgcatgc 125502 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125501 catgcatgcatgcatgcatgc 125481 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125478 catgcatgcatgcatgcatgc 125498 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125497 catgcatgcatgcatgcatgc 125477 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125474 catgcatgcatgcatgcatgc 125494 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 125486 catgcatgcatgcatgcatg 125505 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 125493 catgcatgcatgcatgcatg 125474
>gb|AC101813.5| Mus musculus chromosome 1, clone RP24-315D8, complete sequence Length = 159286 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 11944 attcatgcatgcatgcatgcatgc 11967 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 11969 atgcatgcatgcatgcatgc 11950 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 11966 catgcatgcatgcatgcatg 11947
>emb|AL035459.6|HS81G23 Human DNA sequence from clone RP1-81G23 on chromosome 20q12 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, ESTs, STS and GSSs, complete sequence Length = 50348 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 48444 attcatgcatgcatgcatgcatgc 48467 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 48469 atgcatgcatgcatgcatgc 48450 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 48466 catgcatgcatgcatgcatg 48447
>emb|AL662855.19| Mouse DNA sequence from clone RP23-388J21 on chromosome 11, complete sequence Length = 157088 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 134948 attcatgcatgcatgcatgcatgc 134925 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 134926 catgcatgcatgcatgcatg 134945 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 134923 atgcatgcatgcatgcatgc 134942
>gb|AC093004.2| Homo sapiens 3 BAC RP11-129J11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159134 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 26456 attcatgcatgcatgcatgcatgc 26479 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 26481 atgcatgcatgcatgcatgc 26462 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 26478 catgcatgcatgcatgcatg 26459
>dbj|AK140551.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930026D16 product:unclassifiable, full insert sequence Length = 1136 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 300 attcatgcatgcatgcatgcatgc 277 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 269 tcatgcatgcatgcatgcatgc 290 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 274 catgcatgcatgcatgcatgc 294 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 293 catgcatgcatgcatgcatgc 273 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 304 attcattcatgcatgcatgcatgc 281 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 278 catgcatgcatgcatgcatg 297 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 289 catgcatgcatgcatgcatg 270
>gb|AC160561.2| Mus musculus BAC clone RP23-102D22 from chromosome 12, complete sequence Length = 204231 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 53744 attcatgcatgcatgcatgcatgc 53721 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 53718 catgcatgcatgcatgcatgc 53738 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 53737 catgcatgcatgcatgcatgc 53717 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 53722 catgcatgcatgcatgcatg 53741 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 53715 atgcatgcatgcatgcatgc 53734
>gb|AC157916.2| Mus musculus chromosome 19, clone RP24-330P23, complete sequence Length = 190666 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 41516 attcatgcatgcatgcatgcatgc 41539 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 41523 catgcatgcatgcatgcatgc 41543 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 41542 catgcatgcatgcatgcatgc 41522 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 41538 catgcatgcatgcatgcatg 41519 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 41512 attcattcatgcatgcatgcatgc 41535
>dbj|AK078684.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched library, clone:7530406I19 product:unclassifiable, full insert sequence Length = 3453 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 1878 attcatgcatgcatgcatgcatgc 1855 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1852 catgcatgcatgcatgcatgc 1872 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1871 catgcatgcatgcatgcatgc 1851 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1848 catgcatgcatgcatgcatgc 1868 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1867 catgcatgcatgcatgcatgc 1847 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1844 catgcatgcatgcatgcatgc 1864 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 1856 catgcatgcatgcatgcatg 1875 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 1863 catgcatgcatgcatgcatg 1844
>gb|AC154470.2| Mus musculus BAC clone RP23-193P13 from chromosome 13, complete sequence Length = 216294 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 13572 attcatgcatgcatgcatgcatgc 13595 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 13536 attcatgcatgcatgcatgcatgc 13559 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 13452 attcatgcatgcatgcatgcatgc 13475 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 13504 attcatgcatgcatgcatgcat 13525 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 13459 catgcatgcatgcatgcatgc 13479 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 13478 catgcatgcatgcatgcatgc 13458 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13597 atgcatgcatgcatgcatgc 13578 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 13594 catgcatgcatgcatgcatg 13575 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 13568 attcattcatgcatgcatgcatgc 13591 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13561 atgcatgcatgcatgcatgc 13542 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 13558 catgcatgcatgcatgcatg 13539 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 13532 attcattcatgcatgcatgcatgc 13555 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13481 atgcatgcatgcatgcatgc 13462 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 13474 catgcatgcatgcatgcatg 13455 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 13448 attcattcatgcatgcatgcatgc 13471
>gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosome 17, complete sequence Length = 181773 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 11004 attcatgcatgcatgcatgcatgc 10981 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 10973 tcatgcatgcatgcatgcatgc 10994 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 10978 catgcatgcatgcatgcatgc 10998 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 10997 catgcatgcatgcatgcatgc 10977 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 11008 attcattcatgcatgcatgcatgc 10985 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 10982 catgcatgcatgcatgcatg 11001 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 10993 catgcatgcatgcatgcatg 10974
>gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome 18, complete sequence Length = 211149 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 61284 attcatgcatgcatgcatgcatgc 61307 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 61291 catgcatgcatgcatgcatgc 61311 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 61310 catgcatgcatgcatgcatgc 61290 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 61313 atgcatgcatgcatgcatgc 61294 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 61306 catgcatgcatgcatgcatg 61287 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 61280 attcattcatgcatgcatgcatgc 61303
>gb|AF090447.2| Zea mays 22 kDa alpha zein gene cluster, complete sequence Length = 346296 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgctgc 249 |||||||||||||||||||||||| Sbjct: 32509 catgcatgcatgcatgcatgctgc 32486 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 32490 catgcatgcatgcatgcatg 32509
>gb|AY111699.1| Zea mays CL1117_-2 mRNA sequence Length = 633 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 368 tcgtaccacctggccacgtgcttcttggaggtgaagagcttcct 411 ||||||||| ||||||||| ||||||| |||||||||||||| Sbjct: 364 tcgtaccacttggccacgttcttcttgttagtgaagagcttcct 321
>dbj|AK059226.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D08, full insert sequence Length = 631 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 322 ctgcatcttgaccacctgcttcca 345 |||||||||||||||||||||||| Sbjct: 363 ctgcatcttgaccacctgcttcca 340
>dbj|AP001922.4| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2530H12, complete sequence Length = 219366 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 135549 attcatgcatgcatgcatgcatgc 135572 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 135574 atgcatgcatgcatgcatgc 135555 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 135571 catgcatgcatgcatgcatg 135552
>gb|AF100956.1|AF100956 Mus musculus major histocompatibility locus class II region; Fas-binding protein Daxx (DAXX) gene, partial cds; Bing1 (BING1), tapasin (tapasin), RalGDS-like factor (RLF), KE2 (KE2), BING4 (BING4), beta1, 3-galactosyl transferase (beta1,3-galactosyl transferase), ribosomal protein subunit S18 (RPS18), Sacm21 (Sacm21), H2K1(b) (H2-K1(b)), RING1 (RING1), KE6a (KE6a), KE4 (KE4), RXRbeta (RXRbeta), collagen alpha-2 (XI) (COLA11A2), H2-O alpha (H2-Oalpha), RING3 (RING3), H2-M alpha (H2-M alpha), H2-M beta 2 (H2-M beta2), and H2-M beta1 (H2-M beta1) genes, complete cds; and LMP 2 gene, partial cds Length = 273800 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 104946 attcatgcatgcatgcatgcatgc 104923 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104920 catgcatgcatgcatgcatgc 104940 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104939 catgcatgcatgcatgcatgc 104919 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 104924 catgcatgcatgcatgcatg 104943 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 104917 atgcatgcatgcatgcatgc 104936
>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete sequence Length = 197190 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 115939 attcatgcatgcatgcatgcatgc 115962 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 115946 catgcatgcatgcatgcatgc 115966 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 115965 catgcatgcatgcatgcatgc 115945 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 115961 catgcatgcatgcatgcatg 115942
>emb|AL671335.12| Mouse DNA sequence from clone RP23-130J1 on chromosome X, complete sequence Length = 175336 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 121635 attcatgcatgcatgcatgcatgc 121658 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 121642 catgcatgcatgcatgcatgct 121663 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 121661 catgcatgcatgcatgcatgc 121641 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 121657 catgcatgcatgcatgcatg 121638 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 121631 attcattcatgcatgcatgcatgc 121654
>emb|AL807394.9| Mouse DNA sequence from clone RP23-304N5 on chromosome X, complete sequence Length = 161674 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 84770 attcatgcatgcatgcatgcatgc 84793 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 84777 catgcatgcatgcatgcatgc 84797 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 84796 catgcatgcatgcatgcatgc 84776 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 84792 catgcatgcatgcatgcatg 84773
>emb|AL627323.6| Mouse DNA sequence from clone RP23-477G24 on chromosome 11, complete sequence Length = 64341 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||||| Sbjct: 44093 attcatgcatgcatgcatgcatgc 44116 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 44118 atgcatgcatgcatgcatgc 44099 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 44115 catgcatgcatgcatgcatg 44096 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 44089 attcattcatgcatgcatgcatgc 44112
>gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosome 12, complete sequence Length = 190357 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 105976 ttcatgcatgcatgcatgcatgc 105998 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 105982 catgcatgcatgcatgcatgc 106002 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 106001 catgcatgcatgcatgcatgc 105981 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 105997 catgcatgcatgcatgcatg 105978
>gb|AC164641.5| Mus musculus BAC clone RP23-393F10 from chromosome 12, complete sequence Length = 198725 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 175110 ttcatgcatgcatgcatgcatgc 175088 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 175085 catgcatgcatgcatgcatgc 175105 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 175104 catgcatgcatgcatgcatgc 175084 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 175089 catgcatgcatgcatgcatg 175108
>gb|AC093366.9| Mus musculus chromosome 8, clone RP23-60P23, complete sequence Length = 230236 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgctgc 249 ||||||||||||||||||||||| Sbjct: 55336 atgcatgcatgcatgcatgctgc 55314
>gb|AC123053.4| Mus musculus BAC clone RP24-374O20 from chromosome 7, complete sequence Length = 184618 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 176520 ttcatgcatgcatgcatgcatgc 176542 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 176544 atgcatgcatgcatgcatgc 176525 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 176541 catgcatgcatgcatgcatg 176522
>gb|AC146569.5| Medicago truncatula clone mth2-102a8, complete sequence Length = 127803 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgct 247 ||||||||||||||||||||||| Sbjct: 117823 tcatgcatgcatgcatgcatgct 117801 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 117803 catgcatgcatgcatgcatg 117822
>gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosome 12, complete sequence Length = 197795 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 193541 ttcatgcatgcatgcatgcatgc 193563 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 193547 catgcatgcatgcatgcatgc 193567 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 193566 catgcatgcatgcatgcatgc 193546 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 193562 catgcatgcatgcatgcatg 193543
>emb|BX571770.5| Zebrafish DNA sequence from clone DKEY-276I5 in linkage group 24, complete sequence Length = 210504 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatg 245 ||||||||||||||||||||||| Sbjct: 202874 attcatgcatgcatgcatgcatg 202896 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 202896 catgcatgcatgcatgcatg 202877
>gb|AC159811.2| Mus musculus BAC clone RP24-127J13 from chromosome 9, complete sequence Length = 134895 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 32193 ttcatgcatgcatgcatgcatgc 32171 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 32172 catgcatgcatgcatgcatg 32191 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 32169 atgcatgcatgcatgcatgc 32188
>gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F5, complete sequence Length = 103115 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 21215 ttcatgcatgcatgcatgcatgc 21193 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 21194 catgcatgcatgcatgcatg 21213 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 21191 atgcatgcatgcatgcatgc 21210
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Plus Query: 219 gaagattcatgcatgcatgcatgcatg 245 |||||| |||||||||||||||||||| Sbjct: 33527585 gaagatgcatgcatgcatgcatgcatg 33527611 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 33527612 tcatgcatgcatgcatgcatgc 33527591 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 22806396 tcatgcatgcatgcatgcatgc 22806417 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 24837011 tcatgcatgcatgcatgcatg 24837031 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgct 247 ||||||||||||||||||||| Sbjct: 16570659 atgcatgcatgcatgcatgct 16570639 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcat 244 ||||||||||||||||||||| Sbjct: 4056783 ttcatgcatgcatgcatgcat 4056803 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgct 247 ||||||||||||||||||||| Sbjct: 5015 atgcatgcatgcatgcatgct 4995 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 33527589 atgcatgcatgcatgcatgc 33527608 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 28680428 atgcatgcatgcatgcatgc 28680447 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 24837031 catgcatgcatgcatgcatg 24837012 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 22806419 atgcatgcatgcatgcatgc 22806400 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 22806416 catgcatgcatgcatgcatg 22806397 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 10124125 catgcatgcatgcatgcatg 10124106 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 10124106 catgcatgcatgcatgcatg 10124125
>gb|AC157998.2| Mus musculus BAC clone RP23-27L18 from chromosome 9, complete sequence Length = 253762 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 14750 ttcatgcatgcatgcatgcatgc 14772 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 14774 atgcatgcatgcatgcatgc 14755 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 14771 catgcatgcatgcatgcatg 14752
>gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, complete sequence Length = 228068 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgctg 248 ||||||||||||||||||||||| Sbjct: 125312 catgcatgcatgcatgcatgctg 125290 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 125293 catgcatgcatgcatgcatgc 125313
>dbj|AP005535.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0054K20 Length = 153584 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Plus Query: 219 gaagattcatgcatgcatgcatgcatg 245 |||||| |||||||||||||||||||| Sbjct: 102460 gaagatgcatgcatgcatgcatgcatg 102486 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 102487 tcatgcatgcatgcatgcatgc 102466 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 102464 atgcatgcatgcatgcatgc 102483
>gb|AC154489.2| Mus musculus BAC clone RP23-205G15 from chromosome 14, complete sequence Length = 210483 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgct 247 ||||||||||||||||||||||| Sbjct: 77945 tcatgcatgcatgcatgcatgct 77923 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 77925 catgcatgcatgcatgcatg 77944
>gb|AC149062.3| Mus musculus BAC clone RP23-183E20 from 7, complete sequence Length = 229956 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatgc 246 ||||||||||||||||||||||| Sbjct: 90408 ttcatgcatgcatgcatgcatgc 90430 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 90432 atgcatgcatgcatgcatgc 90413 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 90429 catgcatgcatgcatgcatg 90410
>emb|AL670231.7| Mouse DNA sequence from clone RP23-329G7 on chromosome 4, complete sequence Length = 229957 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatg 245 ||||||||||||||||||||||| Sbjct: 110419 attcatgcatgcatgcatgcatg 110441 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 110441 catgcatgcatgcatgcatg 110422
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 26835 catgcatgcatgcatgcatgct 26856 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26854 catgcatgcatgcatgcatgc 26834 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26831 catgcatgcatgcatgcatgc 26851 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26850 catgcatgcatgcatgcatgc 26830 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26827 catgcatgcatgcatgcatgc 26847 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26846 catgcatgcatgcatgcatgc 26826 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26823 catgcatgcatgcatgcatgc 26843 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26842 catgcatgcatgcatgcatgc 26822 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 26820 atgcatgcatgcatgcatgc 26839 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 26575 catgcatgcatgcatgcatg 26594 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 26594 catgcatgcatgcatgcatg 26575
>gb|AC153581.18| Mus musculus 6 BAC RP23-111F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 208262 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 82306 attcatgcatgcatgcatgcat 82327
>gb|AC151761.1| Ornithorhynchus anatinus chromosome UNK clone OABb-434P24, complete sequence Length = 134595 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 116298 attcatgcatgcatgcatgcat 116277
>gb|AC154555.3| Mus musculus BAC clone RP23-418L12 from chromosome 16, complete sequence Length = 192614 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 74973 catgcatgcatgcatgcatgct 74952 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 74954 catgcatgcatgcatgcatg 74973
>gb|AY024015.1| Oryza sativa microsatellite MRG6340 containing (CATG)X8, closest to marker L131, genomic sequence Length = 232 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 100 tcatgcatgcatgcatgcatgc 121 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 132 catgcatgcatgcatgcatgc 112 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 109 catgcatgcatgcatgcatgc 129 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 128 catgcatgcatgcatgcatgc 108 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 105 catgcatgcatgcatgcatgc 125 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124 catgcatgcatgcatgcatgc 104 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 113 catgcatgcatgcatgcatg 132 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 120 catgcatgcatgcatgcatg 101
>gb|AC005737.1| Homo sapiens chromosome 16, BAC clone 97H22 (LANL), complete sequence Length = 174098 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 63676 tcatgcatgcatgcatgcatgc 63697 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 63696 catgcatgcatgcatgcatg 63677
>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence Length = 181369 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 caggaggggcggctggagatgg 365 |||||||||||||||||||||| Sbjct: 174146 caggaggggcggctggagatgg 174125
>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete sequence Length = 210128 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatg 245 |||||||||||||||||||||| Sbjct: 136153 ttcatgcatgcatgcatgcatg 136174 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 64912 catgcatgcatgcatgcatgct 64891 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 64901 catgcatgcatgcatgcatgc 64921 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 64920 catgcatgcatgcatgcatgc 64900 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 64897 catgcatgcatgcatgcatgc 64917 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 64916 catgcatgcatgcatgcatgc 64896 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 64893 catgcatgcatgcatgcatgc 64913 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 136174 catgcatgcatgcatgcatg 136155 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 64923 atgcatgcatgcatgcatgc 64904 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 ||||| |||||||||||||||||| Sbjct: 64886 attcaagcatgcatgcatgcatgc 64909
>gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence Length = 204120 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 228 tgcatgcatgcatgcatgctgc 249 |||||||||||||||||||||| Sbjct: 196251 tgcatgcatgcatgcatgctgc 196230
>gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, complete sequence Length = 240657 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 190627 attcatgcatgcatgcatgcat 190606
>gb|AC135809.4| Mus musculus BAC clone RP23-353F16 from chromosome 7, complete sequence Length = 195041 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 152878 catgcatgcatgcatgcatgct 152899 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 152897 catgcatgcatgcatgcatg 152878
>gb|AC134546.4| Mus musculus BAC clone RP24-471H17 from chromosome 18, complete sequence Length = 208921 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 91643 attcatgcatgcatgcatgcat 91622
>gb|AC120418.10| Mus musculus chromosome 6, clone RP24-474I24, complete sequence Length = 177307 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 123119 attcatgcatgcatgcatgcat 123098
>gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome 12, complete sequence Length = 219729 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 89577 attcatgcatgcatgcatgcat 89556
>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence Length = 182376 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 221 agattcatgcatgcatgcatgcatgc 246 |||| ||||||||||||||||||||| Sbjct: 174177 agatacatgcatgcatgcatgcatgc 174202 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 174204 atgcatgcatgcatgcatgc 174185 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 174201 catgcatgcatgcatgcatg 174182
>gb|AC161442.5| Mus musculus chromosome 5, clone RP23-384P12, complete sequence Length = 174557 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 55629 attcatgcatgcatgcatgcat 55608
>gb|AC155823.8| Mus musculus BAC clone RP23-348C5 from chromosome 8, complete sequence Length = 219597 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 173995 catgcatgcatgcatgcatgct 173974 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 173976 catgcatgcatgcatgcatgc 173996
>gb|AC158612.7| Mus musculus 10 BAC RP23-39I3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206234 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 91453 catgcatgcatgcatgcatgct 91474 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 91472 catgcatgcatgcatgcatgc 91452 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 91450 atgcatgcatgcatgcatgc 91469
>gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, complete sequence Length = 204704 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgcatgc 246 |||| ||||||||||||||||||||| Sbjct: 126224 agatgcatgcatgcatgcatgcatgc 126199 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 126200 catgcatgcatgcatgcatgc 126220 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 126197 atgcatgcatgcatgcatgc 126216 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 126141 atgcatgcatgcatgcatgc 126122 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgcat 244 |||| ||||||||||||||||||| Sbjct: 126143 agatgcatgcatgcatgcatgcat 126120 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 126120 atgcatgcatgcatgcatgc 126139
>gb|AY525126.1| Homo sapiens signal transducer and activator of transcription 2, 113kDa (STAT2) gene, complete cds Length = 22461 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgctg 248 |||||||||||||||||||||| Sbjct: 9468 atgcatgcatgcatgcatgctg 9447
>gb|AC139939.6| Mus musculus chromosome 1, clone RP23-458O23, complete sequence Length = 175033 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 101164 attcatgcatgcatgcatgcat 101185
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 143440 catgcatgcatgcatgcatgct 143461 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143459 catgcatgcatgcatgcatgc 143439 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143436 catgcatgcatgcatgcatgc 143456 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143455 catgcatgcatgcatgcatgc 143435 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143432 catgcatgcatgcatgcatgc 143452 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143451 catgcatgcatgcatgcatgc 143431 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143428 catgcatgcatgcatgcatgc 143448 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 143447 catgcatgcatgcatgcatgc 143427 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 143425 atgcatgcatgcatgcatgc 143444 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 143184 catgcatgcatgcatgcatg 143203 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 143203 catgcatgcatgcatgcatg 143184
>emb|AJ438040.1|TCH438040 Tetraselmis chui DNA containing repeats, strain CCAP 8/6 Length = 903 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 302 tcatgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 326 catgcatgcatgcatgcatgc 306 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 307 catgcatgcatgcatgcatg 326 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 322 catgcatgcatgcatgcatg 303
>gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, complete sequence Length = 191116 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 59205 attcatgcatgcatgcatgcat 59184
>gb|AC124683.3| Mus musculus BAC clone RP24-349E11 from chromosome 6, complete sequence Length = 168179 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 221 agattcatgcatgcatgcatgcatgc 246 |||| ||||||||||||||||||||| Sbjct: 84603 agatgcatgcatgcatgcatgcatgc 84628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 84627 catgcatgcatgcatgcatgc 84607 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 84630 atgcatgcatgcatgcatgc 84611
>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete sequence Length = 168423 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 221 agattcatgcatgcatgcatgcatgc 246 |||| ||||||||||||||||||||| Sbjct: 13158 agatgcatgcatgcatgcatgcatgc 13183 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 13182 catgcatgcatgcatgcatgc 13162 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13262 atgcatgcatgcatgcatgc 13243 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13241 atgcatgcatgcatgcatgc 13260 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 221 agattcatgcatgcatgcatgcat 244 |||| ||||||||||||||||||| Sbjct: 13239 agatgcatgcatgcatgcatgcat 13262 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 13185 atgcatgcatgcatgcatgc 13166
>gb|AC124187.3| Mus musculus BAC clone RP23-237I24 from 18, complete sequence Length = 172828 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 229 gcatgcatgcatgcatgctgcc 250 |||||||||||||||||||||| Sbjct: 131436 gcatgcatgcatgcatgctgcc 131457
>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete sequence Length = 164705 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 220 aagattcatgcatgcatgcatgcatg 245 ||||| |||||||||||||||||||| Sbjct: 153643 aagatgcatgcatgcatgcatgcatg 153668 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 153668 catgcatgcatgcatgcatgc 153648 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 153646 atgcatgcatgcatgcatgc 153665
>gb|AC117596.6| Mus musculus chromosome 6, clone RP23-392K24, complete sequence Length = 233811 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 223385 catgcatgcatgcatgcatgct 223406 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 223404 catgcatgcatgcatgcatgc 223384 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 223381 catgcatgcatgcatgcatgc 223401 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 223400 catgcatgcatgcatgcatgc 223380 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 223377 catgcatgcatgcatgcatgc 223397 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 223396 catgcatgcatgcatgcatg 223377
>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence Length = 192819 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 184884 tcatgcatgcatgcatgcatgc 184863 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 184860 catgcatgcatgcatgcatgc 184880 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 184879 catgcatgcatgcatgcatgc 184859 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 184864 catgcatgcatgcatgcatg 184883
>gb|AC164425.3| Mus musculus BAC clone RP24-497H13 from chromosome 16, complete sequence Length = 162603 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 18743 catgcatgcatgcatgcatgct 18764 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 18762 catgcatgcatgcatgcatg 18743
>gb|AC108436.5| Mus musculus chromosome 8, clone RP23-230G11, complete sequence Length = 185534 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 177823 attcatgcatgcatgcatgcat 177802 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 177827 attcattcatgcatgcatgcatgc 177804
>emb|AL589745.8| Human DNA sequence from clone RP11-478K15 on chromosome 13 Contains parts of four novel genes, the 5' end of a novel gene and a CpG island, complete sequence Length = 170765 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 130577 attcatgcatgcatgcatgcat 130556 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 222 gattcatgcatgcatgcatgcatgc 246 ||||||| ||||||||||||||||| Sbjct: 130582 gattcattcatgcatgcatgcatgc 130558
>emb|AL356858.19| Human DNA sequence from clone RP11-357K9 on chromosome Xp11.4-21.2 Contains the PRRG1 gene for proline-rich Gla (G-carboxyglutamic acid) polypetide 1, a ferritin heavy polypeptide-like 17 (FTHL17) pseudogene and a CpG island, complete sequence Length = 128968 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 100235 attcatgcatgcatgcatgcat 100256 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 100231 attcattcatgcatgcatgcatgc 100254
>gb|AC026231.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-114F4, complete sequence Length = 208199 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 135066 tcatgcatgcatgcatgcatgc 135045 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 135046 catgcatgcatgcatgcatg 135065
>emb|AL162379.14| Human DNA sequence from clone RP11-426K7 on chromosome 13 Contains part of a novel gene, complete sequence Length = 109757 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 39263 attcatgcatgcatgcatgcat 39242 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 222 gattcatgcatgcatgcatgcatgc 246 ||||||| ||||||||||||||||| Sbjct: 39268 gattcattcatgcatgcatgcatgc 39244
>gb|AC108850.3| Mus musculus chromosome 1, clone RP24-85N11, complete sequence Length = 194889 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 36283 attcatgcatgcatgcatgcat 36304
>gb|AC120241.5| Rattus norvegicus X BAC CH230-390I1 (Children's Hospital Oakland Research Institute) complete sequence Length = 174991 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 2298 tcatgcatgcatgcatgcatgc 2277 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 2278 catgcatgcatgcatgcatg 2297
>emb|AL008715.1|HS1216H12 Human DNA sequence from clone CTC-1216H12 on chromosome 22, complete sequence Length = 101817 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 88897 attcatgcatgcatgcatgcat 88918 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 88893 attcattcatgcatgcatgcatgc 88916
>emb|CR354557.9| Zebrafish DNA sequence from clone DKEY-34I7 in linkage group 23, complete sequence Length = 127420 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgcatgc 246 |||| ||||||||||||||||||||| Sbjct: 86137 agatgcatgcatgcatgcatgcatgc 86112 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 86113 catgcatgcatgcatgcatgc 86133 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 86109 catgcatgcatgcatgcatgc 86129 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 86128 catgcatgcatgcatgcatgc 86108 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 86106 atgcatgcatgcatgcatgc 86125
>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete sequence Length = 189457 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 4910 tcatgcatgcatgcatgcatgc 4889 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 4886 catgcatgcatgcatgcatgc 4906 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 4905 catgcatgcatgcatgcatgc 4885 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 4890 catgcatgcatgcatgcatg 4909
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 169479 attcatgcatgcatgcatgcat 169458
>emb|AJ318464.1|MMU318464 Mus musculus Rpgr gene for retinitis pigmentosa GTPase regulator, exons 1-19 Length = 109632 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 88687 attcatgcatgcatgcatgcat 88708
>emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in linkage group 5, complete sequence Length = 156095 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 4181 attcatgcatgcatgcatgcat 4202 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 4177 attcattcatgcatgcatgcatgc 4200
>emb|BX571792.9| Zebrafish DNA sequence from clone CH211-177D9 in linkage group 12, complete sequence Length = 141671 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 42230 catgcatgcatgcatgcatgct 42251 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 42249 catgcatgcatgcatgcatgc 42229 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 42227 atgcatgcatgcatgcatgc 42246
>gb|AC109445.3| Homo sapiens chromosome 5 clone CTD-2351A8, complete sequence Length = 135875 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 94282 catgcatgcatgcatgcatgct 94303 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 94301 catgcatgcatgcatgcatgc 94281
>gb|AC097537.2| Homo sapiens BAC clone RP11-806K15 from 4, complete sequence Length = 138574 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 39706 attcatgcatgcatgcatgcat 39685
>gb|AC137589.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0072L08, complete sequence Length = 152272 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 110785 tcatgcatgcatgcatgcatgc 110764 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 110765 catgcatgcatgcatgcatg 110784
>gb|AC144558.1| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0072L08, sequencing in progress, complete sequence Length = 152272 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 110785 tcatgcatgcatgcatgcatgc 110764 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 110765 catgcatgcatgcatgcatg 110784
>gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosome 12, complete sequence Length = 191808 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 17017 attcatgcatgcatgcatgcat 16996
>emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 in linkage group 21, complete sequence Length = 191281 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 2136 attcatgcatgcatgcatgcat 2115
>gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome 1, complete sequence Length = 223534 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 99443 attcatgcatgcatgcatgcat 99422
>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180996 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 17930 catgcatgcatgcatgcatgct 17951 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17949 catgcatgcatgcatgcatgc 17929 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17926 catgcatgcatgcatgcatgc 17946 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17945 catgcatgcatgcatgcatgc 17925 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17922 catgcatgcatgcatgcatgc 17942 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17941 catgcatgcatgcatgcatgc 17921 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17918 catgcatgcatgcatgcatgc 17938 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17937 catgcatgcatgcatgcatgc 17917
>emb|BX005236.16| Mouse DNA sequence from clone RP23-254A23 on chromosome X, complete sequence Length = 122633 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 119386 attcatgcatgcatgcatgcat 119365
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 24133175 attcatgcatgcatgcatgcat 24133154 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 21501439 catgcatgcatgcatgcatgct 21501460 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 21501458 catgcatgcatgcatgcatgc 21501438 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 228 tgcatgcatgcatgcatgctg 248 ||||||||||||||||||||| Sbjct: 17640165 tgcatgcatgcatgcatgctg 17640185 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 1149021 tcatgcatgcatgcatgcatg 1149001 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 1149000 tcatgcatgcatgcatgcatg 1149020 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgc 249 |||||||||||||||||||| Sbjct: 23594672 catgcatgcatgcatgctgc 23594653 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgc 242 |||||||||||||||||||| Sbjct: 21858112 attcatgcatgcatgcatgc 21858131 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 20033314 atgcatgcatgcatgcatgc 20033295 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 20033293 atgcatgcatgcatgcatgc 20033312 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 16581435 tcatgcatgcatgcatgcat 16581416
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 21108470 tcatgcatgcatgcatgcatgc 21108449 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26702626 catgcatgcatgcatgcatgc 26702606 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 26702603 catgcatgcatgcatgcatgc 26702623 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 26702607 catgcatgcatgcatgcatg 26702626 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 26702622 catgcatgcatgcatgcatg 26702603 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgc 242 |||||||||||||||||||| Sbjct: 25088432 attcatgcatgcatgcatgc 25088413 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 22733973 atgcatgcatgcatgcatgc 22733954 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 21108450 catgcatgcatgcatgcatg 21108469 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 15917284 atgcatgcatgcatgcatgc 15917303 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 14496812 atgcatgcatgcatgcatgc 14496793 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 14496791 atgcatgcatgcatgcatgc 14496810 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 6481793 atgcatgcatgcatgcatgc 6481812
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 16066357 tcatgcatgcatgcatgcatgc 16066378 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 2564518 catgcatgcatgcatgcatgc 2564498 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 2564495 catgcatgcatgcatgcatgc 2564515 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 2564514 catgcatgcatgcatgcatgc 2564494 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 2564491 catgcatgcatgcatgcatgc 2564511 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 16066377 catgcatgcatgcatgcatg 16066358 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 2564499 catgcatgcatgcatgcatg 2564518 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 2564510 catgcatgcatgcatgcatg 2564491
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgc 242 |||||||||||||||||||||| Sbjct: 916044 agattcatgcatgcatgcatgc 916023 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 220 aagattcatgcatgcatgcatgca 243 ||||||| |||||||||||||||| Sbjct: 10853478 aagattcgtgcatgcatgcatgca 10853501 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 3135562 tcatgcatgcatgcatgcat 3135543 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 3090728 tcatgcatgcatgcatgcat 3090709 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 3045484 tcatgcatgcatgcatgcat 3045465
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 22326323 tcatgcatgcatgcatgcatgc 22326344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatg 241 ||||||||||||||||||||| Sbjct: 26243299 agattcatgcatgcatgcatg 26243279 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22326355 catgcatgcatgcatgcatgc 22326335 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22326332 catgcatgcatgcatgcatgc 22326352 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22326351 catgcatgcatgcatgcatgc 22326331 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22326328 catgcatgcatgcatgcatgc 22326348 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22326347 catgcatgcatgcatgcatgc 22326327 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 21034523 tcatgcatgcatgcatgcatg 21034503 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 21034502 tcatgcatgcatgcatgcatg 21034522 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 4285518 catgcatgcatgcatgcatgc 4285498 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgc 242 |||||||||||||||||||| Sbjct: 27804335 attcatgcatgcatgcatgc 27804354 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 22326336 catgcatgcatgcatgcatg 22326355 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 22326343 catgcatgcatgcatgcatg 22326324 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 tgcatgcatgcatgcatgct 247 |||||||||||||||||||| Sbjct: 7774287 tgcatgcatgcatgcatgct 7774306 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 4285499 catgcatgcatgcatgcatg 4285518
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 3374656 tcatgcatgcatgcatgcatgc 3374677 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 40749592 catgcatgcatgcatgcatgc 40749612 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 40749611 catgcatgcatgcatgcatgc 40749591 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33279917 catgcatgcatgcatgcatgc 33279937 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 33279936 catgcatgcatgcatgcatgc 33279916 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgca 243 ||||||||||||||||||||| Sbjct: 4001195 attcatgcatgcatgcatgca 4001215 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 40749589 atgcatgcatgcatgcatgc 40749608 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 33830442 atgcatgcatgcatgcatgc 33830461 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 28180589 tcatgcatgcatgcatgcat 28180570 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 25999374 atgcatgcatgcatgcatgc 25999355 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 tgcatgcatgcatgcatgct 247 |||||||||||||||||||| Sbjct: 16359502 tgcatgcatgcatgcatgct 16359521 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 ||||||||||| |||||||||||| Sbjct: 7705303 attcatgcatgtatgcatgcatgc 7705326 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 4001191 attcattcatgcatgcatgcatgc 4001214 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3374676 catgcatgcatgcatgcatg 3374657 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3171389 catgcatgcatgcatgcatg 3171370 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3171370 catgcatgcatgcatgcatg 3171389 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3155577 catgcatgcatgcatgcatg 3155558 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 3155558 catgcatgcatgcatgcatg 3155577
>gb|AC007433.16|AC007433 Mus musculus chromosome 10, clone RP21-340M5, complete sequence Length = 125105 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 111825 catgcatgcatgcatgcatgct 111804 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 111806 catgcatgcatgcatgcatgc 111826 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 111828 atgcatgcatgcatgcatgc 111809
>gb|AC087799.43| Mus musculus strain C57BL/6J chromosome 16 clone rp23-198m10, complete sequence Length = 208011 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 154075 catgcatgcatgcatgcatgct 154096 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 154094 catgcatgcatgcatgcatg 154075
>gb|AC010432.6|AC010432 Homo sapiens chromosome 5 clone CTD-2202A17, complete sequence Length = 148697 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 120138 catgcatgcatgcatgcatgct 120117 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 120119 catgcatgcatgcatgcatgc 120139
>gb|AC025574.19| Homo sapiens 12 BAC RP11-348M3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 60153 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgctg 248 |||||||||||||||||||||| Sbjct: 39323 atgcatgcatgcatgcatgctg 39302
>gb|AC111186.11| Homo sapiens chromosome 17, clone RP11-1112G13, complete sequence Length = 145601 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 141683 attcatgcatgcatgcatgcat 141662 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 141687 attcattcatgcatgcatgcatgc 141664
>gb|AC087651.19| Homo sapiens chromosome 17, clone RP11-309N17, complete sequence Length = 197148 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 121358 attcatgcatgcatgcatgcat 121379 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 121354 attcattcatgcatgcatgcatgc 121377
>gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 168396 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 113453 attcatgcatgcatgcatgcat 113432 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 113457 attcattcatgcatgcatgcatgc 113434
>dbj|AP003810.6| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1119_A04 Length = 128906 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 221 agattcatgcatgcatgcatgc 242 |||||||||||||||||||||| Sbjct: 20391 agattcatgcatgcatgcatgc 20370
>dbj|AP004375.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0475C12 Length = 140863 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 138396 tcatgcatgcatgcatgcatgc 138417 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 138416 catgcatgcatgcatgcatg 138397
>emb|AL929073.19| Mouse DNA sequence from clone RP23-125D6 on chromosome 4, complete sequence Length = 129246 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 97963 attcatgcatgcatgcatgcat 97942
>dbj|AP003630.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0566A10 Length = 174367 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 104746 tcatgcatgcatgcatgcatgc 104767 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104778 catgcatgcatgcatgcatgc 104758 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104755 catgcatgcatgcatgcatgc 104775 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104774 catgcatgcatgcatgcatgc 104754 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104751 catgcatgcatgcatgcatgc 104771 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 104770 catgcatgcatgcatgcatgc 104750 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 104759 catgcatgcatgcatgcatg 104778 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 104766 catgcatgcatgcatgcatg 104747
>dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0701D05 Length = 172161 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 53026 tcatgcatgcatgcatgcatgc 53047 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 53046 catgcatgcatgcatgcatg 53027
>emb|BX000522.11| Zebrafish DNA sequence from clone CH211-146K11, complete sequence Length = 175406 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 131932 attcatgcatgcatgcatgcat 131953 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 131928 attcattcatgcatgcatgcatgc 131951
>emb|AL831780.12| Mouse DNA sequence from clone RP23-394B8 on chromosome 2, complete sequence Length = 173444 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 13165 attcatgcatgcatgcatgcat 13186
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0006O15 Length = 139723 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 39734 tcatgcatgcatgcatgcatgc 39755 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 39757 atgcatgcatgcatgcatgc 39738 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 39754 catgcatgcatgcatgcatg 39735
>dbj|AP005726.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0028A18 Length = 151080 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 4437 tcatgcatgcatgcatgcatgc 4458 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 4457 catgcatgcatgcatgcatg 4438
>gb|AC121513.15| Mus musculus chromosome 18, clone RP24-391B9, complete sequence Length = 160247 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 229 gcatgcatgcatgcatgctgcc 250 |||||||||||||||||||||| Sbjct: 123109 gcatgcatgcatgcatgctgcc 123088
>gb|AC147616.3| Mus musculus BAC clone RP23-433L22 from 8, complete sequence Length = 182152 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 164571 attcatgcatgcatgcatgcat 164592 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 164567 attcattcatgcatgcatgcatgc 164590
>gb|AC116817.9| Mus musculus chromosome 1, clone RP24-357I7, complete sequence Length = 186439 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 141823 tcatgcatgcatgcatgcatgc 141844 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 141846 atgcatgcatgcatgcatgc 141827 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 141843 catgcatgcatgcatgcatg 141824
>gb|AC091272.12| Mus musculus chromosome 1, clone RP23-74B7, complete sequence Length = 252476 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 168781 tcatgcatgcatgcatgcatgc 168760 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 168761 catgcatgcatgcatgcatg 168780
>gb|AC120132.11| Mus musculus chromosome 6, clone RP23-105D1, complete sequence Length = 203185 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 188189 attcatgcatgcatgcatgcat 188210
>gb|AC167016.5| Mus musculus chromosome 3, clone RP23-76C12, complete sequence Length = 225524 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 187540 attcatgcatgcatgcatgcat 187519
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 21418711 tcatgcatgcatgcatgcatgc 21418690 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 27027689 catgcatgcatgcatgcatgc 27027669 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 27027666 catgcatgcatgcatgcatgc 27027686 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 27027670 catgcatgcatgcatgcatg 27027689 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 27027685 catgcatgcatgcatgcatg 27027666 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgc 242 |||||||||||||||||||| Sbjct: 25399451 attcatgcatgcatgcatgc 25399432 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 23043884 atgcatgcatgcatgcatgc 23043865 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 21418691 catgcatgcatgcatgcatg 21418710 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 16004660 atgcatgcatgcatgcatgc 16004679 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 14578813 atgcatgcatgcatgcatgc 14578794 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 14578792 atgcatgcatgcatgcatgc 14578811 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 6548260 atgcatgcatgcatgcatgc 6548279
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 24061381 attcatgcatgcatgcatgcat 24061360 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 21429760 catgcatgcatgcatgcatgct 21429781 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 21429779 catgcatgcatgcatgcatgc 21429759 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 228 tgcatgcatgcatgcatgctg 248 ||||||||||||||||||||| Sbjct: 17594536 tgcatgcatgcatgcatgctg 17594556 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 1149021 tcatgcatgcatgcatgcatg 1149001 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatg 245 ||||||||||||||||||||| Sbjct: 1149000 tcatgcatgcatgcatgcatg 1149020 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 catgcatgcatgcatgctgc 249 |||||||||||||||||||| Sbjct: 23522863 catgcatgcatgcatgctgc 23522844 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgc 242 |||||||||||||||||||| Sbjct: 21786457 attcatgcatgcatgcatgc 21786476 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 19959528 atgcatgcatgcatgcatgc 19959509 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 19959507 atgcatgcatgcatgcatgc 19959526 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcat 244 |||||||||||||||||||| Sbjct: 16534668 tcatgcatgcatgcatgcat 16534649
>emb|AL772426.5|CNS08CA4 Oryza sativa chromosome 12, . BAC OJ1310_C03 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 132733 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 17866 attcatgcatgcatgcatgcat 17845
>emb|AL772319.13| Mouse DNA sequence from clone RP23-397E2 on chromosome 4, complete sequence Length = 206709 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 23001 catgcatgcatgcatgcatgct 22980 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 22982 catgcatgcatgcatgcatg 23001
>emb|AL805955.26| Mouse DNA sequence from clone RP23-192A6 on chromosome 2, complete sequence Length = 182439 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 179945 catgcatgcatgcatgcatgct 179924 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 179926 catgcatgcatgcatgcatgc 179946 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 179948 atgcatgcatgcatgcatgc 179929
>emb|AL844497.4|CNS08CAU Oryza sativa chromosome 12, . BAC OSJNBa0085B23 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 158019 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 144450 catgcatgcatgcatgcatgct 144429 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 144431 catgcatgcatgcatgcatgc 144451
>emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chromosome 11 Contains the 3' end of the Msi2h gene for Musashi homolog 2 (Drosophila), an eukaryotic translation elongation factor 2 (Eef2) pseudogene and a ribosomal protein L35a (Rpl35a) pseudogene, complete sequence Length = 216688 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 165298 catgcatgcatgcatgcatgct 165277 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 165283 catgcatgcatgcatgcatgc 165303 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 165302 catgcatgcatgcatgcatgc 165282 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 165279 catgcatgcatgcatgcatgc 165299
>emb|AL611983.23| Mouse DNA sequence from clone RP23-467J23 on chromosome 4, complete sequence Length = 153955 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 55212 attcatgcatgcatgcatgcat 55191
>gb|AC140327.3| Mus musculus BAC clone RP24-325P20 from 6, complete sequence Length = 154692 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 228 tgcatgcatgcatgcatgctgc 249 |||||||||||||||||||||| Sbjct: 105703 tgcatgcatgcatgcatgctgc 105724
>gb|AC122444.4| Mus musculus BAC clone RP24-232I9 from 9, complete sequence Length = 184253 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 120517 attcatgcatgcatgcatgcat 120496
>gb|AC154234.1| Mus musculus BAC clone RP24-345H5 from 16, complete sequence Length = 161505 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcatg 245 |||||||||||||||||||||| Sbjct: 113699 ttcatgcatgcatgcatgcatg 113720 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 113720 catgcatgcatgcatgcatg 113701
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence Length = 180886 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 89476 attcatgcatgcatgcatgcat 89497 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 89472 attcattcatgcatgcatgcatgc 89495
>gb|AC153998.2| Mus musculus 6 BAC RP24-278I6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 166019 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 14073 attcatgcatgcatgcatgcat 14094
>gb|AC139846.4| Mus musculus BAC clone RP23-385F3 from 8, complete sequence Length = 191571 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 36341 attcatgcatgcatgcatgcat 36362 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 36337 attcattcatgcatgcatgcatgc 36360
>gb|AC140415.3| Mus musculus BAC clone RP23-127A20 from 13, complete sequence Length = 221245 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcatg 245 |||||||||||||||||||||| Sbjct: 177863 ttcatgcatgcatgcatgcatg 177842 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 177842 catgcatgcatgcatgcatg 177861
>emb|AL954325.8| Mouse DNA sequence from clone RP23-416H10 on chromosome 2, complete sequence Length = 195457 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 66473 tcatgcatgcatgcatgcatgc 66452 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 66449 catgcatgcatgcatgcatgc 66469 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 66468 catgcatgcatgcatgcatgc 66448 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 66453 catgcatgcatgcatgcatg 66472
>emb|CR956393.14| Pig DNA sequence from clone CH242-163M14 on chromosome 17, complete sequence Length = 195684 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 95693 tcatgcatgcatgcatgcatgc 95672 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 95669 catgcatgcatgcatgcatgc 95689 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 95688 catgcatgcatgcatgcatgc 95668 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 95673 catgcatgcatgcatgcatg 95692 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 95666 atgcatgcatgcatgcatgc 95685
>gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete sequence Length = 197831 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 124600 catgcatgcatgcatgcatgct 124579 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124593 catgcatgcatgcatgcatgc 124613 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124612 catgcatgcatgcatgcatgc 124592 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124589 catgcatgcatgcatgcatgc 124609 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124608 catgcatgcatgcatgcatgc 124588 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124585 catgcatgcatgcatgcatgc 124605 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124604 catgcatgcatgcatgcatgc 124584 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124581 catgcatgcatgcatgcatgc 124601
>gb|U18671.1|HSU18671 Human Stat2 gene, complete cds Length = 18648 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgctg 248 |||||||||||||||||||||| Sbjct: 8302 atgcatgcatgcatgcatgctg 8281
>gb|AC151918.2| Phaeodactylum tricornutum clone JGIAHOK-13P10, complete sequence Length = 37061 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 16425 attcatgcatgcatgcatgcat 16446
>gb|AC132909.14| Mus musculus chromosome 1, clone RP24-298H1, complete sequence Length = 185140 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 148181 catgcatgcatgcatgcatgct 148202 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 148200 catgcatgcatgcatgcatgc 148180 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 148178 atgcatgcatgcatgcatgc 148197
>emb|AL928653.4| Mouse DNA sequence from clone RP23-410F9 on chromosome 2, complete sequence Length = 72045 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgct 247 |||||||||||||||||||||| Sbjct: 7193 catgcatgcatgcatgcatgct 7214 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 7212 catgcatgcatgcatgcatg 7193
>emb|AL627184.18| Mouse DNA sequence from clone RP23-125F21 on chromosome 4, complete sequence Length = 152069 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 225 tcatgcatgcatgcatgcatgc 246 |||||||||||||||||||||| Sbjct: 43489 tcatgcatgcatgcatgcatgc 43510 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 43512 atgcatgcatgcatgcatgc 43493 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 43509 catgcatgcatgcatgcatg 43490
>emb|AL807755.7| Mouse DNA sequence from clone RP23-394N20 on chromosome X, complete sequence Length = 203068 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 74753 attcatgcatgcatgcatgcat 74732
>emb|AL691419.10| Mouse DNA sequence from clone RP23-95I4 on chromosome 3, complete sequence Length = 249405 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcat 244 |||||||||||||||||||||| Sbjct: 158182 attcatgcatgcatgcatgcat 158203 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 158178 attcattcatgcatgcatgcatgc 158201
>gb|BC039085.1| Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 11, mRNA (cDNA clone IMAGE:3850196), complete cds Length = 4106 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcat 244 ||||||||||||||||||||| Sbjct: 4085 ttcatgcatgcatgcatgcat 4065
>gb|AC153802.1| Mus musculus 6 NOVECTOR RP24-79H20 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 189471 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 99675 catgcatgcatgcatgcatgc 99695 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 99694 catgcatgcatgcatgcatgc 99674
>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence Length = 216364 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 59400 catgcatgcatgcatgcatgc 59420 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 59419 catgcatgcatgcatgcatgc 59399 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 59396 catgcatgcatgcatgcatgc 59416 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 59415 catgcatgcatgcatgcatgc 59395 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 59392 catgcatgcatgcatgcatgc 59412 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 59422 atgcatgcatgcatgcatgc 59403 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 59411 catgcatgcatgcatgcatg 59392
>gb|AY779455.1| Eimeria maxima clone USDA-EM-6-8 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779452.1| Eimeria maxima clone USDA-EM-6-47 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779451.1| Eimeria maxima clone USDA-EM-6-40 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779450.1| Eimeria maxima clone USDA-EM-6-39 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779448.1| Eimeria maxima clone USDA-EM-6-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779447.1| Eimeria maxima clone USDA-EM-6-35 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779445.1| Eimeria maxima clone USDA-EM-6-31 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 302 catgcatgcatgcatgcatgc 322 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 321 catgcatgcatgcatgcatgc 301
>gb|AY779444.1| Eimeria maxima clone USDA-EM-6-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 310 catgcatgcatgcatgcatgc 330 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 329 catgcatgcatgcatgcatgc 309 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305
>gb|AY779442.1| Eimeria maxima clone USDA-EM-6-21 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779439.1| Eimeria maxima clone USDA-EM-6-18 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779437.1| Eimeria maxima clone USDA-EM-6-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779436.1| Eimeria maxima clone USDA-EM-6-13 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779433.1| Eimeria maxima clone USDA-EM-5-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 968 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779429.1| Eimeria maxima clone USDA-EM-5-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779427.1| Eimeria maxima clone USDA-EM-5-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779425.1| Eimeria maxima clone USDA-EM-4-38 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 971 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779421.1| Eimeria maxima clone USDA-EM-4-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779417.1| Eimeria maxima clone USDA-EM-3-56 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779416.1| Eimeria maxima clone USDA-EM-3-55 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779415.1| Eimeria maxima clone USDA-EM-3-54 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 310 catgcatgcatgcatgcatgc 330 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 329 catgcatgcatgcatgcatgc 309 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305
>gb|AY779413.1| Eimeria maxima clone USDA-EM-3-50 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779412.1| Eimeria maxima clone USDA-EM-3-49 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779410.1| Eimeria maxima clone USDA-EM-3-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779408.1| Eimeria maxima clone USDA-EM-3-12 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779403.1| Eimeria maxima clone USDA-EM-2-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779399.1| Eimeria maxima clone USDA-EM-2-115 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779396.1| Eimeria maxima clone USDA-EM-2-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779390.1| Eimeria maxima clone USDA-EM-1-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, complete sequence Length = 172954 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 224 ttcatgcatgcatgcatgcat 244 ||||||||||||||||||||| Sbjct: 37006 ttcatgcatgcatgcatgcat 37026
>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence Length = 205646 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 121133 catgcatgcatgcatgcatgc 121153 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 121152 catgcatgcatgcatgcatgc 121132
>gb|AC124333.13| Mus musculus chromosome 1, clone RP24-511E9, complete sequence Length = 185857 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76846 catgcatgcatgcatgcatgc 76866 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76865 catgcatgcatgcatgcatgc 76845 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76842 catgcatgcatgcatgcatgc 76862 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 76861 catgcatgcatgcatgcatg 76842
>gb|AC110512.13| Mus musculus chromosome 15, clone RP24-134E9, complete sequence Length = 163319 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 86401 catgcatgcatgcatgcatgc 86381 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 86382 catgcatgcatgcatgcatg 86401
>gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome 13, complete sequence Length = 234717 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 170191 catgcatgcatgcatgcatgc 170211 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 170210 catgcatgcatgcatgcatg 170191
>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence Length = 253457 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 9196 catgcatgcatgcatgcatgc 9176 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 9173 catgcatgcatgcatgcatgc 9193 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 9192 catgcatgcatgcatgcatgc 9172 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 9177 catgcatgcatgcatgcatg 9196 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 9170 atgcatgcatgcatgcatgc 9189
>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete sequence Length = 169205 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 tgcatgcatgcatgcatgctg 248 ||||||||||||||||||||| Sbjct: 89495 tgcatgcatgcatgcatgctg 89475
>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence Length = 170234 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34631 catgcatgcatgcatgcatgc 34651 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34650 catgcatgcatgcatgcatgc 34630 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 34653 atgcatgcatgcatgcatgc 34634
>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence Length = 198057 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 71263 catgcatgcatgcatgcatgc 71243 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 71244 catgcatgcatgcatgcatg 71263 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 71241 atgcatgcatgcatgcatgc 71260
>gb|AC110214.7| Mus musculus chromosome 8, clone RP24-485L5, complete sequence Length = 213387 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 145851 catgcatgcatgcatgcatgc 145871 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 145873 atgcatgcatgcatgcatgc 145854 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 145870 catgcatgcatgcatgcatg 145851
>gb|DP000017.1| Sus scrofa target 1 genomic scaffold Length = 1471440 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 907464 catgcatgcatgcatgcatgc 907484 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 907483 catgcatgcatgcatgcatg 907464
>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence Length = 188514 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 94247 catgcatgcatgcatgcatgc 94227 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 94228 catgcatgcatgcatgcatg 94247 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 94225 atgcatgcatgcatgcatgc 94244
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10, complete sequence Length = 153366 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 107100 catgcatgcatgcatgcatgc 107120 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 107122 atgcatgcatgcatgcatgc 107103 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 107119 catgcatgcatgcatgcatg 107100
>gb|AC104743.28| Mus musculus chromosome 6, clone RP23-27D8, complete sequence Length = 218391 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 108477 catgcatgcatgcatgcatgc 108497 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 108496 catgcatgcatgcatgcatg 108477
>gb|AF405701.1| Synthetic construct legume box RY repeat motif sequence Length = 82 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 70 catgcatgcatgcatgcatgc 50 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 47 catgcatgcatgcatgcatgc 67 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 66 catgcatgcatgcatgcatgc 46 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 43 catgcatgcatgcatgcatgc 63 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 62 catgcatgcatgcatgcatgc 42 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 39 catgcatgcatgcatgcatgc 59 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 58 catgcatgcatgcatgcatgc 38 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 35 catgcatgcatgcatgcatgc 55 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 54 catgcatgcatgcatgcatgc 34 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 31 catgcatgcatgcatgcatgc 51 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 50 catgcatgcatgcatgcatgc 30 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 51 catgcatgcatgcatgcatg 70
>gb|AY024272.1| Oryza sativa microsatellite MRG6597 containing (TGCA)X8, closest to marker RM132, genomic sequence Length = 232 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 111 catgcatgcatgcatgcatgc 131 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 130 catgcatgcatgcatgcatgc 110 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 107 catgcatgcatgcatgcatgc 127 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 126 catgcatgcatgcatgcatgc 106 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 103 catgcatgcatgcatgcatgc 123 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 122 catgcatgcatgcatgcatgc 102
>gb|AY024014.1| Oryza sativa microsatellite MRG6339 containing (CATG)X6, closest to marker Y6854L, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 124 catgcatgcatgcatgcatgc 104 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 101 catgcatgcatgcatgcatgc 121 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 105 catgcatgcatgcatgcatg 124 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 120 catgcatgcatgcatgcatg 101
>gb|AC145381.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024K17 map near S16403, complete sequence Length = 172238 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 30967 catgcatgcatgcatgcatgc 30987 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 30986 catgcatgcatgcatgcatg 30967
>gb|AY258809.1| Xiphophorus maculatus microsatellite Msc018 sequence Length = 724 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 472 catgcatgcatgcatgcatgc 492 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 494 atgcatgcatgcatgcatgc 475 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 491 catgcatgcatgcatgcatg 472
>gb|AY258744.1| Xiphophorus maculatus microsatellite Msc045 sequence Length = 602 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 267 catgcatgcatgcatgcatgc 247 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 244 catgcatgcatgcatgcatgc 264 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 263 catgcatgcatgcatgcatgc 243 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 248 catgcatgcatgcatgcatg 267 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 241 atgcatgcatgcatgcatgc 260
>gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome 9, complete sequence Length = 194427 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 11766 catgcatgcatgcatgcatgc 11746 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 11747 catgcatgcatgcatgcatg 11766 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 11744 atgcatgcatgcatgcatgc 11763
>gb|AC163748.6| Mus musculus BAC clone RP23-411N10 from chromosome 9, complete sequence Length = 226254 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 38693 catgcatgcatgcatgcatgc 38713 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 38712 catgcatgcatgcatgcatg 38693
>gb|AC135431.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B12, complete sequence Length = 187523 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 69405 catgcatgcatgcatgcatgc 69425 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 69424 catgcatgcatgcatgcatgc 69404
>gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete sequence Length = 40246 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17247 catgcatgcatgcatgcatgc 17267 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17266 catgcatgcatgcatgcatgc 17246 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17243 catgcatgcatgcatgcatgc 17263 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 17262 catgcatgcatgcatgcatgc 17242
>gb|AC124110.8| Mus musculus chromosome 1, clone RP24-343C13, complete sequence Length = 149487 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 42657 catgcatgcatgcatgcatgc 42677 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 42676 catgcatgcatgcatgcatgc 42656
>gb|AC150540.2| Bos taurus BAC CH240-385H19 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 172471 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 18975 catgcatgcatgcatgcatgc 18995 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 18994 catgcatgcatgcatgcatgc 18974 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 18997 atgcatgcatgcatgcatgc 18978
>gb|AC158548.10| Mus musculus chromosome 5, clone RP23-258F17, complete sequence Length = 227065 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 126058 catgcatgcatgcatgcatgc 126038 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 126039 catgcatgcatgcatgcatg 126058 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 126036 atgcatgcatgcatgcatgc 126055
>gb|AC135190.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0064H09, complete sequence Length = 146742 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 5084 catgcatgcatgcatgcatgc 5064 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 5061 catgcatgcatgcatgcatgc 5081 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 5065 catgcatgcatgcatgcatg 5084 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 5080 catgcatgcatgcatgcatg 5061
>gb|AY621154.1| Alpinia hainanensis AP3-like MADS-box protein (MADS5) mRNA, partial cds Length = 830 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 672 catgcatgcatgcatgcatgc 692 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 691 catgcatgcatgcatgcatgc 671
>gb|AY663543.1| Sus scrofa albumin gene, complete cds Length = 35317 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 13761 catgcatgcatgcatgcatgc 13781 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 13780 catgcatgcatgcatgcatgc 13760
>gb|AC136998.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0082P17, complete sequence Length = 157539 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 112702 catgcatgcatgcatgcatgc 112682 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 112679 catgcatgcatgcatgcatgc 112699 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 112683 catgcatgcatgcatgcatg 112702 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 112698 catgcatgcatgcatgcatg 112679
>gb|AC102229.7| Mus musculus chromosome 15, clone RP24-70F9, complete sequence Length = 202156 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 160785 catgcatgcatgcatgcatgc 160765 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 160766 catgcatgcatgcatgcatg 160785
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 991 catgcatgcatgcatgcatgc 1011 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 1010 catgcatgcatgcatgcatg 991
>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence Length = 214765 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 29053 catgcatgcatgcatgcatgc 29033 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 29034 catgcatgcatgcatgcatg 29053 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 29031 atgcatgcatgcatgcatgc 29050
>gb|AC183919.2| Pan troglodytes BAC clone CH251-691O9 from chromosome 7, complete sequence Length = 188947 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34141 catgcatgcatgcatgcatgc 34161 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34160 catgcatgcatgcatgcatgc 34140 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34137 catgcatgcatgcatgcatgc 34157 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34156 catgcatgcatgcatgcatgc 34136 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 34133 catgcatgcatgcatgcatgc 34153 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 34163 atgcatgcatgcatgcatgc 34144 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 34152 catgcatgcatgcatgcatg 34133
>gb|AC124830.8| Mus musculus chromosome 17, clone RP24-165B21, complete sequence Length = 176889 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 83124 catgcatgcatgcatgcatgc 83104 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 83105 catgcatgcatgcatgcatg 83124 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 83102 atgcatgcatgcatgcatgc 83121
>gb|AC137156.3| Mus musculus BAC clone RP23-118K10 from chromosome 15, complete sequence Length = 205599 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 191435 catgcatgcatgcatgcatgc 191415 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 191416 catgcatgcatgcatgcatg 191435 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 191413 atgcatgcatgcatgcatgc 191432
>gb|AC096884.2| Sus scrofa clone RP44-519O7, complete sequence Length = 146504 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 76869 catgcatgcatgcatgcatgc 76889 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 76888 catgcatgcatgcatgcatg 76869
>gb|AC131713.3| Mus musculus BAC clone RP23-193O18 from chromosome 18, complete sequence Length = 220193 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 22323 catgcatgcatgcatgcatgc 22303 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 22304 catgcatgcatgcatgcatg 22323 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 22301 atgcatgcatgcatgcatgc 22320
>gb|AC183990.2| Pan troglodytes BAC clone CH251-134O11 from chromosome 6, complete sequence Length = 166671 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgca 243 ||||||||||||||||||||| Sbjct: 61574 attcatgcatgcatgcatgca 61594 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 attcatgcatgcatgcatgcatgc 246 |||||| ||||||||||||||||| Sbjct: 61570 attcattcatgcatgcatgcatgc 61593
>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence Length = 190426 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 113218 catgcatgcatgcatgcatgc 113198 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 113199 catgcatgcatgcatgcatg 113218 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 113196 atgcatgcatgcatgcatgc 113215
>gb|AC133459.9| Mus musculus chromosome 12, clone RP23-383O15, complete sequence Length = 227171 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 44170 catgcatgcatgcatgcatgc 44190 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 44189 catgcatgcatgcatgcatgc 44169
>gb|AC124978.19| Mus musculus chromosome 5, clone RP24-107D19, complete sequence Length = 182405 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 ttcatgcatgcatgcatgcat 244 ||||||||||||||||||||| Sbjct: 72998 ttcatgcatgcatgcatgcat 72978
>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence Length = 230097 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 189443 catgcatgcatgcatgcatgc 189423 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 189420 catgcatgcatgcatgcatgc 189440 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 189439 catgcatgcatgcatgcatgc 189419 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 189424 catgcatgcatgcatgcatg 189443
>gb|AC164080.7| Mus musculus chromosome 1, clone RP23-212E14, complete sequence Length = 205823 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 103445 catgcatgcatgcatgcatgc 103425 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 103422 catgcatgcatgcatgcatgc 103442 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 103441 catgcatgcatgcatgcatgc 103421 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 103426 catgcatgcatgcatgcatg 103445 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 103419 atgcatgcatgcatgcatgc 103438
>gb|DQ160222.1|DQ160222S1 Zea mays pericarp color 1 gene, pericarp color 1-P1rwCFS342 allele, 5' noncoding region Length = 5500 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 catgcatgcatgcatgcatgc 246 ||||||||||||||||||||| Sbjct: 1809 catgcatgcatgcatgcatgc 1789 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 catgcatgcatgcatgcatg 245 |||||||||||||||||||| Sbjct: 1790 catgcatgcatgcatgcatg 1809 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 atgcatgcatgcatgcatgc 246 |||||||||||||||||||| Sbjct: 1787 atgcatgcatgcatgcatgc 1806 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,412,601 Number of Sequences: 3902068 Number of extensions: 3412601 Number of successful extensions: 114587 Number of sequences better than 10.0: 798 Number of HSP's better than 10.0 without gapping: 839 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 100191 Number of HSP's gapped (non-prelim): 11716 length of query: 440 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 418 effective length of database: 17,147,199,772 effective search space: 7167529504696 effective search space used: 7167529504696 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)