ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart32f10 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_483551.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1691 Score = 125 bits (63), Expect = 1e-25 Identities = 153/183 (83%) Strand = Plus / Minus Query: 301 ccatgccggtaggcaccatggggccgggaaactgaagcacagggatggcgccggagccgg 360 ||||| ||||| ||||||||| ||||||| ||||||||||| | ||| ||||| || Sbjct: 1305 ccatgtcggtaagcaccatggaaccgggaagctgaagcacagagcaggcttgggagctgg 1246 Query: 361 ctgctgcggctcggccacgaggatgtagaccaggcccatgacgccggtgtgctcgcgggt 420 ||| | |||| || || |||||||||| ||||||||||||||||||||||| |||| Sbjct: 1245 ctgttcttgctctgcaacaaggatgtagagcaggcccatgacgccggtgtgctggcggtc 1186 Query: 421 gctgctgtagttggagacgatggtcagcacctcgccgtcgctgaccttgatggatcctgg 480 ||||||||||||||||||| ||||||||||||||| || |||||||||| ||||| || Sbjct: 1185 actgctgtagttggagacgacggtcagcacctcgccatcactgaccttgactgatcccgg 1126 Query: 481 ctt 483 ||| Sbjct: 1125 ctt 1123
>dbj|AK067831.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013121M08, full insert sequence Length = 1719 Score = 125 bits (63), Expect = 1e-25 Identities = 153/183 (83%) Strand = Plus / Minus Query: 301 ccatgccggtaggcaccatggggccgggaaactgaagcacagggatggcgccggagccgg 360 ||||| ||||| ||||||||| ||||||| ||||||||||| | ||| ||||| || Sbjct: 1305 ccatgtcggtaagcaccatggaaccgggaagctgaagcacagagcaggcttgggagctgg 1246 Query: 361 ctgctgcggctcggccacgaggatgtagaccaggcccatgacgccggtgtgctcgcgggt 420 ||| | |||| || || |||||||||| ||||||||||||||||||||||| |||| Sbjct: 1245 ctgttcttgctctgcaacaaggatgtagagcaggcccatgacgccggtgtgctggcggtc 1186 Query: 421 gctgctgtagttggagacgatggtcagcacctcgccgtcgctgaccttgatggatcctgg 480 ||||||||||||||||||| ||||||||||||||| || |||||||||| ||||| || Sbjct: 1185 actgctgtagttggagacgacggtcagcacctcgccatcactgaccttgactgatcccgg 1126 Query: 481 ctt 483 ||| Sbjct: 1125 ctt 1123
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 119 bits (60), Expect = 9e-24 Identities = 93/104 (89%) Strand = Plus / Minus Query: 380 aggatgtagaccaggcccatgacgccggtgtgctcgcgggtgctgctgtagttggagacg 439 |||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| Sbjct: 26913723 aggatgtagagcaggcccatgacgccggtgtgctggcggtcactgctgtagttggagacg 26913664 Query: 440 atggtcagcacctcgccgtcgctgaccttgatggatcctggctt 483 | ||||||||||||||| || |||||||||| ||||| ||||| Sbjct: 26913663 acggtcagcacctcgccatcactgaccttgactgatcccggctt 26913620
>dbj|AP004592.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0666G10 Length = 150761 Score = 119 bits (60), Expect = 9e-24 Identities = 93/104 (89%) Strand = Plus / Minus Query: 380 aggatgtagaccaggcccatgacgccggtgtgctcgcgggtgctgctgtagttggagacg 439 |||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| Sbjct: 15123 aggatgtagagcaggcccatgacgccggtgtgctggcggtcactgctgtagttggagacg 15064 Query: 440 atggtcagcacctcgccgtcgctgaccttgatggatcctggctt 483 | ||||||||||||||| || |||||||||| ||||| ||||| Sbjct: 15063 acggtcagcacctcgccatcactgaccttgactgatcccggctt 15020
>dbj|AP004464.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0665C04 Length = 177054 Score = 119 bits (60), Expect = 9e-24 Identities = 93/104 (89%) Strand = Plus / Minus Query: 380 aggatgtagaccaggcccatgacgccggtgtgctcgcgggtgctgctgtagttggagacg 439 |||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| Sbjct: 176513 aggatgtagagcaggcccatgacgccggtgtgctggcggtcactgctgtagttggagacg 176454 Query: 440 atggtcagcacctcgccgtcgctgaccttgatggatcctggctt 483 | ||||||||||||||| || |||||||||| ||||| ||||| Sbjct: 176453 acggtcagcacctcgccatcactgaccttgactgatcccggctt 176410
>gb|AY107588.1| Zea mays PCO070301 mRNA sequence Length = 805 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 283 tcacatgttgccagacatccatgccggtaggcaccatggggccgggaaactgaagcacag 342 ||||| ||||| |||| ||||| |||||||||||||||| ||||||| ||||||||||| Sbjct: 435 tcacaggttgctcgacagccatgacggtaggcaccatgggaccgggaagctgaagcacag 376 Query: 343 g 343 | Sbjct: 375 g 375 Score = 61.9 bits (31), Expect = 2e-06 Identities = 76/91 (83%) Strand = Plus / Minus Query: 371 tcggccacgaggatgtagaccaggcccatgacgccggtgtgctcgcgggtgctgctgtag 430 ||||||||||||||||||| |||||||||||||| ||||| |||| ||||||||| Sbjct: 344 tcggccacgaggatgtagaagaggcccatgacgcccgtgtggcggcggtcgctgctgtac 285 Query: 431 ttggagacgatggtcagcacctcgccgtcgc 461 |||| |||| ||| ||| ||||||||||| Sbjct: 284 ctggacacgacggtgagcggctcgccgtcgc 254
>emb|AL133380.5| Human DNA sequence from clone RP5-862P8 on chromosome 1q42.2-43 Contains a ribosomal protein S7 (RPS7) pseudogene, pecanex homolog (Drosophila) (PCNX) pseudogene and the gene for mixed lineage kinase 4 (KIAA1804), complete sequence Length = 118632 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 347 ggcgccggagccggctgctgcggc 370 |||||||||||||||||||||||| Sbjct: 8659 ggcgccggagccggctgctgcggc 8682
>dbj|AK092353.1| Homo sapiens cDNA FLJ35034 fis, clone OCBBF2016591, moderately similar to Mus musculus pecanex 1 mRNA Length = 2843 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 347 ggcgccggagccggctgctgcggc 370 |||||||||||||||||||||||| Sbjct: 91 ggcgccggagccggctgctgcggc 68
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 447 gcacctcgccgtcgctgaccttgatg 472 |||||||| ||||||||||||||||| Sbjct: 2746528 gcacctcggcgtcgctgaccttgatg 2746553
>gb|BT016757.1| Zea mays clone Contig590 mRNA sequence Length = 898 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 448 cacctcgccgtcgctgaccttgatg 472 ||||||| ||||||||||||||||| Sbjct: 760 cacctcgtcgtcgctgaccttgatg 736
>gb|BT016469.1| Zea mays clone Contig302 mRNA sequence Length = 1305 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 448 cacctcgccgtcgctgaccttgatg 472 ||||||| ||||||||||||||||| Sbjct: 799 cacctcgtcgtcgctgaccttgatg 823
>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12 Length = 333800 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 tcagcacctcgccgtcgctga 464 ||||||||||||||||||||| Sbjct: 276631 tcagcacctcgccgtcgctga 276651
>gb|AY197773.1| Zea mays fructokinase 2 (frk2) mRNA, complete cds Length = 1358 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 448 cacctcgccgtcgctgaccttgatg 472 ||||||| ||||||||||||||||| Sbjct: 750 cacctcgtcgtcgctgaccttgatg 726
>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome Length = 1522076 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 144 tgtatatatattagctagtaa 164 ||||||||||||||||||||| Sbjct: 1399737 tgtatatatattagctagtaa 1399757
>gb|AC096887.2| Homo sapiens chromosome 3 clone RP11-5O17, complete sequence Length = 171289 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 327 ggaaactgaagcacagggatg 347 ||||||||||||||||||||| Sbjct: 153678 ggaaactgaagcacagggatg 153698
>dbj|BA000038.2| Vibrio vulnificus YJ016 DNA, chromosome II, complete sequence Length = 1857073 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 tcaactcatacaactcagctttata 54 |||||||||||||||| |||||||| Sbjct: 1406445 tcaactcatacaactctgctttata 1406469
>gb|AF457962.1| Zea mays clone csi1n.pk0029.c8, mRNA sequence Length = 543 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 448 cacctcgccgtcgctgaccttgatg 472 ||||||| ||||||||||||||||| Sbjct: 237 cacctcgtcgtcgctgaccttgatg 213
>gb|AY112523.1| Zea mays CL966_1 mRNA sequence Length = 1528 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 448 cacctcgccgtcgctgaccttgatg 472 ||||||| ||||||||||||||||| Sbjct: 752 cacctcgtcgtcgctgaccttgatg 728
>gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete sequence Length = 1844853 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 tcaactcatacaactcagctttata 54 |||||||||||||||| |||||||| Sbjct: 869502 tcaactcatacaactccgctttata 869526
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 439 gatggtcagcacctcgccgtc 459 ||||||||||||||||||||| Sbjct: 3525131 gatggtcagcacctcgccgtc 3525151
>ref|XM_444943.1| Candida glabrata CBS138 hypothetical protein (CAGL0A04059g) partial mRNA Length = 1356 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 786 cgaggatgtagaccaggccc 805
>gb|AC004525.1|HUAC004525 Homo sapiens Chromosome 16 BAC clone CIT987SK-582J2, complete sequence Length = 130020 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 127913 gggaaactgaagcacaggga 127894
>gb|AC106739.5| Homo sapiens chromosome 16 clone CTD-3203P2, complete sequence Length = 150762 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 53832 gggaaactgaagcacaggga 53813
>emb|CR380947.1| Candida glabrata strain CBS138 chromosome A complete sequence Length = 485192 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 402226 cgaggatgtagaccaggccc 402245
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 caggcccatgacgccggtgt 410 |||||||||||||||||||| Sbjct: 242732 caggcccatgacgccggtgt 242751
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 caggcccatgacgccggtgt 410 |||||||||||||||||||| Sbjct: 154202 caggcccatgacgccggtgt 154221
>emb|BX640418.1| Bordetella pertussis strain Tohama I, complete genome; segment 8/12 Length = 349346 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 caggcccatgacgccggtgt 410 |||||||||||||||||||| Sbjct: 6896 caggcccatgacgccggtgt 6877
>emb|AL939105.1|SCO939105 Streptomyces coelicolor A3(2) complete genome; segment 2/29 Length = 291000 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 cgatggtcagcacctcgccg 457 |||||||||||||||||||| Sbjct: 214624 cgatggtcagcacctcgccg 214643
>emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001 Length = 281116 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 41 aactcagctttatacactgctact 64 ||||||||||||| |||||||||| Sbjct: 12231 aactcagctttatccactgctact 12208
>emb|BX640768.1|HSM806852 Homo sapiens genomic DNA; cDNA DKFZp686B07129 (from clone DKFZp686B07129) Length = 3786 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 2207 gggaaactgaagcacaggga 2188
>gb|AC021483.11| Homo sapiens, clone RP11-38G5, complete sequence Length = 163065 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 cagccatcttataactatga 204 |||||||||||||||||||| Sbjct: 32368 cagccatcttataactatga 32387
>gb|AC122721.2| Homo sapiens chromosome 5 clone RP11-91I13, complete sequence Length = 137867 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tgcttttgtatatatattag 157 |||||||||||||||||||| Sbjct: 14649 tgcttttgtatatatattag 14630
>dbj|AP008931.1| Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence Length = 271577 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 441 tggtcagcacctcgccgtcg 460 |||||||||||||||||||| Sbjct: 48114 tggtcagcacctcgccgtcg 48095
>gb|AC021649.18| Homo sapiens 3 BAC RP11-321F19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 209521 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 201777 gggaaactgaagcacaggga 201758
>gb|AC026992.12| Homo sapiens chromosome 15, clone RP11-352D13, complete sequence Length = 177902 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 177314 gggaaactgaagcacaggga 177333
>gb|AC104825.4| Homo sapiens BAC clone RP11-774O3 from 4, complete sequence Length = 134369 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 62317 gggaaactgaagcacaggga 62336
>gb|AC084408.21| Homo sapiens 3q BAC RP11-47C16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 100501 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 47908 gggaaactgaagcacaggga 47927
>gb|AC073468.9| Homo sapiens BAC clone RP11-405I21 from 7, complete sequence Length = 138435 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 ctacgcttcacatgttgcca 295 |||||||||||||||||||| Sbjct: 122528 ctacgcttcacatgttgcca 122547
>gb|AC027237.8| Homo sapiens chromosome 15, clone RP11-253M7, complete sequence Length = 157448 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 151522 gggaaactgaagcacaggga 151503
>gb|AC010430.5| Homo sapiens chromosome 5 clone CTD-2201D24, complete sequence Length = 57142 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tgcttttgtatatatattag 157 |||||||||||||||||||| Sbjct: 16778 tgcttttgtatatatattag 16797
>gb|AC008504.7| Homo sapiens chromosome 5 clone CTC-444E21, complete sequence Length = 74253 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tgcttttgtatatatattag 157 |||||||||||||||||||| Sbjct: 29159 tgcttttgtatatatattag 29178
>gb|AC026826.7| Homo sapiens, clone RP11-591L14, complete sequence Length = 169462 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 cagccatcttataactatga 204 |||||||||||||||||||| Sbjct: 114673 cagccatcttataactatga 114692
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 caatttgcattgcaggtaga 268 |||||||||||||||||||| Sbjct: 22580285 caatttgcattgcaggtaga 22580266
>gb|AC012666.7| Homo sapiens BAC clone RP11-219B1 from 2, complete sequence Length = 106576 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 ggaaactgaagcacagggat 346 |||||||||||||||||||| Sbjct: 60474 ggaaactgaagcacagggat 60493
>gb|U82694.2| Homo sapiens chromosome X multiple clones map q28, complete sequence Length = 75276 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 10045 gggaaactgaagcacaggga 10026
>gb|AF274572.4| Homo sapiens chromosome X clone RP4-741O10 map q28, complete sequence Length = 126522 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 125377 gggaaactgaagcacaggga 125358
>dbj|AP006450.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1130E07 Length = 152245 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 caatttgcattgcaggtaga 268 |||||||||||||||||||| Sbjct: 22205 caatttgcattgcaggtaga 22186
>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1331F11 Length = 132205 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 caatttgcattgcaggtaga 268 |||||||||||||||||||| Sbjct: 95486 caatttgcattgcaggtaga 95467
>dbj|AK110287.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-F02, full insert sequence Length = 2718 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 348 gcgccggagccggctgctgc 367 |||||||||||||||||||| Sbjct: 565 gcgccggagccggctgctgc 546
>gb|AY771106.1| Candida glabrata genotype 31 N-myristoyl transferase (NMT1) gene, NMT1-19 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771105.1| Candida glabrata genotype 32 N-myristoyl transferase (NMT1) gene, NMT1-18 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771104.1| Candida glabrata genotype 28 N-myristoyl transferase (NMT1) gene, NMT1-17 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771103.1| Candida glabrata genotype 25 N-myristoyl transferase (NMT1) gene, NMT1-16 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771102.1| Candida glabrata genotype 27 N-myristoyl transferase (NMT1) gene, NMT1-15 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771101.1| Candida glabrata genotype 23 N-myristoyl transferase (NMT1) gene, NMT1-14 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771100.1| Candida glabrata genotype 17 N-myristoyl transferase (NMT1) gene, NMT1-13 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771099.1| Candida glabrata genotype 36 N-myristoyl transferase (NMT1) gene, NMT1-12 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771098.1| Candida glabrata genotype 20 N-myristoyl transferase (NMT1) gene, NMT1-12 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771097.1| Candida glabrata genotype 16 N-myristoyl transferase (NMT1) gene, NMT1-11 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771096.1| Candida glabrata genotype 35 N-myristoyl transferase (NMT1) gene, NMT1-11 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771095.1| Candida glabrata genotype 24 N-myristoyl transferase (NMT1) gene, NMT1-10 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771094.1| Candida glabrata genotype 21 N-myristoyl transferase (NMT1) gene, NMT1-10 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771093.1| Candida glabrata genotype 4 N-myristoyl transferase (NMT1) gene, NMT1-9 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771092.1| Candida glabrata genotype 34 N-myristoyl transferase (NMT1) gene, NMT1-9 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771091.1| Candida glabrata genotype 3 N-myristoyl transferase (NMT1) gene, NMT1-8 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771090.1| Candida glabrata genotype 6 N-myristoyl transferase (NMT1) gene, NMT1-7 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771089.1| Candida glabrata genotype 14 N-myristoyl transferase (NMT1) gene, NMT1-7 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771088.1| Candida glabrata genotype 22 N-myristoyl transferase (NMT1) gene, NMT1-6 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771087.1| Candida glabrata genotype 19 N-myristoyl transferase (NMT1) gene, NMT1-5 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771086.1| Candida glabrata genotype 13 N-myristoyl transferase (NMT1) gene, NMT1-5 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771085.1| Candida glabrata genotype 30 N-myristoyl transferase (NMT1) gene, NMT1-4 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771084.1| Candida glabrata genotype 7 N-myristoyl transferase (NMT1) gene, NMT1-4 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771083.1| Candida glabrata genotype 29 N-myristoyl transferase (NMT1) gene, NMT1-3 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771082.1| Candida glabrata genotype 26 N-myristoyl transferase (NMT1) gene, NMT1-3 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771081.1| Candida glabrata genotype 18 N-myristoyl transferase (NMT1) gene, NMT1-3 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771080.1| Candida glabrata genotype 15 N-myristoyl transferase (NMT1) gene, NMT1-3 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771079.1| Candida glabrata genotype 10 N-myristoyl transferase (NMT1) gene, NMT1-3 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771078.1| Candida glabrata genotype 12 N-myristoyl transferase (NMT1) gene, NMT1-2 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771077.1| Candida glabrata genotype 11 N-myristoyl transferase (NMT1) gene, NMT1-2 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771076.1| Candida glabrata genotype 8 N-myristoyl transferase (NMT1) gene, NMT1-2 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771075.1| Candida glabrata genotype 2 N-myristoyl transferase (NMT1) gene, NMT1-2 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>gb|AY771074.1| Candida glabrata genotype 1 N-myristoyl transferase (NMT1) gene, NMT1-1 allele, partial cds Length = 607 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 138 cgaggatgtagaccaggccc 157
>emb|CT009557.4| Pan troglodytes chromosome X clone PTB-010G23 map Xq28, complete sequence Length = 244504 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 gggaaactgaagcacaggga 345 |||||||||||||||||||| Sbjct: 82223 gggaaactgaagcacaggga 82242
>emb|AJ628149.4| Micromonospora echinospora genomic region of the gentamicin biosynthesis gene cluster, strain DSM 43036 Length = 84222 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 ccggctgctgcggctcggcc 376 |||||||||||||||||||| Sbjct: 67486 ccggctgctgcggctcggcc 67467
>gb|AF073886.1|AF073886 Candida glabrata myristoyl-CoA:protein N-myristoyltransferase (NMT1) gene, complete cds Length = 1356 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 cgaggatgtagaccaggccc 397 |||||||||||||||||||| Sbjct: 786 cgaggatgtagaccaggccc 805
>emb|AL078471.2|HSB15L0C0 Homo sapiens chromosome 21 BAC B15L0C0, complete sequence Length = 80692 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 41 aactcagctttatacactgctact 64 ||||||||||||| |||||||||| Sbjct: 68462 aactcagctttatccactgctact 68485 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,947,579 Number of Sequences: 3902068 Number of extensions: 4947579 Number of successful extensions: 89582 Number of sequences better than 10.0: 86 Number of HSP's better than 10.0 without gapping: 86 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 89183 Number of HSP's gapped (non-prelim): 399 length of query: 486 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 464 effective length of database: 17,147,199,772 effective search space: 7956300694208 effective search space used: 7956300694208 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
