>emb|AL669859.5| Mouse DNA sequence from clone RP23-167D6 on chromosome 11, complete
             sequence
          Length = 155196

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 60    agttttatattagggtttaatg 81
             ||||||||||||||||||||||
Sbjct: 54624 agttttatattagggtttaatg 54603

>gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complete sequence
          Length = 192540

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     tccgtatgttgcccacatcgg 56
              |||||||||||||||||||||
Sbjct: 159801 tccgtatgttgcccacatcgg 159781

>ref|NM_167518.1| Drosophila melanogaster Traf3 CG4394-RB, transcript variant B
           (Traf3), mRNA
          Length = 1809

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 36  tccgtatgttgcccacatcgg 56
           |||||||||||||||||||||
Sbjct: 340 tccgtatgttgcccacatcgg 320

>ref|NM_167517.1| Drosophila melanogaster Traf3 CG4394-RA, transcript variant A
           (Traf3), mRNA
          Length = 2249

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 36  tccgtatgttgcccacatcgg 56
           |||||||||||||||||||||
Sbjct: 780 tccgtatgttgcccacatcgg 760

>ref|NM_132898.2| Drosophila melanogaster Traf3 CG4394-RC, transcript variant C
           (Traf3), mRNA
          Length = 2337

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 36  tccgtatgttgcccacatcgg 56
           |||||||||||||||||||||
Sbjct: 868 tccgtatgttgcccacatcgg 848

>gb|AY052057.1| Drosophila melanogaster LP08566 full length cDNA
          Length = 2352

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 36  tccgtatgttgcccacatcgg 56
           |||||||||||||||||||||
Sbjct: 868 tccgtatgttgcccacatcgg 848

>gb|AC010920.11|AC010920 Drosophila melanogaster, chromosome X, region 14C-14D, BAC clone
             BACR47D09, complete sequence
          Length = 166935

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 36    tccgtatgttgcccacatcgg 56
             |||||||||||||||||||||
Sbjct: 63847 tccgtatgttgcccacatcgg 63827

>gb|AE003502.4| Drosophila melanogaster chromosome X, section 54 of 74 of the complete
             sequence
          Length = 304712

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 36    tccgtatgttgcccacatcgg 56
             |||||||||||||||||||||
Sbjct: 83129 tccgtatgttgcccacatcgg 83109

>gb|AC160127.2| Mus musculus BAC clone RP23-295O2 from chromosome 9, complete sequence
          Length = 205289

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   acattttacatgaggagtac 120
             ||||||||||||||||||||
Sbjct: 86957 acattttacatgaggagtac 86976

>gb|AY569234.1| Adelotettix gigas 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 509

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 62  ttttatattagggtttaatg 81
           ||||||||||||||||||||
Sbjct: 257 ttttatattagggtttaatg 276

>emb|Y11658.1|ECVHL88 Equus caballus DNA for CA microsatellite, locus ECVHL88
          Length = 595

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 107 tacatgaggagtacacacac 126
           ||||||||||||||||||||
Sbjct: 317 tacatgaggagtacacacac 298


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,987,133
Number of Sequences: 3902068
Number of extensions: 1987133
Number of successful extensions: 31295
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31283
Number of HSP's gapped (non-prelim): 12
length of query: 267
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 245
effective length of database: 17,147,199,772
effective search space: 4201063944140
effective search space used: 4201063944140
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)