ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart32e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 46 0.020
2gb|AY921645.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR8... 42 0.32
3dbj|AK106409.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.32
4gb|AY108381.1| Zea mays PCO088244 mRNA sequence 42 0.32
5gb|AC174930.1| Oryza sativa (japonica cultivar-group) BAC clone ... 42 0.32
6dbj|AB030705.1| Lithospermum erythrorhizon mRNA for LEDI-5a prot... 42 0.32
7gb|AY921644.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR7... 40 1.2
8emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chr... 40 1.2
9gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana... 40 1.2
10gb|AY106967.1| Zea mays PCO088243 mRNA sequence 40 1.2
11ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 38 4.9
12ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 38 4.9
13gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds 38 4.9
14ref|XM_747738.1| Aspergillus fumigatus Af293 hypothetical protei... 38 4.9
15gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosom... 38 4.9
16gb|AC148406.12| Medicago truncatula clone mth2-46e9, complete se... 38 4.9
17emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section... 38 4.9
18emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate ... 38 4.9
19emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 i... 38 4.9
20emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 38 4.9
21gb|AC104629.10| Homo sapiens 3 BAC RP11-12N13 (Roswell Park Canc... 38 4.9
22gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, comple... 38 4.9
23gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, compl... 38 4.9
24gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, com... 38 4.9
25gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a... 38 4.9
26gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complet... 38 4.9
27gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28... 38 4.9
28gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete s... 38 4.9
29dbj|BS000218.1| Pan troglodytes chromosome 22 clone:PTB-414O06, ... 38 4.9
30gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate re... 38 4.9
31dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and ... 38 4.9

>ref|XM_648008.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (94.t00028)
            partial mRNA
          Length = 1644

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 31   caatatatggatcaatcattatttatg 57
            ||||||||| |||||||||||||||||
Sbjct: 1264 caatatatgaatcaatcattatttatg 1290



to top

>gb|AY921645.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR8) mRNA, complete cds
          Length = 1529

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 81   aacgggtagtcggtgtaaccgacgacggg 109
            ||||||||||| |||||||| ||||||||
Sbjct: 1269 aacgggtagtccgtgtaaccaacgacggg 1241



to top

>dbj|AK106409.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-H07, full
            insert sequence
          Length = 1360

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 81   aacgggtagtcggtgtaaccgacgacggg 109
            ||||||||||||||||| ||| |||||||
Sbjct: 1150 aacgggtagtcggtgtagccggcgacggg 1122



to top

>gb|AY108381.1| Zea mays PCO088244 mRNA sequence
          Length = 694

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 81  aacgggtagtcggtgtaaccgacgacggg 109
           ||||||||||| |||||||| ||||||||
Sbjct: 434 aacgggtagtccgtgtaaccaacgacggg 406



to top

>gb|AC174930.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBa0043H01, from
             chromosome 4, complete sequence
          Length = 15426

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 81    aacgggtagtcggtgtaaccgacgacggg 109
             ||||||||||||||||| ||| |||||||
Sbjct: 12779 aacgggtagtcggtgtagccggcgacggg 12807



to top

>dbj|AB030705.1| Lithospermum erythrorhizon mRNA for LEDI-5a protein, complete cds
          Length = 1454

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 77   aagaaacgggtagtcggtgtaaccgacgacggg 109
            |||||| |||||||||||||| ||||| |||||
Sbjct: 1139 aagaaatgggtagtcggtgtagccgacaacggg 1107



to top

>gb|AY921644.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR7) mRNA, complete cds
          Length = 1594

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 86   gtagtcggtgtaaccgacgacggg 109
            |||||| |||||||||||||||||
Sbjct: 1400 gtagtccgtgtaaccgacgacggg 1377



to top

>emb|AL589846.5| Human DNA sequence from clone RP11-199O16 on chromosome 9, complete
             sequence
          Length = 44495

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ttttcacatggcaatatatg 39
             ||||||||||||||||||||
Sbjct: 17566 ttttcacatggcaatatatg 17547



to top

>gb|AC000107.2|AC000107 Genomic sequence for Arabidopsis thaliana BAC F17F8 from chromosome I,
             complete sequence
          Length = 102393

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 34    tatatggatcaatcattatttatg 57
             ||||||||| ||||||||||||||
Sbjct: 27805 tatatggatgaatcattatttatg 27828



to top

>gb|AY106967.1| Zea mays PCO088243 mRNA sequence
          Length = 765

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 86  gtagtcggtgtaaccgacgacggg 109
           |||||| |||||||||||||||||
Sbjct: 571 gtagtccgtgtaaccgacgacggg 548



to top

>ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.2 mRNA, complete cds
          Length = 1460

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1242 gggtaatcggtgtaaccgacgac 1220



to top

>ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.1 mRNA, complete cds
          Length = 1451

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1233 gggtaatcggtgtaaccgacgac 1211



to top

>gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds
          Length = 1119

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1097 gggtaatcggtgtaaccgacgac 1075



to top

>ref|XM_747738.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g14620) partial
            mRNA
          Length = 3207

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ccttttgattttcacatgg 30
            |||||||||||||||||||
Sbjct: 2737 ccttttgattttcacatgg 2755



to top

>gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosome 10, complete
             sequence
          Length = 208221

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 67    cccatccaggaagaaacgg 85
             |||||||||||||||||||
Sbjct: 55035 cccatccaggaagaaacgg 55053



to top

>gb|AC148406.12| Medicago truncatula clone mth2-46e9, complete sequence
          Length = 110272

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 2     agaaaaggttccttttgattttc 24
             ||||||||||||||||| |||||
Sbjct: 32536 agaaaaggttccttttggttttc 32558



to top

>emb|Z99109.2|BSUB0006 Bacillus subtilis complete genome (section 6 of 21): from 1011039 to
              1209781
          Length = 198743

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     ttttcacatggcaatatat 38
              |||||||||||||||||||
Sbjct: 196403 ttttcacatggcaatatat 196385



to top

>emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate reductase
          Length = 1311

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1162 gggtaatcggtgtaaccgacgac 1140



to top

>emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 in linkage group 13,
             complete sequence
          Length = 132853

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    tcacatggcaatatatgga 41
             |||||||||||||||||||
Sbjct: 82220 tcacatggcaatatatgga 82202



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
              complete sequence
          Length = 207677

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     tcacatggcaatatatgga 41
              |||||||||||||||||||
Sbjct: 133388 tcacatggcaatatatgga 133370



to top

>gb|AC104629.10| Homo sapiens 3 BAC RP11-12N13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158224

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     ccttttgattttcacatgg 30
              |||||||||||||||||||
Sbjct: 128509 ccttttgattttcacatgg 128527



to top

>gb|AC125469.3| Homo sapiens BAC clone RP11-761E16 from 4, complete sequence
          Length = 14706

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   ttttcacatggcaatatat 38
            |||||||||||||||||||
Sbjct: 1375 ttttcacatggcaatatat 1357



to top

>gb|AC113424.2| Homo sapiens chromosome 5 clone RP11-624C4, complete sequence
          Length = 194717

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     tcacatggcaatatatgga 41
              |||||||||||||||||||
Sbjct: 119751 tcacatggcaatatatgga 119733



to top

>gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, complete cds
          Length = 1252

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1167 gggtaatcggtgtaaccgacgac 1145



to top

>gb|AC000070.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 105a In DGCR Region,
             complete sequence
          Length = 38699

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 34    tatatggatcaatcattatttat 56
             ||||||||| |||||||||||||
Sbjct: 28256 tatatggatgaatcattatttat 28278



to top

>gb|AC114734.4| Homo sapiens BAC clone CTD-2018D8 from 4, complete sequence
          Length = 78693

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    ttttcacatggcaatatat 38
             |||||||||||||||||||
Sbjct: 78068 ttttcacatggcaatatat 78050



to top

>gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28O16 genomic sequence, complete
             sequence
          Length = 87684

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 84    gggtagtcggtgtaaccgacgac 106
             ||||| |||||||||||||||||
Sbjct: 15021 gggtaatcggtgtaaccgacgac 14999



to top

>gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete sequence
          Length = 1280

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 1167 gggtaatcggtgtaaccgacgac 1145



to top

>dbj|BS000218.1| Pan troglodytes chromosome 22 clone:PTB-414O06, map 22, complete
             sequences
          Length = 92059

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    cttttgattttcacatggc 31
             |||||||||||||||||||
Sbjct: 76811 cttttgattttcacatggc 76829



to top

>gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate reductase OPR1 and
            12-oxophytodienoate reductase OPR2 genes, complete cds
          Length = 7079

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 84   gggtagtcggtgtaaccgacgac 106
            ||||| |||||||||||||||||
Sbjct: 4615 gggtaatcggtgtaaccgacgac 4593



to top

>dbj|D86376.1| Bacillus subtilis ArgF and med genes, partial and complete cds
          Length = 4608

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   ttttcacatggcaatatat 38
            |||||||||||||||||||
Sbjct: 4429 ttttcacatggcaatatat 4411


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,095,678
Number of Sequences: 3902068
Number of extensions: 1095678
Number of successful extensions: 77241
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77197
Number of HSP's gapped (non-prelim): 44
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top