ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart32b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC124763.4| Mus musculus BAC clone RP23-158P17 from 12, compl... 40 0.62
2gb|AC115296.6| Mus musculus BAC clone RP23-195I8 from chromosome... 40 0.62
3emb|AL596083.21| Mouse DNA sequence from clone RP23-293L24 on ch... 38 2.5
4gb|AC079863.11| Homo sapiens 3 BAC RP11-95L3 (Roswell Park Cance... 38 2.5
5ref|NM_145433.1| Mus musculus mitochondrial rRNA methyltransfera... 38 2.5
6gb|AC091805.16| Homo sapiens 12p BAC RP11-841C19 (Roswell Park C... 38 2.5
7dbj|AK164059.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 38 2.5
8dbj|AK156416.1| Mus musculus activated spleen cDNA, RIKEN full-l... 38 2.5
9dbj|AK163986.1| Mus musculus ES cells cDNA, RIKEN full-length en... 38 2.5
10emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 i... 38 2.5
11gb|AC020892.7|AC020892 Homo sapiens chromosome 15 clone RP11-313... 38 2.5
12gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175... 38 2.5
13gb|AF248660.1|AF248660 Gryllus bimaculatus haplotype 2 cytochrom... 38 2.5
14gb|AF248659.1|AF248659 Gryllus bimaculatus haplotype 1 cytochrom... 38 2.5
15emb|BX000349.7| Zebrafish DNA sequence from clone DKEY-63L3 in l... 38 2.5
16gb|BC039743.1| Mus musculus mitochondrial rRNA methyltransferase... 38 2.5
17gb|BC005625.1| Mus musculus mitochondrial rRNA methyltransferase... 38 2.5
18emb|AL928861.5| Mouse DNA sequence from clone RP24-153B19 on chr... 38 2.5
19gb|AF467260.1| Ostrinia furnacalis mitochondrion, complete genome 36 9.7
20gb|AC166340.4| Mus musculus chromosome 1, clone RP24-234I17, com... 36 9.7
21gb|AC135809.4| Mus musculus BAC clone RP23-353F16 from chromosom... 36 9.7
22gb|AC135509.2| Mus musculus BAC clone RP24-448I12 from chromosom... 36 9.7
23gb|AC123926.4| Mus musculus BAC clone RP24-326N11 from chromosom... 36 9.7
24gb|AC124346.3| Mus musculus BAC clone RP24-460E12 from chromosom... 36 9.7
25gb|AC124572.4| Mus musculus BAC clone RP23-159A20 from 12, compl... 36 9.7
26emb|Z99707.1|ATAP21 Arabidopsis thaliana DNA chromosome 4, ESSA ... 36 9.7
27emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete... 36 9.7
28emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, comple... 36 9.7
29emb|AL161590.2|ATCHRIV86 Arabidopsis thaliana DNA chromosome 4, ... 36 9.7
30emb|AJ235271.1|RPXX02 Rickettsia prowazekii strain Madrid E, com... 36 9.7
31emb|CR339061.13| Zebrafish DNA sequence from clone CH211-235P24 ... 36 9.7
32emb|BX936355.7| Mouse DNA sequence from clone RP24-541A1 on chro... 36 9.7
33emb|AL844142.5| Mouse DNA sequence from clone RP23-355C24 on chr... 36 9.7
34gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosom... 36 9.7
35gb|AC160116.2| Mus musculus BAC clone RP23-456L15 from chromosom... 36 9.7
36gb|AC013737.5| Homo sapiens chromosome 10 clone RP11-313B15, com... 36 9.7
37gb|AC102944.2| Homo sapiens chromosome 8, clone CTD2-3082P9, com... 36 9.7
38gb|AC022733.8| Homo sapiens chromosome 8, clone RP11-470M17, com... 36 9.7
39gb|AC091560.6| Homo sapiens chromosome 8, clone RP11-104D16, com... 36 9.7
40emb|AJ560793.1|OFU560793 Ostrinia furnacalis mitochondrial nd5 g... 36 9.7
41emb|AJ560791.1|OFU560791 Ostrinia furnacalis mitochondrial nd5 g... 36 9.7
42gb|AC159894.2| Mus musculus BAC clone RP23-296M10 from chromosom... 36 9.7
43dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 36 9.7
44gb|AC157531.2| Pan troglodytes BAC clone CH251-277G13 from chrom... 36 9.7
45gb|AC154764.2| Mus musculus BAC clone RP24-423N7 from chromosome... 36 9.7
46gb|AC153534.2| Mus musculus 10 BAC RP23-360K7 (Roswell Park Canc... 36 9.7
47gb|AC153863.6| Mus musculus 10 BAC RP23-149M7 (Roswell Park Canc... 36 9.7
48dbj|AP003846.2| Oryza sativa (japonica cultivar-group) genomic D... 36 9.7
49gb|AY916449.1| Phalaenopsis aphrodite subsp. formosana plastid, ... 36 9.7
50emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10,... 36 9.7
51emb|CR932040.2| Medicago truncatula chromosome 5 clone mth2-55h1... 36 9.7
52emb|AL844153.3| Mouse DNA sequence from clone RP24-147L2 on chro... 36 9.7
53emb|BX088567.6| Mouse DNA sequence from clone RP23-21L20 on chro... 36 9.7
54gb|AC154362.1| Mus musculus BAC clone RP23-154E1 from 14, comple... 36 9.7
55gb|AC170262.2| Mus musculus BAC clone RP23-163J7 from chromosome... 36 9.7 
>gb|AC124763.4| Mus musculus BAC clone RP23-158P17 from 12, complete sequence
          Length = 208489

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    tattggatataaagcacaca 53
             ||||||||||||||||||||
Sbjct: 20891 tattggatataaagcacaca 20872
to top
>gb|AC115296.6| Mus musculus BAC clone RP23-195I8 from chromosome 12, complete sequence
          Length = 211561

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tattggatataaagcacaca 53
             ||||||||||||||||||||
Sbjct: 81700 tattggatataaagcacaca 81719
to top
>emb|AL596083.21| Mouse DNA sequence from clone RP23-293L24 on chromosome 11 Contains four
              novel genes and the 3' end of the Zfp403 gene for zinc
              finger protein 403, complete sequence
          Length = 186526

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 8      acctccacagagggctctc 26
              |||||||||||||||||||
Sbjct: 157379 acctccacagagggctctc 157397
to top
>gb|AC079863.11| Homo sapiens 3 BAC RP11-95L3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 152492

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    attattggatataaagcac 50
             |||||||||||||||||||
Sbjct: 43970 attattggatataaagcac 43952
to top
>ref|NM_145433.1| Mus musculus mitochondrial rRNA methyltransferase 1 homolog (S.
            cerevisiae) (Mrm1), mRNA
          Length = 2490

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1680 acctccacagagggctctc 1662
to top
>gb|AC091805.16| Homo sapiens 12p BAC RP11-841C19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177115

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 31    tattattggatataaagcacaca 53
             ||||||||| |||||||||||||
Sbjct: 47168 tattattggttataaagcacaca 47146
to top
>dbj|AK164059.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430039E19 product:hypothetical
            tRNA/rRNA methyltransferase (SpoU) containing protein,
            full insert sequence
          Length = 2456

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1661 acctccacagagggctctc 1643
to top
>dbj|AK156416.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830021B13 product:hypothetical tRNA/rRNA
            methyltransferase (SpoU) containing protein, full insert
            sequence
          Length = 2399

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1604 acctccacagagggctctc 1586
to top
>dbj|AK163986.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
            clone:C330033M23 product:hypothetical tRNA/rRNA
            methyltransferase (SpoU) containing protein, full insert
            sequence
          Length = 2467

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1672 acctccacagagggctctc 1654
to top
>emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 in linkage group 7,
             complete sequence
          Length = 200579

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    ttttattattggatataaa 46
             |||||||||||||||||||
Sbjct: 65717 ttttattattggatataaa 65735
to top
>gb|AC020892.7|AC020892 Homo sapiens chromosome 15 clone RP11-313P18 map 15q21.2, complete
             sequence
          Length = 186253

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 28    ttttattattggatataaagcac 50
             |||||||||||| ||||||||||
Sbjct: 12589 ttttattattggttataaagcac 12567
to top
>gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175-1418323 strain AX4,
              complete sequence
          Length = 413138

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 28     ttttattattggatataaa 46
              |||||||||||||||||||
Sbjct: 326182 ttttattattggatataaa 326164
to top
>gb|AF248660.1|AF248660 Gryllus bimaculatus haplotype 2 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1036

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  tttattattggatataaag 47
           |||||||||||||||||||
Sbjct: 838 tttattattggatataaag 820
to top
>gb|AF248659.1|AF248659 Gryllus bimaculatus haplotype 1 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1036

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  tttattattggatataaag 47
           |||||||||||||||||||
Sbjct: 838 tttattattggatataaag 820
to top
>emb|BX000349.7| Zebrafish DNA sequence from clone DKEY-63L3 in linkage group 7, complete
              sequence
          Length = 173706

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 28     ttttattattggatataaa 46
              |||||||||||||||||||
Sbjct: 108701 ttttattattggatataaa 108719
to top
>gb|BC039743.1| Mus musculus mitochondrial rRNA methyltransferase 1 homolog (S.
            cerevisiae), mRNA (cDNA clone IMAGE:3155268), with
            apparent retained intron
          Length = 2798

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1981 acctccacagagggctctc 1963
to top
>gb|BC005625.1| Mus musculus mitochondrial rRNA methyltransferase 1 homolog (S.
            cerevisiae), mRNA (cDNA clone MGC:7021 IMAGE:3155732),
            complete cds
          Length = 2490

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    acctccacagagggctctc 26
            |||||||||||||||||||
Sbjct: 1680 acctccacagagggctctc 1662
to top
>emb|AL928861.5| Mouse DNA sequence from clone RP24-153B19 on chromosome 2, complete
            sequence
          Length = 98816

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 22   ctctcgttttattattgga 40
            |||||||||||||||||||
Sbjct: 2167 ctctcgttttattattgga 2149
to top
>gb|AF467260.1| Ostrinia furnacalis mitochondrion, complete genome
          Length = 14536

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 28   ttttattattggatataa 45
            ||||||||||||||||||
Sbjct: 7338 ttttattattggatataa 7321
to top
>gb|AC166340.4| Mus musculus chromosome 1, clone RP24-234I17, complete sequence
          Length = 172530

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 9     cctccacagagggctctc 26
             ||||||||||||||||||
Sbjct: 84930 cctccacagagggctctc 84947
to top
>gb|AC135809.4| Mus musculus BAC clone RP23-353F16 from chromosome 7, complete sequence
          Length = 195041

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 39     gatataaagcacacaact 56
              ||||||||||||||||||
Sbjct: 180039 gatataaagcacacaact 180056
to top
>gb|AC135509.2| Mus musculus BAC clone RP24-448I12 from chromosome 17, complete
             sequence
          Length = 141307

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    ttttattattggatataa 45
             ||||||||||||||||||
Sbjct: 79683 ttttattattggatataa 79666
to top
>gb|AC123926.4| Mus musculus BAC clone RP24-326N11 from chromosome 16, complete
             sequence
          Length = 148820

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 43    taaagcacacaacttcac 60
             ||||||||||||||||||
Sbjct: 57042 taaagcacacaacttcac 57025
to top
>gb|AC124346.3| Mus musculus BAC clone RP24-460E12 from chromosome 12, complete sequence
          Length = 203150

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 22     ctctcgttttattattggatat 43
              ||||| ||||||||||||||||
Sbjct: 170557 ctctctttttattattggatat 170536
to top
>gb|AC124572.4| Mus musculus BAC clone RP23-159A20 from 12, complete sequence
          Length = 170191

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 22    ctctcgttttattattggatat 43
             ||||| ||||||||||||||||
Sbjct: 21767 ctctctttttattattggatat 21746
to top
>emb|Z99707.1|ATAP21 Arabidopsis thaliana DNA chromosome 4, ESSA I AP2 contig fragment No. 1
          Length = 206420

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     tcgttttattattggata 42
              ||||||||||||||||||
Sbjct: 185829 tcgttttattattggata 185812
to top
>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 28      ttttattattggatataa 45
               ||||||||||||||||||
Sbjct: 1011817 ttttattattggatataa 1011800
to top
>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 28      ttttattattggatataa 45
               ||||||||||||||||||
Sbjct: 1033106 ttttattattggatataa 1033089
to top
>emb|AL161590.2|ATCHRIV86 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 86
          Length = 198780

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 25    tcgttttattattggata 42
             ||||||||||||||||||
Sbjct: 69405 tcgttttattattggata 69422
to top
>emb|AJ235271.1|RPXX02 Rickettsia prowazekii strain Madrid E, complete genome; segment 2/4
          Length = 312430

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    gttttattattggatata 44
             ||||||||||||||||||
Sbjct: 46781 gttttattattggatata 46764
to top
>emb|CR339061.13| Zebrafish DNA sequence from clone CH211-235P24 in linkage group 7,
              complete sequence
          Length = 111333

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 101825 ttttattattggatataa 101842
to top
>emb|BX936355.7| Mouse DNA sequence from clone RP24-541A1 on chromosome 4 Contains part of
              a novel gene and the Cbx3-ps3 gene for chromobox homolog 3
              (Drosophila HP1 gamma), pseudogene 3, complete sequence
          Length = 144108

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 137413 ttttattattggatataa 137396
to top
>emb|AL844142.5| Mouse DNA sequence from clone RP23-355C24 on chromosome 4, complete
             sequence
          Length = 121550

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 33    ttattggatataaagcac 50
             ||||||||||||||||||
Sbjct: 18000 ttattggatataaagcac 17983
to top
>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete sequence
          Length = 211315

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 27     gttttattattggatata 44
              ||||||||||||||||||
Sbjct: 168624 gttttattattggatata 168641
to top
>gb|AC160116.2| Mus musculus BAC clone RP23-456L15 from chromosome 9, complete sequence
          Length = 182041

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      cctccacagagggctctc 26
              ||||||||||||||||||
Sbjct: 162052 cctccacagagggctctc 162035
to top
>gb|AC013737.5| Homo sapiens chromosome 10 clone RP11-313B15, complete sequence
          Length = 203259

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    tttattattggatataaa 46
             ||||||||||||||||||
Sbjct: 82219 tttattattggatataaa 82202
to top
>gb|AC102944.2| Homo sapiens chromosome 8, clone CTD2-3082P9, complete sequence
          Length = 144383

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     ttattattggatataaag 47
              ||||||||||||||||||
Sbjct: 110366 ttattattggatataaag 110383
to top
>gb|AC022733.8| Homo sapiens chromosome 8, clone RP11-470M17, complete sequence
          Length = 175202

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    ttattattggatataaag 47
             ||||||||||||||||||
Sbjct: 12753 ttattattggatataaag 12770
to top
>gb|AC091560.6| Homo sapiens chromosome 8, clone RP11-104D16, complete sequence
          Length = 190283

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    ttattattggatataaag 47
             ||||||||||||||||||
Sbjct: 18533 ttattattggatataaag 18516
to top
>emb|AJ560793.1|OFU560793 Ostrinia furnacalis mitochondrial nd5 gene (partial), tRNA-Ser gene
            (partial), tRNA-Glu gene and tRNA-Phe gene, specimen
            voucher Jiggins F. 335 (Dept. Genetics, University of
            Cambridge)
          Length = 1222

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 28   ttttattattggatataa 45
            ||||||||||||||||||
Sbjct: 1208 ttttattattggatataa 1191
to top
>emb|AJ560791.1|OFU560791 Ostrinia furnacalis mitochondrial nd5 gene (partial), tRNA-Ser gene
            (partial), tRNA-Glu gene and tRNA-Phe gene, specimen
            voucher Jiggins F. 327 (Dept. Genetics, University of
            Cambridge)
          Length = 1222

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 28   ttttattattggatataa 45
            ||||||||||||||||||
Sbjct: 1208 ttttattattggatataa 1191
to top
>gb|AC159894.2| Mus musculus BAC clone RP23-296M10 from chromosome 9, complete sequence
          Length = 198120

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 9      cctccacagagggctctc 26
              ||||||||||||||||||
Sbjct: 175357 cctccacagagggctctc 175374
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 32       attattggatataaagca 49
                ||||||||||||||||||
Sbjct: 24176471 attattggatataaagca 24176454
to top
>gb|AC157531.2| Pan troglodytes BAC clone CH251-277G13 from chromosome unknown,
             complete sequence
          Length = 183251

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    tttattattggatataaa 46
             ||||||||||||||||||
Sbjct: 63197 tttattattggatataaa 63214
to top
>gb|AC154764.2| Mus musculus BAC clone RP24-423N7 from chromosome 16, complete sequence
          Length = 159556

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    ttttattattggatataa 45
             ||||||||||||||||||
Sbjct: 94420 ttttattattggatataa 94403
to top
>gb|AC153534.2| Mus musculus 10 BAC RP23-360K7 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207306

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 46     agcacacaacttcacact 63
              ||||||||||||||||||
Sbjct: 199447 agcacacaacttcacact 199464
to top
>gb|AC153863.6| Mus musculus 10 BAC RP23-149M7 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 203121

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 46     agcacacaacttcacact 63
              ||||||||||||||||||
Sbjct: 127506 agcacacaacttcacact 127523
to top
>dbj|AP003846.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1710_H11
          Length = 136107

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 32     attattggatataaagca 49
              ||||||||||||||||||
Sbjct: 109886 attattggatataaagca 109869
to top
>gb|AY916449.1| Phalaenopsis aphrodite subsp. formosana plastid, complete genome
          Length = 148964

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 29   tttattattggatataaa 46
            ||||||||||||||||||
Sbjct: 9766 tttattattggatataaa 9749
to top
>emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10, complete sequence
          Length = 204217

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 197555 ttttattattggatataa 197572
to top
>emb|CR932040.2| Medicago truncatula chromosome 5 clone mth2-55h1, COMPLETE SEQUENCE
          Length = 122965

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    ttttattattggatataa 45
             ||||||||||||||||||
Sbjct: 69466 ttttattattggatataa 69449
to top
>emb|AL844153.3| Mouse DNA sequence from clone RP24-147L2 on chromosome 4, complete
              sequence
          Length = 193917

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 160859 ttttattattggatataa 160842
to top
>emb|BX088567.6| Mouse DNA sequence from clone RP23-21L20 on chromosome X, complete
              sequence
          Length = 150122

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 122569 ttttattattggatataa 122552
to top
>gb|AC154362.1| Mus musculus BAC clone RP23-154E1 from 14, complete sequence
          Length = 205650

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 27     gttttattattggatata 44
              ||||||||||||||||||
Sbjct: 195796 gttttattattggatata 195779
to top
>gb|AC170262.2| Mus musculus BAC clone RP23-163J7 from chromosome 17, complete sequence
          Length = 219714

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 28     ttttattattggatataa 45
              ||||||||||||||||||
Sbjct: 196375 ttttattattggatataa 196358


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 624,344
Number of Sequences: 3902068
Number of extensions: 624344
Number of successful extensions: 40695
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40573
Number of HSP's gapped (non-prelim): 122
length of query: 65
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 44
effective length of database: 17,151,101,840
effective search space: 754648480960
effective search space used: 754648480960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top