Clone Name | rbart32a06 |
---|---|
Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 111 bits (56), Expect = 2e-21 Identities = 174/212 (82%), Gaps = 6/212 (2%) Strand = Plus / Plus Query: 236 tcagcggaagccgccgtcggcccaatatgacccgccggcggttccattctgattgctccc 295 ||||||||||||||| || | |||||| || || |||| |||||| |||||||||||||| Sbjct: 9428074 tcagcggaagccgccttccgtccaataggagccaccggtggttccgttctgattgctccc 9428133 Query: 296 gctcttgttggcagggctgtgatggctgtaactatcaaaaccgtcatctttcgcatcgtc 355 |||| ||| | |||||||| |||||||||||||| |||||| ||| |||| || Sbjct: 9428134 ---cttgctgggggtgctgtgat---tgtaactatcaaaattgtcatccttcccatcatc 9428187 Query: 356 ccagccggcccacgagtcgctgccctgacttgtcttggcaggctcttccttcttgtcttg 415 |||||||||||| ||||| |||| || | | || |||||||| ||||||||| || | Sbjct: 9428188 ccagccggcccaggagtcactgctttggcgttctttcgcaggctcatccttcttgactgg 9428247 Query: 416 gtcatcccaatcatcccaagaattggaattgt 447 ||||||||||||||||| ||||||||||||| Sbjct: 9428248 ctcatcccaatcatcccaggaattggaattgt 9428279
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 111 bits (56), Expect = 2e-21 Identities = 174/212 (82%), Gaps = 6/212 (2%) Strand = Plus / Plus Query: 236 tcagcggaagccgccgtcggcccaatatgacccgccggcggttccattctgattgctccc 295 ||||||||||||||| || | |||||| || || |||| |||||| |||||||||||||| Sbjct: 125474 tcagcggaagccgccttccgtccaataggagccaccggtggttccgttctgattgctccc 125533 Query: 296 gctcttgttggcagggctgtgatggctgtaactatcaaaaccgtcatctttcgcatcgtc 355 |||| ||| | |||||||| |||||||||||||| |||||| ||| |||| || Sbjct: 125534 ---cttgctgggggtgctgtgat---tgtaactatcaaaattgtcatccttcccatcatc 125587 Query: 356 ccagccggcccacgagtcgctgccctgacttgtcttggcaggctcttccttcttgtcttg 415 |||||||||||| ||||| |||| || | | || |||||||| ||||||||| || | Sbjct: 125588 ccagccggcccaggagtcactgctttggcgttctttcgcaggctcatccttcttgactgg 125647 Query: 416 gtcatcccaatcatcccaagaattggaattgt 447 ||||||||||||||||| ||||||||||||| Sbjct: 125648 ctcatcccaatcatcccaggaattggaattgt 125679
>gb|AY224461.1| Oryza sativa (japonica cultivar-group) isolate 23497 ADP ribosylation GTPase-like protein mRNA, partial cds Length = 927 Score = 111 bits (56), Expect = 2e-21 Identities = 174/212 (82%), Gaps = 6/212 (2%) Strand = Plus / Minus Query: 236 tcagcggaagccgccgtcggcccaatatgacccgccggcggttccattctgattgctccc 295 ||||||||||||||| || | |||||| || || |||| |||||| |||||||||||||| Sbjct: 927 tcagcggaagccgccttccgtccaataggagccaccggtggttccgttctgattgctccc 868 Query: 296 gctcttgttggcagggctgtgatggctgtaactatcaaaaccgtcatctttcgcatcgtc 355 |||| ||| | |||||||| |||||||||||||| |||||| ||| |||| || Sbjct: 867 ---cttgctgggggtgctgtgat---tgtaactatcaaaattgtcatccttcccatcatc 814 Query: 356 ccagccggcccacgagtcgctgccctgacttgtcttggcaggctcttccttcttgtcttg 415 |||||||||||| ||||| |||| || | | || |||||||| ||||||||| || | Sbjct: 813 ccagccggcccaggagtcactgctttggcgttctttcgcaggctcatccttcttgactgg 754 Query: 416 gtcatcccaatcatcccaagaattggaattgt 447 ||||||||||||||||| ||||||||||||| Sbjct: 753 ctcatcccaatcatcccaggaattggaattgt 722
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 111 bits (56), Expect = 2e-21 Identities = 174/212 (82%), Gaps = 6/212 (2%) Strand = Plus / Plus Query: 236 tcagcggaagccgccgtcggcccaatatgacccgccggcggttccattctgattgctccc 295 ||||||||||||||| || | |||||| || || |||| |||||| |||||||||||||| Sbjct: 9426195 tcagcggaagccgccttccgtccaataggagccaccggtggttccgttctgattgctccc 9426254 Query: 296 gctcttgttggcagggctgtgatggctgtaactatcaaaaccgtcatctttcgcatcgtc 355 |||| ||| | |||||||| |||||||||||||| |||||| ||| |||| || Sbjct: 9426255 ---cttgctgggggtgctgtgat---tgtaactatcaaaattgtcatccttcccatcatc 9426308 Query: 356 ccagccggcccacgagtcgctgccctgacttgtcttggcaggctcttccttcttgtcttg 415 |||||||||||| ||||| |||| || | | || |||||||| ||||||||| || | Sbjct: 9426309 ccagccggcccaggagtcactgctttggcgttctttcgcaggctcatccttcttgactgg 9426368 Query: 416 gtcatcccaatcatcccaagaattggaattgt 447 ||||||||||||||||| ||||||||||||| Sbjct: 9426369 ctcatcccaatcatcccaggaattggaattgt 9426400
>dbj|AK070052.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040P09, full insert sequence Length = 1888 Score = 111 bits (56), Expect = 2e-21 Identities = 174/212 (82%), Gaps = 6/212 (2%) Strand = Plus / Minus Query: 236 tcagcggaagccgccgtcggcccaatatgacccgccggcggttccattctgattgctccc 295 ||||||||||||||| || | |||||| || || |||| |||||| |||||||||||||| Sbjct: 1378 tcagcggaagccgccttccgtccaataggagccaccggtggttccgttctgattgctccc 1319 Query: 296 gctcttgttggcagggctgtgatggctgtaactatcaaaaccgtcatctttcgcatcgtc 355 |||| ||| | |||||||| |||||||||||||| |||||| ||| |||| || Sbjct: 1318 ---cttgctgggggtgctgtgat---tgtaactatcaaaattgtcatccttcccatcatc 1265 Query: 356 ccagccggcccacgagtcgctgccctgacttgtcttggcaggctcttccttcttgtcttg 415 |||||||||||| ||||| |||| || | | || |||||||| ||||||||| || | Sbjct: 1264 ccagccggcccaggagtcactgctttggcgttctttcgcaggctcatccttcttgactgg 1205 Query: 416 gtcatcccaatcatcccaagaattggaattgt 447 ||||||||||||||||| ||||||||||||| Sbjct: 1204 ctcatcccaatcatcccaggaattggaattgt 1173
>gb|AY596524.1| Saccharum officinarum clone SCCCLR1079D12, complete sequence Length = 1757 Score = 91.7 bits (46), Expect = 2e-15 Identities = 109/130 (83%) Strand = Plus / Minus Query: 327 ctatcaaaaccgtcatctttcgcatcgtcccagccggcccacgagtcgctgccctgactt 386 ||||||||||| ||||| ||| |||| |||||||| ||||| ||||| |||| ||| Sbjct: 1361 ctatcaaaaccatcatccttcccatcatcccagccagcccaggagtcactgctctggtgc 1302 Query: 387 gtcttggcaggctcttccttcttgtcttggtcatcccaatcatcccaagaattggaattg 446 | || |||||||| ||||||||| ||||||||||||||| ||||||||| |||||||| Sbjct: 1301 ggttttgcaggctcatccttcttgcattggtcatcccaatcgtcccaagaactggaattg 1242 Query: 447 tggttcttcg 456 | |||||||| Sbjct: 1241 ttgttcttcg 1232
>gb|AY107443.1| Zea mays PCO116581 mRNA sequence Length = 832 Score = 58.0 bits (29), Expect = 3e-05 Identities = 98/121 (80%) Strand = Plus / Minus Query: 327 ctatcaaaaccgtcatctttcgcatcgtcccagccggcccacgagtcgctgccctgactt 386 ||||||||||| ||||| ||| |||| |||||||| ||||| ||||| |||| ||| Sbjct: 491 ctatcaaaaccatcatccttcccatcatcccagccagcccaggagtcactgctctggtgc 432 Query: 387 gtcttggcaggctcttccttcttgtcttggtcatcccaatcatcccaagaattggaattg 446 | || |||||||| || |||||| || |||| ||||| || ||||||||| |||||||| Sbjct: 431 ggtttcgcaggctcatctttcttgcctgggtcgtcccagtcgtcccaagaactggaattg 372 Query: 447 t 447 | Sbjct: 371 t 371
>emb|AJ243174.2|PFL243174 Pseudomonas fluorescens fumC (partial), ORF1, bolA, ORF3, ORF4, and abcX (partial) genes Length = 3997 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 483 ccgttgctgttgccattgctggt 505 ||||||||||||||||||||||| Sbjct: 3345 ccgttgctgttgccattgctggt 3367
>emb|BX927168.11| Human DNA sequence from clone DAMA-367I24 on chromosome 6, complete sequence Length = 109326 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttcttgt 411 |||||||||||||||||||||| Sbjct: 18439 ttggcaggctcttccttcttgt 18418
>ref|XM_393424.2| PREDICTED: Apis mellifera similar to ENSANGP00000020223 (LOC409932), mRNA Length = 2406 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 477 ttccagccgttgctgttgccattgct 502 |||||||||||||||||||| ||||| Sbjct: 218 ttccagccgttgctgttgccgttgct 193
>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence Length = 2906179 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 gctggatggcagtttcaaatga 54 |||||||||||||||||||||| Sbjct: 435389 gctggatggcagtttcaaatga 435410
>gb|AC093047.1| Drosophila melanogaster, chromosome 2L, region 38D-38E, BAC clone BACR31P14, complete sequence Length = 156806 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 485 gttgctgttgccattgctggt 505 ||||||||||||||||||||| Sbjct: 97664 gttgctgttgccattgctggt 97684
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete sequence Length = 4332241 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 388 tcttggcaggctcttccttct 408 ||||||||||||||||||||| Sbjct: 4054332 tcttggcaggctcttccttct 4054312
>gb|AE003667.3| Drosophila melanogaster chromosome 2L, section 76 of 83 of the complete sequence Length = 257666 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 485 gttgctgttgccattgctggt 505 ||||||||||||||||||||| Sbjct: 215686 gttgctgttgccattgctggt 215706
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome I, complete sequence Length = 4277185 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 388 tcttggcaggctcttccttct 408 ||||||||||||||||||||| Sbjct: 3992914 tcttggcaggctcttccttct 3992894
>gb|AC004759.1|AC004759 Drosophila melanogaster DNA sequence (P1s DS04217 (D56) and DS00582 (D85)), complete sequence Length = 142799 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 485 gttgctgttgccattgctggt 505 ||||||||||||||||||||| Sbjct: 121269 gttgctgttgccattgctggt 121249
>ref|XM_527070.1| PREDICTED: Pan troglodytes similar to PGC-1-related estrogen receptor alpha coactivator (LOC471692), mRNA Length = 4485 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 cagccggcccacgagtcgct 376 |||||||||||||||||||| Sbjct: 36 cagccggcccacgagtcgct 55
>ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (MG05326.4) partial mRNA Length = 1512 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 482 gccgttgctgttgccattgctggt 505 |||||||| ||||||||||||||| Sbjct: 189 gccgttgccgttgccattgctggt 166
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 483 ccgttgctgttgccattgctggtc 506 |||||||||||||| ||||||||| Sbjct: 1902160 ccgttgctgttgccgttgctggtc 1902183
>gb|AY663415.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA03715 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0103 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 100761 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 15741 ttggcaggctcttccttctt 15760
>gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA03715 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0103 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 118048 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 40235 ttggcaggctcttccttctt 40254
>gb|AY663413.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14663 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 117527 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 31729 ttggcaggctcttccttctt 31748
>gb|AY663412.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA00576 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*110101 allele, complete cds Length = 108785 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11201 ttggcaggctcttccttctt 11220
>gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14663 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 99966 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11248 ttggcaggctcttccttctt 11267
>gb|AY663410.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA00576 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*030302 allele and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0302 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 105171 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 32421 ttggcaggctcttccttctt 32440
>gb|AY663409.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA04535 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 77506 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11649 ttggcaggctcttccttctt 11668
>gb|AY663408.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA04535 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010401 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*140501 allele, complete cds Length = 100515 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 9909 ttggcaggctcttccttctt 9928
>gb|AY663407.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 106318 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 21802 ttggcaggctcttccttctt 21821
>gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*150101 allele, complete cds Length = 103395 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 22221 ttggcaggctcttccttctt 22240
>gb|AY663405.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10540 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010401 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 116082 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 12238 ttggcaggctcttccttctt 12257
>gb|AY663404.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10540 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*030302 allele and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0302 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 109441 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 37715 ttggcaggctcttccttctt 37734
>gb|AY663403.1| Gorilla gorilla voucher Coriell Cell Repository DNA sample NG05251 MHC class II antigen (HLA-DQB1) and MHC class II antigen (HLA-DQA1) genes, complete cds Length = 70727 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 35343 ttggcaggctcttccttctt 35362
>gb|AY663401.1| Pan troglodytes voucher Coriell Cell Repository DNA sample NS03646 MHC class II antigen (HLA-DQB1), MHC class II antigen (HLA-DQA1), and MHC class II antigen (HLA-DRB1) genes, complete cds Length = 111437 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 16759 ttggcaggctcttccttctt 16778
>gb|AY663400.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01018 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*050101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010102 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 143390 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 42169 ttggcaggctcttccttctt 42188
>gb|AY663399.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01018 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 105464 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 15117 ttggcaggctcttccttctt 15136
>gb|AY663398.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01960 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*030201 allele and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*030101 allele, complete cds Length = 73220 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 17743 ttggcaggctcttccttctt 17762
>gb|AY663397.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01960 MHC class II antigen (HLA-DQB1), MHC class II antigen (HLA-DQA1), and MHC class II antigen (HLA-DRB1) genes, complete cds Length = 94591 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11403 ttggcaggctcttccttctt 11422
>gb|AY663396.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14660 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*050101 allele and MHC class II antigen (HLA-DQA1) gene, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 100091 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 21881 ttggcaggctcttccttctt 21900
>gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14660 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 104996 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11107 ttggcaggctcttccttctt 11126
>gb|AY663394.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14661 MHC class II antigen (HLA-DQB1) gene, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*110401 allele, complete cds Length = 127159 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 30665 ttggcaggctcttccttctt 30684
>gb|AY663393.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14661 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0303 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 78546 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 11649 ttggcaggctcttccttctt 11668
>ref|XM_755583.1| Ustilago maydis 521 hypothetical protein (UM04529.1) partial mRNA Length = 5004 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 412 cttggtcatcccaatcatcc 431 |||||||||||||||||||| Sbjct: 244 cttggtcatcccaatcatcc 225
>ref|XM_389049.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08873.1) partial mRNA Length = 1737 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 482 gccgttgctgttgccattgc 501 |||||||||||||||||||| Sbjct: 1329 gccgttgctgttgccattgc 1310
>gb|AC111008.6| Mus musculus BAC clone RP23-415J21 from chromosome 7, complete sequence Length = 193593 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 tatcctgaaataataaccaccacc 167 ||||||||||||||| |||||||| Sbjct: 111113 tatcctgaaataatacccaccacc 111136
>emb|AL731683.12| Human DNA sequence from clone XXbac-254C11 on chromosome 6, complete sequence Length = 83878 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 16707 ttggcaggctcttccttctt 16688
>emb|Z84489.1|HS93N13 Human DNA sequence from clone RP1-93N13 on chromosome 6p21 Contains the HLA-DRB1*03011 and HLA-DQA1*05011 genes for major histocompatibility complex class II DR beta 1 and DQ alpha 1, a CpG island, ESTs, STSs and GSSs, complete sequence Length = 86896 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 1599 ttggcaggctcttccttctt 1618
>emb|BX248406.4| Human DNA sequence from clone DASS-390M22 on chromosome 6, complete sequence Length = 124787 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 35070 ttggcaggctcttccttctt 35051
>emb|AL935026.4| Human DNA sequence from clone DAQB-109B10 on chromosome 6 Contains the HLA-DQA1 gene for the major histocompatibility complex, class II, DQ alpha 1 protein, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1 protein and one CpG island, complete sequence Length = 39179 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 19384 ttggcaggctcttccttctt 19365
>emb|AL662789.11| Human DNA sequence from clone XXbac-254F23 on chromosome 6 contains the 5' end of the HLA-DRB1 gene for major histocompatibility complex, class II, DR beta 1, the HLA-DQA1 gene for major histocompatibility complex, class II, DQ alpha 1, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1, a cytochrome C oxidase polypeptide III pseudogene, a major histocompatibility complex, class II, beta polypeptide pseudogene and two CpG islands, complete sequence Length = 147557 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 70316 ttggcaggctcttccttctt 70297
>ref|XM_786947.1| PREDICTED: Strongylocentrotus purpuratus similar to High mobility group protein 2 (HMG-2) (LOC587204), mRNA Length = 2882 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tttctggcatataacaattc 201 |||||||||||||||||||| Sbjct: 2478 tttctggcatataacaattc 2459
>gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosome 7, complete sequence Length = 213870 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 tatcctgaaataataaccaccacc 167 ||||||||||||||| |||||||| Sbjct: 167969 tatcctgaaataatacccaccacc 167992
>emb|AL031863.1|DMCEG0003 Drosophila melanogaster cosmid EG0003 Length = 37688 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 8490 gccgccgtcggcccaatatg 8509
>emb|CR753846.4| Human DNA sequence from clone DADB-249P12 on chromosome 6, complete sequence Length = 128049 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 20503 ttggcaggctcttccttctt 20484
>emb|CR933859.5| Human DNA sequence from clone DAMC-134I7 on chromosome 6, complete sequence Length = 83682 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 30511 ttggcaggctcttccttctt 30492
>emb|AL663031.15| Mouse DNA sequence from clone RP23-29H5 on chromosome 11 Contains the 3' end of the Sox30 gene for SRY-box containing gene 30, a large ribosomal protein (Rplp1) P1 pseudogene, a novel gene, the Adam19 gene for a disintegrin and metalloproteinase domain 19 (meltrin beta), the 3' end of a novel gene and a CpG island, complete sequence Length = 181021 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 caggctcttccttcttgtct 413 |||||||||||||||||||| Sbjct: 156727 caggctcttccttcttgtct 156708
>emb|CR753901.9| Human DNA sequence from clone DADB-166N19 on chromosome 6, complete sequence Length = 110625 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 49175 ttggcaggctcttccttctt 49156
>gb|AC010049.7| Drosophila melanogaster 3L BAC RPCI98-3O18 (Roswell Park Cancer Institute Drosophila BAC library) complete sequence Length = 168058 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 157395 ccgttgctgttgctattgctgttctcct 157368
>dbj|AK097297.1| Homo sapiens cDNA FLJ39978 fis, clone SPLEN2029380 Length = 2291 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 1087 ttggcaggctcttccttctt 1106
>ref|NM_168912.1| Drosophila melanogaster CG7597-RB, transcript variant B (CG7597), mRNA Length = 5051 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 2429 ccgttgctgttgctattgctgttctcct 2402
>ref|NM_141068.2| Drosophila melanogaster CG7597-RA, transcript variant A (CG7597), mRNA Length = 4773 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 2151 ccgttgctgttgctattgctgttctcct 2124
>ref|NM_137319.2| Drosophila melanogaster CG6426-RA (CG6426), mRNA Length = 726 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 342 gccgccgtcggcccaatatg 323
>gb|AC010701.3| Drosophila melanogaster 3L BAC RP98-26P10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174920 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 150787 ccgttgctgttgctattgctgttctcct 150814
>gb|AY071664.1| Drosophila melanogaster RH01665 full length cDNA Length = 735 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 341 gccgccgtcggcccaatatg 322
>gb|AY069806.1| Drosophila melanogaster SD04681 full length cDNA Length = 4197 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 2087 ccgttgctgttgctattgctgttctcct 2060
>ref|XM_945818.1| PREDICTED: Homo sapiens similar to HLA class II histocompatibility antigen, DQ(W1.1) beta chain precursor (DQB1*0501), transcript variant 2 (LOC650557), mRNA Length = 5741 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 3168 ttggcaggctcttccttctt 3187
>ref|XM_942240.1| PREDICTED: Homo sapiens similar to HLA class II histocompatibility antigen, DQ(W1.1) beta chain precursor (DQB1*0501), transcript variant 1 (LOC650557), mRNA Length = 6217 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 3644 ttggcaggctcttccttctt 3663
>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone BACR09M08, complete sequence Length = 179283 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 20576 gccgccgtcggcccaatatg 20557
>gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53E-54X, BAC clone BACR03E17, complete sequence Length = 160338 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 125225 gccgccgtcggcccaatatg 125206
>gb|AC148700.1| Macaca mulatta Major Histocompatibility Complex BAC MMU281E18, complete sequence Length = 188725 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 110129 ttggcaggctcttccttctt 110148
>gb|AC148661.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007H18, complete sequence Length = 215614 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 156986 ttggcaggctcttccttctt 156967
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 482 gccgttgctgttgccattgc 501 |||||||||||||||||||| Sbjct: 17042054 gccgttgctgttgccattgc 17042073
>gb|AC022100.7| Homo sapiens chromosome 5 clone CTB-66A9, complete sequence Length = 149603 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 cagccggcccacgagtcgct 376 |||||||||||||||||||| Sbjct: 30670 cagccggcccacgagtcgct 30651
>gb|AC069145.5|AC069145 Oryza sativa chromosome 10 BAC OSJNBb0094K03 genomic sequence, complete sequence Length = 135216 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 482 gccgttgctgttgccattgc 501 |||||||||||||||||||| Sbjct: 82546 gccgttgctgttgccattgc 82565
>gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45 of 73 of the complete sequence Length = 272948 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 139073 gccgccgtcggcccaatatg 139054
>gb|AE003594.3| Drosophila melanogaster chromosome 3L, section 75 of 83 of the complete sequence Length = 314904 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 483 ccgttgctgttgccattgctggtctcct 510 ||||||||||||| ||||||| |||||| Sbjct: 253997 ccgttgctgttgctattgctgttctcct 253970
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 482 gccgttgctgttgccattgc 501 |||||||||||||||||||| Sbjct: 17051094 gccgttgctgttgccattgc 17051113
>gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s DS07321 (D175), DS05993 (D241), and DS06306 (D173)), complete sequence Length = 154985 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 gccgccgtcggcccaatatg 264 |||||||||||||||||||| Sbjct: 85221 gccgccgtcggcccaatatg 85240
>gb|U92032.1|HSU92032 Homo sapiens P1 clone 797a11 containing MHC class II DQ-beta (HLA-DQB) and MHC class II DC-alpha (HLA-DCA) genes, complete cds Length = 86217 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 ttggcaggctcttccttctt 409 |||||||||||||||||||| Sbjct: 50094 ttggcaggctcttccttctt 50113
>gb|U46195.1|PAU46195 Pichia angusta Per10p (PER10) gene, complete cds, and tRNA-Asn gene, complete sequence Length = 3201 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 475 aattccagccgttgctgttgccat 498 |||||| ||||||||||||||||| Sbjct: 857 aattcctgccgttgctgttgccat 834 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,266,367 Number of Sequences: 3902068 Number of extensions: 4266367 Number of successful extensions: 76054 Number of sequences better than 10.0: 79 Number of HSP's better than 10.0 without gapping: 79 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75787 Number of HSP's gapped (non-prelim): 267 length of query: 522 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 499 effective length of database: 17,143,297,704 effective search space: 8554505554296 effective search space used: 8554505554296 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)