ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart31h11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB058923.1| Hordeum vulgare mRNA for protein kinase HvPKABA1... 955 0.0
2dbj|AB058924.1| Hordeum vulgare gene for protein kinase HvPKABA1... 920 0.0
3gb|M94726.1|M94726 Triticum aestivum protein kinase mRNA, partia... 462 e-127
4gb|U29095.1|U29095 Triticum aestivum serine-threonine protein ki... 422 e-115
5ref|XM_470803.1| Oryza sativa (japonica cultivar-group), mRNA 196 5e-47
6dbj|AB125302.1| Oryza sativa (japonica cultivar-group) SAPK1 mRN... 196 5e-47
7dbj|AK068899.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 5e-47
8dbj|AK060856.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 5e-47
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 161 3e-36
10gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom... 161 3e-36
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
12gb|AY108950.1| Zea mays PCO069505 mRNA sequence 135 2e-28
13dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
14dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
15ref|NM_189878.2| Oryza sativa (japonica cultivar-group), mRNA 80 8e-12
16ref|XM_506481.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 8e-12
17gb|AY207043.1| Oryza sativa (indica cultivar-group) abcisic acid... 80 8e-12
18dbj|AB125303.1| Oryza sativa (japonica cultivar-group) sapk2 mRN... 80 8e-12
19dbj|AK103945.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
20dbj|AK070965.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
21gb|AY107474.1| Zea mays PCO105841 mRNA sequence 76 1e-10
22gb|AY714526.1| Aegilops tauschii protein kinase 1 mRNA, complete... 72 2e-09
23gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence 66 1e-07
24gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence 42 1.7
25gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence 42 1.7
26gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, r... 42 1.7
27gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, r... 42 1.7
28gb|AC154430.3| Mus musculus BAC clone RP24-208K8 from chromosome... 42 1.7
29gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70... 42 1.7
30gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome... 40 6.6
31gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, co... 40 6.6
32ref|NM_019576.1| Mus musculus thrombospondin, type I, domain 1 (... 40 6.6
33gb|BC051957.1| Mus musculus thrombospondin, type I, domain 1, mR... 40 6.6
34gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosom... 40 6.6
35ref|XM_765844.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 6.6
36gb|AY316305.1| Homo sapiens glutathione transferase zeta 1 (male... 40 6.6
37dbj|AK094344.1| Homo sapiens cDNA FLJ37025 fis, clone BRACE20108... 40 6.6
38gb|AC148755.6| Medicago truncatula clone mth2-24n16, complete se... 40 6.6
39gb|AC090282.6| Homo sapiens chromosome 17, clone CTD-2309O5, com... 40 6.6
40dbj|AK052555.1| Mus musculus 13 days embryo stomach cDNA, RIKEN ... 40 6.6
41emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on ch... 40 6.6
42dbj|AK049636.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 40 6.6
43dbj|AK014758.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 40 6.6
44dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
45dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
46dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
47dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.6
48gb|AC007954.7|AC007954 Homo sapiens chromosome 14 clone RP11-493... 40 6.6
49gb|AF053543.1|HSGSTZ1G5 Homo sapiens glutathione transferase zet... 40 6.6
50gb|AF116597.1|AF116597 Metarhizium anisopliae cAMP-dependent pro... 40 6.6
51emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4,... 40 6.6
52dbj|AB039946.1| Mus musculus TMTSP mRNA for transmembrane molecu... 40 6.6 
>dbj|AB058923.1| Hordeum vulgare mRNA for protein kinase HvPKABA1, complete cds,
            cultivar:Himalaya
          Length = 1329

 Score =  955 bits (482), Expect = 0.0
 Identities = 488/490 (99%)
 Strand = Plus / Minus

                                                                        
Query: 2    cttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttctacacggca 61
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1329 cttaactagtgatttcgatattcgcatgtaaacttgtctcgtactggtttctacacggca 1270

                                                                        
Query: 62   aggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaagcacgacaa 121
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1269 aggccgatctgtgcagcacacagaaaatatgtgatccggaagaaaatcgaagcacgacaa 1210

                                                                        
Query: 122  acagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacgg 181
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1209 acagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacgg 1150

                                                                        
Query: 182  gcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgtc 241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1149 gcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgtc 1090

                                                                        
Query: 242  tagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccgg 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1089 tagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccgg 1030

                                                                        
Query: 302  tttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcat 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1029 tttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcat 970

                                                                        
Query: 362  gtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgag 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 969  gtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgag 910

                                                                        
Query: 422  gaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttccaacgaa 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 909  gaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttccaacgaa 850

                      
Query: 482  aatgcgggac 491
            ||||||||||
Sbjct: 849  aatgcgggac 840
to top
>dbj|AB058924.1| Hordeum vulgare gene for protein kinase HvPKABA1, complete cds,
             cultivar:Igri
          Length = 11684

 Score =  920 bits (464), Expect = 0.0
 Identities = 464/464 (100%)
 Strand = Plus / Minus

                                                                         
Query: 1     ccttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttctacacggc 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10943 ccttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttctacacggc 10884

                                                                         
Query: 61    aaggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaagcacgaca 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10883 aaggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaagcacgaca 10824

                                                                         
Query: 121   aacagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacg 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10823 aacagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacg 10764

                                                                         
Query: 181   ggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgt 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10763 ggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgt 10704

                                                                         
Query: 241   ctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccg 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10703 ctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccg 10644

                                                                         
Query: 301   gtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttca 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10643 gtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttca 10584

                                                                         
Query: 361   tgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttga 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10583 tgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttga 10524

                                                         
Query: 421   ggaaccatggatggttcttgatctccgggatggttattcgctgc 464
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10523 ggaaccatggatggttcttgatctccgggatggttattcgctgc 10480



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                            
Query: 461   ctgctgaggatttccaacgaaaatgcgggac 491
             |||||||||||||||||||||||||||||||
Sbjct: 10292 ctgctgaggatttccaacgaaaatgcgggac 10262
to top
>gb|M94726.1|M94726 Triticum aestivum protein kinase mRNA, partial cds
          Length = 1210

 Score =  462 bits (233), Expect = e-127
 Identities = 344/378 (91%), Gaps = 6/378 (1%)
 Strand = Plus / Minus

                                                                        
Query: 120  aaacagggatccatccacagctaaaccaccaaga--acttctaaacc---catcagca-t 173
            ||||||||||||||||||||  |||||| |||||  |||| | ||||   ||| |||| |
Sbjct: 1058 aaacagggatccatccacaggcaaaccatcaagagaacttttgaaccactcatgagcaat 999

                                                                        
Query: 174  cacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatca 233
            ||||||||||||||||| ||||||||| |||||| ||||||||||||||  |||||||| 
Sbjct: 998  cacaacgggcacacgaaatccccgctgctctcaacgtcaatgtcgtcgatatcgaaatcg 939

                                                                        
Query: 234  atgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgtta 293
            |||||||| | |||||||||||||||||||||||||||||| |||| |||||||||||||
Sbjct: 938  atgtcgtccaaatccatgctccccaggcaggcaacctgcccggcaacccctagggcgtta 879

                                                                        
Query: 294  tgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggc 353
            |  || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 878  tcgccaggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgtgacggc 819

                                                                        
Query: 354  gtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcagg 413
            |||||||||||||||| |||||||| |||||||||||| || ||||||||||||||||  
Sbjct: 818  gtgttcatgtctgccagctgcatgctcctttggtactcatcggtcatctcaacgggcaat 759

                                                                        
Query: 414  cgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggattt 473
            |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 758  ctcttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggattt 699

                              
Query: 474  ccaacgaaaatgcgggac 491
            ||||||||||||||||||
Sbjct: 698  ccaacgaaaatgcgggac 681



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 5    aactagtgatttcgatattcgcatgtaaactt 36
            ||||| ||||||||||||  ||||||||||||
Sbjct: 1173 aactactgatttcgatataagcatgtaaactt 1142
to top
>gb|U29095.1|U29095 Triticum aestivum serine-threonine protein kinase (TaPK3) gene, exons
            3 through 9 and complete cds
          Length = 2250

 Score =  422 bits (213), Expect = e-115
 Identities = 279/299 (93%), Gaps = 4/299 (1%)
 Strand = Plus / Minus

                                                                        
Query: 169  agcatcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcga---cgt 225
            |||||||||||||||||||||| ||||||||||||||||| || ||||||||||   |||
Sbjct: 1961 agcatcacaacgggcacacgaaatccccgctgttctcaat-tcgatgtcgtcgatgtcgt 1903

                                                                        
Query: 226  cgaaatcaatgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagcccta 285
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 1902 cgaaatcaatgtcatctagatccatgctccccaggcaggcaacctgcccagcaattccta 1843

                                                                        
Query: 286  gggcgttatgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctct 345
            ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||| |||||
Sbjct: 1842 gggcgttatcacccggtttctgtgcctcgtggatgatcgccatggcttcttccatgctct 1783

                                                                        
Query: 346  gcgacggcgtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaa 405
            | ||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||
Sbjct: 1782 gtgacggcgtgttcatgtctgccaactgcatgctcctttggtactcatcggtcatctcaa 1723

                                                                       
Query: 406  cgggcaggcgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 464
            |||||||  |||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1722 cgggcagttgtttgaggaaccatggatggttcttgatctccggcatggttattcgctgc 1664



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 461  ctgctgaggatttccaacgaaaatgcgggac 491
            ||||||||||||||||| |||||||||||||
Sbjct: 1597 ctgctgaggatttccaatgaaaatgcgggac 1567



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 56/65 (86%), Gaps = 6/65 (9%)
 Strand = Plus / Minus

                                                                        
Query: 81   acagaaaatatgtgatccggaagaaaatcgaa-----gcacgacaaa-cagggatccatc 134
            |||||||||||||||||| |||||||||| ||     ||| |||||| ||||||||||||
Sbjct: 2060 acagaaaatatgtgatccagaagaaaatccaacccaagcatgacaaaacagggatccatc 2001

                 
Query: 135  cacag 139
            |||||
Sbjct: 2000 cacag 1996
to top
>ref|XM_470803.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1468

 Score =  196 bits (99), Expect = 5e-47
 Identities = 171/195 (87%)
 Strand = Plus / Minus

                                                                        
Query: 297  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1112 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1053

                                                                        
Query: 357  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1052 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 993

                                                                        
Query: 417  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 476
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 992  ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 933

                           
Query: 477  acgaaaatgcgggac 491
            |||||||| ||||||
Sbjct: 932  acgaaaatccgggac 918



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 172  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1237 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1181

                                                       
Query: 232  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1180 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1138
to top
>dbj|AB125302.1| Oryza sativa (japonica cultivar-group) SAPK1 mRNA for
            serine/threonine protein kinase SAPK1, complete cds
          Length = 1471

 Score =  196 bits (99), Expect = 5e-47
 Identities = 171/195 (87%)
 Strand = Plus / Minus

                                                                        
Query: 297  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1141 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1082

                                                                        
Query: 357  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1081 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 1022

                                                                        
Query: 417  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 476
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 1021 ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 962

                           
Query: 477  acgaaaatgcgggac 491
            |||||||| ||||||
Sbjct: 961  acgaaaatccgggac 947



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 172  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1266 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1210

                                                       
Query: 232  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1209 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1167
to top
>dbj|AK068899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G01, full
            insert sequence
          Length = 1674

 Score =  196 bits (99), Expect = 5e-47
 Identities = 171/195 (87%)
 Strand = Plus / Minus

                                                                        
Query: 297  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1122 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1063

                                                                        
Query: 357  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1062 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 1003

                                                                        
Query: 417  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 476
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 1002 ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 943

                           
Query: 477  acgaaaatgcgggac 491
            |||||||| ||||||
Sbjct: 942  acgaaaatccgggac 928



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 172  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1247 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1191

                                                       
Query: 232  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1190 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1148
to top
>dbj|AK060856.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-F03, full
            insert sequence
          Length = 1390

 Score =  196 bits (99), Expect = 5e-47
 Identities = 171/195 (87%)
 Strand = Plus / Minus

                                                                        
Query: 297  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1079 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1020

                                                                        
Query: 357  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1019 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 960

                                                                        
Query: 417  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 476
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 959  ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 900

                           
Query: 477  acgaaaatgcgggac 491
            |||||||| ||||||
Sbjct: 899  acgaaaatccgggac 885



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 172  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1204 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1148

                                                       
Query: 232  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1147 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1105
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Plus

                                                                            
Query: 297      cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
                ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 15466845 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 15466904

                                                                            
Query: 357      ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
                |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 15466905 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 15466964

                                                         
Query: 417      ttgaggaaccatggatggttcttgatctccgggatggttat 457
                || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 15466965 ttcaggaaccatgggtggttcttgatctctgggatagttat 15467005



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                            
Query: 172      atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
                ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 15466720 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 15466776

                                                           
Query: 232      caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
                | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 15466777 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 15466819



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 461      ctgctgaggatttccaacgaaaatgcgggac 491
                ||||| |||||||||||||||||| ||||||
Sbjct: 15467132 ctgctcaggatttccaacgaaaatccgggac 15467162
to top
>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete
             sequence
          Length = 164705

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Minus

                                                                         
Query: 297   cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
             ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 34681 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 34622

                                                                         
Query: 357   ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
             |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 34621 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 34562

                                                      
Query: 417   ttgaggaaccatggatggttcttgatctccgggatggttat 457
             || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 34561 ttcaggaaccatgggtggttcttgatctctgggatagttat 34521



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                         
Query: 172   atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
             ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 34806 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 34750

                                                        
Query: 232   caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
             | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 34749 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 34707



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 461   ctgctgaggatttccaacgaaaatgcgggac 491
             ||||| |||||||||||||||||| ||||||
Sbjct: 34394 ctgctcaggatttccaacgaaaatccgggac 34364
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Plus

                                                                            
Query: 297      cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 356
                ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 15461379 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 15461438

                                                                            
Query: 357      ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 416
                |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 15461439 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 15461498

                                                         
Query: 417      ttgaggaaccatggatggttcttgatctccgggatggttat 457
                || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 15461499 ttcaggaaccatgggtggttcttgatctctgggatagttat 15461539



 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                            
Query: 172      atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 231
                ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 15461254 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 15461310

                                                           
Query: 232      caatgtcgtctagatccatgctccccaggcaggcaacctgccc 274
                | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 15461311 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 15461353



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 461      ctgctgaggatttccaacgaaaatgcgggac 491
                ||||| |||||||||||||||||| ||||||
Sbjct: 15461666 ctgctcaggatttccaacgaaaatccgggac 15461696
to top
>gb|AY108950.1| Zea mays PCO069505 mRNA sequence
          Length = 1328

 Score =  135 bits (68), Expect = 2e-28
 Identities = 146/172 (84%)
 Strand = Plus / Minus

                                                                        
Query: 307  gcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcatgtctg 366
            ||||||||||||||||||||||  | || |||||||| |||  ||| |||||||||||||
Sbjct: 1028 gcgcctcctggatgatcgccatcacctcctccaggctttgccccggggtgttcatgtctg 969

                                                                        
Query: 367  ccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgaggaacc 426
            |||||||||||| |   ||||||||||| |||||||| | ||||||    ||||||||||
Sbjct: 968  ccaactgcatgctctgctggtactcgtcggtcatctcgatgggcagattcttgaggaacc 909

                                                                
Query: 427  atggatggttcttgatctccgggatggttattcgctgctgaggatttccaac 478
            | || || ||||||||||| || |||||||||| ||||| ||||||||||||
Sbjct: 908  acgggtgcttcttgatctcaggaatggttattctctgctcaggatttccaac 857



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 71/82 (86%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                        
Query: 186  acgaagtccccgctgttctcaatgtcaatgtcgtcga---cgtcgaaatcaatgtcgtct 242
            |||||||| |||||||||||| |||| |||||||| |   |||| |||||||||||||| 
Sbjct: 1149 acgaagtcgccgctgttctcagtgtcgatgtcgtcaatatcgtcaaaatcaatgtcgtca 1090

                                  
Query: 243  agatccatgctccccaggcagg 264
            || |||| ||||||||||||||
Sbjct: 1089 aggtccacgctccccaggcagg 1068
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 137/169 (81%)
 Strand = Plus / Minus

                                                                            
Query: 296      acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
                |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 25668145 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 25668086

                                                                            
Query: 356      gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
                ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 25668085 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 25668026

                                                                 
Query: 416      tttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 464
                 |||||||||||||| |||||||||||||| || ||||| |||||||||
Sbjct: 25668025 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgctgc 25667977



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                 
Query: 173      tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
                |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 25668259 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 25668211
to top
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0594D10
          Length = 143200

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 137/169 (81%)
 Strand = Plus / Minus

                                                                          
Query: 296    acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
              |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 122118 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 122059

                                                                          
Query: 356    gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
              ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 122058 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 121999

                                                               
Query: 416    tttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 464
               |||||||||||||| |||||||||||||| || ||||| |||||||||
Sbjct: 121998 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgctgc 121950



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 173    tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
              |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 122232 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 122184
to top
>ref|NM_189878.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1398

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 296  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1128 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1069

                                                                        
Query: 356  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1068 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1009

                                                                        
Query: 416  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1008 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 949

                            
Query: 476  aacgaaaatgcgggac 491
             |||||||| ||||||
Sbjct: 948  cacgaaaatccgggac 933



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1242 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1194
to top
>ref|XM_506481.1| PREDICTED Oryza sativa (japonica cultivar-group), P0594D10.134 mRNA
          Length = 1414

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 296  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1130 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1071

                                                                        
Query: 356  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1070 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1011

                                                                        
Query: 416  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1010 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 951

                            
Query: 476  aacgaaaatgcgggac 491
             |||||||| ||||||
Sbjct: 950  cacgaaaatccgggac 935



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1244 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1196
to top
>gb|AY207043.1| Oryza sativa (indica cultivar-group) abcisic acid-inducible protein
           kinanase mRNA, partial cds
          Length = 1089

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                       
Query: 296 acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
           |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 949 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 890

                                                                       
Query: 356 gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
           ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 889 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 830

                                                                       
Query: 416 tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
            |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 829 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 770

                           
Query: 476 aacgaaaatgcgggac 491
            |||||||| ||||||
Sbjct: 769 cacgaaaatccgggac 754



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1063 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1015
to top
>dbj|AB125303.1| Oryza sativa (japonica cultivar-group) sapk2 mRNA for
            serine/threonine protein kinase SAPK2, complete cds
          Length = 1401

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 296  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1131 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1072

                                                                        
Query: 356  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1071 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1012

                                                                        
Query: 416  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1011 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 952

                            
Query: 476  aacgaaaatgcgggac 491
             |||||||| ||||||
Sbjct: 951  cacgaaaatccgggac 936



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1245 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1197
to top
>dbj|AK103945.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A05, full
            insert sequence
          Length = 1397

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 296  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1127 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1068

                                                                        
Query: 356  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1067 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1008

                                                                        
Query: 416  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1007 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 948

                            
Query: 476  aacgaaaatgcgggac 491
             |||||||| ||||||
Sbjct: 947  cacgaaaatccgggac 932



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1241 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1193
to top
>dbj|AK070965.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023068H23, full
            insert sequence
          Length = 1414

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 157/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 296  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 355
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1130 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1071

                                                                        
Query: 356  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 415
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1070 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1011

                                                                        
Query: 416  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 475
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1010 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 951

                            
Query: 476  aacgaaaatgcgggac 491
             |||||||| ||||||
Sbjct: 950  cacgaaaatccgggac 935



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 173  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 221
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1244 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1196
to top
>gb|AY107474.1| Zea mays PCO105841 mRNA sequence
          Length = 970

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 384 tggtactcgtctgtcatctcaacgggcaggcgtttgaggaaccatggatggttcttgatc 443
           ||||||||||| |||||||| | |||||||   || ||||||||||| ||||||||||||
Sbjct: 495 tggtactcgtcggtcatctcgatgggcaggttcttcaggaaccatgggtggttcttgatc 436

                         
Query: 444 tccgggatggttat 457
           || |||||||||||
Sbjct: 435 tctgggatggttat 422
to top
>gb|AY714526.1| Aegilops tauschii protein kinase 1 mRNA, complete cds
          Length = 1438

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                        
Query: 384  tggtactcgtctgtcatctcaacgggcaggcgtttgaggaaccatggatggttcttgatc 443
            ||||||||||| |||||||| |  |||||    ||||||||||| || ||||||||||||
Sbjct: 1036 tggtactcgtcggtcatctcgatcggcagattcttgaggaaccacgggtggttcttgatc 977

                                                            
Query: 444  tccgggatggttattcgctgctgaggatttccaacgaaaatgcgggac 491
            ||  ||||||||||||| |||| ||| ||| | |||||||| ||||||
Sbjct: 976  tcttggatggttattcgttgctcagggtttgccacgaaaatccgggac 929



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 297  cccggtttctgcgcctcctggatgatcgccatg 329
            |||||| || |||||||||||||||| ||||||
Sbjct: 1123 cccggtatccgcgcctcctggatgatggccatg 1091
to top
>gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence
          Length = 1082

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 432  tggttcttgatctccgggatggttattcgctgc 464
            |||||||||||||||||||||||||||||||||
Sbjct: 1078 tggttcttgatctccgggatggttattcgctgc 1046



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 461 ctgctgaggatttccaacgaaaatgcgggac 491
           |||||||||||||||||||||||||||||||
Sbjct: 884 ctgctgaggatttccaacgaaaatgcgggac 854
to top
>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence
          Length = 103167

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 417   ttgaggaaccatggatggttcttgatctc 445
             |||| ||||||||||||| ||||||||||
Sbjct: 26525 ttgacgaaccatggatggctcttgatctc 26553
to top
>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence
          Length = 125927

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 417   ttgaggaaccatggatggttcttgatctc 445
             |||| ||||||||||||| ||||||||||
Sbjct: 93170 ttgacgaaccatggatggctcttgatctc 93198
to top
>gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR03E19, complete sequence
          Length = 167777

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 249   atgctccccaggcaggcaacc 269
             |||||||||||||||||||||
Sbjct: 93403 atgctccccaggcaggcaacc 93423
to top
>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR17A06, complete sequence
          Length = 170546

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 249   atgctccccaggcaggcaacc 269
             |||||||||||||||||||||
Sbjct: 43989 atgctccccaggcaggcaacc 44009
to top
>gb|AC154430.3| Mus musculus BAC clone RP24-208K8 from chromosome 16, complete sequence
          Length = 178222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 462   tgctgaggatttccaacgaaa 482
             |||||||||||||||||||||
Sbjct: 93397 tgctgaggatttccaacgaaa 93377
to top
>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the
            complete sequence
          Length = 265558

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 249  atgctccccaggcaggcaacc 269
            |||||||||||||||||||||
Sbjct: 9127 atgctccccaggcaggcaacc 9147
to top
>gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome 9, complete sequence
          Length = 193364

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   ctgcccagcaagccctaggg 288
             ||||||||||||||||||||
Sbjct: 63405 ctgcccagcaagccctaggg 63424
to top
>gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, complete sequence
          Length = 190317

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    ctgcccagcaagccctaggg 288
              ||||||||||||||||||||
Sbjct: 107126 ctgcccagcaagccctaggg 107107
to top
>ref|NM_019576.1| Mus musculus thrombospondin, type I, domain 1 (Thsd1), mRNA
          Length = 2815

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 2677 gtgcagcccacagaaagtatgtga 2654
to top
>gb|BC051957.1| Mus musculus thrombospondin, type I, domain 1, mRNA (cDNA clone
            IMAGE:6401753), containing frame-shift errors
          Length = 3261

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 2602 gtgcagcccacagaaagtatgtga 2579
to top
>gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosome 8, complete sequence
          Length = 182816

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 72    gtgcagcccacagaaaatatgtga 95
             |||||||||||||||| |||||||
Sbjct: 65385 gtgcagcccacagaaagtatgtga 65408
to top
>ref|XM_765844.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_608_54498_53302) partial mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 428 tggatggttcttgatctccg 447
           ||||||||||||||||||||
Sbjct: 774 tggatggttcttgatctccg 755
to top
>gb|AY316305.1| Homo sapiens glutathione transferase zeta 1 (maleylacetoacetate
             isomerase) (GSTZ1) gene, complete cds
          Length = 12743

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 69    tctgtgcagcccacagaaaatatgtgat 96
             ||||||||||||| ||||||| ||||||
Sbjct: 10027 tctgtgcagcccaaagaaaatctgtgat 10000
to top
>dbj|AK094344.1| Homo sapiens cDNA FLJ37025 fis, clone BRACE2010888, weakly similar
           to MALEYLACETOACETATE ISOMERASE (EC 5.2.1.2)
          Length = 2338

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  tctgtgcagcccacagaaaatatgtgat 96
           ||||||||||||| ||||||| ||||||
Sbjct: 684 tctgtgcagcccaaagaaaatctgtgat 657
to top
>gb|AC148755.6| Medicago truncatula clone mth2-24n16, complete sequence
          Length = 119876

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 423   aaccatggatggttcttgat 442
             ||||||||||||||||||||
Sbjct: 81151 aaccatggatggttcttgat 81132
to top
>gb|AC090282.6| Homo sapiens chromosome 17, clone CTD-2309O5, complete sequence
          Length = 164883

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    cagcccacagaaaatatgtg 94
             ||||||||||||||||||||
Sbjct: 84659 cagcccacagaaaatatgtg 84678
to top
>dbj|AK052555.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched
            library, clone:D530002G20 product:transmembrane molecule
            with thrombospondin module, full insert sequence
          Length = 3273

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 2647 gtgcagcccacagaaagtatgtga 2624
to top
>emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on chromosome 3, complete
              sequence
          Length = 180483

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 327    atggcttcttccaggctctg 346
              ||||||||||||||||||||
Sbjct: 145542 atggcttcttccaggctctg 145523
to top
>dbj|AK049636.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
            enriched library, clone:C530010H06 product:transmembrane
            molecule with thrombospondin module, full insert sequence
          Length = 4383

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 2811 gtgcagcccacagaaagtatgtga 2788
to top
>dbj|AK014758.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
            library, clone:4833423O18 product:transmembrane molecule
            with thrombospondin module, full insert sequence
          Length = 1297

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 1148 gtgcagcccacagaaagtatgtga 1125
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 85       aaaatatgtgatccggaagaaaat 108
                |||||| |||||||||||||||||
Sbjct: 32056967 aaaataagtgatccggaagaaaat 32056990
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 143      aaccaccaagaacttctaaa 162
                ||||||||||||||||||||
Sbjct: 30975410 aaccaccaagaacttctaaa 30975429
to top
>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0439E07
          Length = 176486

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 143   aaccaccaagaacttctaaa 162
             ||||||||||||||||||||
Sbjct: 32389 aaccaccaagaacttctaaa 32408
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 217     cgtcgacgtcgaaatcaatg 236
               ||||||||||||||||||||
Sbjct: 6233514 cgtcgacgtcgaaatcaatg 6233533
to top
>gb|AC007954.7|AC007954 Homo sapiens chromosome 14 clone RP11-493G17 and CTD-2516D11 map 14q24.3,
              complete sequence
          Length = 210204

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 69     tctgtgcagcccacagaaaatatgtgat 96
              ||||||||||||| ||||||| ||||||
Sbjct: 116102 tctgtgcagcccaaagaaaatctgtgat 116075
to top
>gb|AF053543.1|HSGSTZ1G5 Homo sapiens glutathione transferase zeta 1 (GSTZ1) gene, exons 6
           and 7
          Length = 964

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  tctgtgcagcccacagaaaatatgtgat 96
           ||||||||||||| ||||||| ||||||
Sbjct: 168 tctgtgcagcccaaagaaaatctgtgat 141
to top
>gb|AF116597.1|AF116597 Metarhizium anisopliae cAMP-dependent protein kinase catalytic
            subunit (PKA) gene, complete cds
          Length = 5864

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 422  gaaccatggatggttcttga 441
            ||||||||||||||||||||
Sbjct: 4815 gaaccatggatggttcttga 4796
to top
>emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0089N06,
             complete sequence
          Length = 141752

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 85    aaaatatgtgatccggaagaaaat 108
             |||||| |||||||||||||||||
Sbjct: 77674 aaaataagtgatccggaagaaaat 77697
to top
>dbj|AB039946.1| Mus musculus TMTSP mRNA for transmembrane molecule with
            thrombospondin module, complete cds
          Length = 2815

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   gtgcagcccacagaaaatatgtga 95
            |||||||||||||||| |||||||
Sbjct: 2677 gtgcagcccacagaaagtatgtga 2654


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,407,287
Number of Sequences: 3902068
Number of extensions: 3407287
Number of successful extensions: 59074
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58859
Number of HSP's gapped (non-prelim): 204
length of query: 491
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 469
effective length of database: 17,147,199,772
effective search space: 8042036693068
effective search space used: 8042036693068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top