>emb|AL110485.5|CEY46G5A Caenorhabditis elegans YAC Y46G5A, complete sequence
          Length = 197908

 Score = 42.1 bits (21), Expect = 0.23
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 32     tttgtatgtacattattacca 52
              |||||||||||||||||||||
Sbjct: 143357 tttgtatgtacattattacca 143377

>gb|AC097014.2| Homo sapiens chromosome 3 clone RP11-29M1, complete sequence
          Length = 143671

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 55     atctgggctgaatccaacag 74
              ||||||||||||||||||||
Sbjct: 118917 atctgggctgaatccaacag 118898

>gb|AC025572.13|AC025572 Homo sapiens 3 BAC RP11-58O15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191510

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 55     atctgggctgaatccaacag 74
              ||||||||||||||||||||
Sbjct: 164390 atctgggctgaatccaacag 164371

>ref|XM_577835.1| PREDICTED: Rattus norvegicus similar to QRWT5810 (LOC502363), mRNA
          Length = 480

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 51  caagatctgggctgaatccaaca 73
           |||||||||||||||| ||||||
Sbjct: 297 caagatctgggctgaagccaaca 319

>emb|AL807382.8| Mouse DNA sequence from clone RP23-434B7 on chromosome 4, complete
             sequence
          Length = 190179

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 30    actttgtatgtacattatt 48
             |||||||||||||||||||
Sbjct: 71280 actttgtatgtacattatt 71262


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,201,110
Number of Sequences: 3902068
Number of extensions: 1201110
Number of successful extensions: 62155
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62147
Number of HSP's gapped (non-prelim): 8
length of query: 86
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 65
effective length of database: 17,151,101,840
effective search space: 1114821619600
effective search space used: 1114821619600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)