ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart31a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in... 42 0.25
2ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin... 40 1.0
3dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co... 40 1.0
4emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i... 40 1.0
5emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 i... 40 1.0
6dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full ... 40 1.0
7emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in l... 40 1.0
8gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 38 4.0
9gb|AC146618.2| Mus musculus BAC clone RP23-5P3 from chromosome 1... 38 4.0
10emb|CR937052.2| Rattus norvegicus chromosome 1 BAC CH230-445C15,... 38 4.0
11gb|AC112793.5| Mus musculus BAC clone RP23-410D16 from chromosom... 38 4.0
12gb|U28371.1|YSCP9584 Saccharomyces cerevisiae chromosome XVI cos... 38 4.0
13gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s... 38 4.0
14gb|AF547984.1| Adoxophyes orana granulovirus, complete genome 38 4.0
15emb|AL139078.2|CJ11168X5 Campylobacter jejuni subsp. jejuni NCTC... 38 4.0
16gb|AC106800.2| Homo sapiens chromosome 5 clone RP11-447H19, comp... 38 4.0
17gb|AC092700.2| Homo sapiens chromosome 8, clone RP11-661A3, comp... 38 4.0
18gb|AC068522.7| Homo sapiens chromosome 8, clone RP11-23K11, comp... 38 4.0
19gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map ... 38 4.0
20gb|AC005851.3| Arabidopsis thaliana chromosome 2 clone F24D13 ma... 38 4.0
21gb|AC095036.2| Homo sapiens chromosome 1 clone RP11-320E2, compl... 38 4.0
22gb|AC079951.35| Homo sapiens 12q BAC RP11-346L11 (Roswell Park C... 38 4.0
23gb|AC093832.2| Homo sapiens BAC clone RP11-402L11 from 4, comple... 38 4.0
24emb|BX649437.8| Zebrafish DNA sequence from clone DKEY-28J9 in l... 38 4.0
25dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 38 4.0
26emb|BX539336.7| Zebrafish DNA sequence from clone CH211-128H21 i... 38 4.0
27gb|AC151832.3| Mus musculus BAC clone RP24-68M1 from chromosome ... 38 4.0
28gb|AC160050.2| Mus musculus BAC clone RP24-467L17 from chromosom... 38 4.0
29gb|AC066612.7|AC066612 Homo sapiens chromosome 15 clone RP11-605... 38 4.0
30gb|AC142416.3| Homo sapiens fosmid clone XXFOS-88136C3 from 4, c... 38 4.0
31gb|AC020571.9| Homo sapiens BAC clone RP11-387H5 from 2, complet... 38 4.0
32gb|AC005235.2| Homo sapiens BAC clone RP11-439M9 from 2, complet... 38 4.0
33gb|AC131681.4| Mus musculus BAC clone RP23-353O7 from 9, complet... 38 4.0
34emb|AL807762.9| Mouse DNA sequence from clone RP23-48F4 on chrom... 38 4.0
35emb|AL732468.10| Mouse DNA sequence from clone RP23-149P17 on ch... 38 4.0

>emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in linkage group 2,
            complete sequence
          Length = 200950

 Score = 42.1 bits (21), Expect = 0.25
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 31   tattccaacacaaaatacaaa 51
            |||||||||||||||||||||
Sbjct: 7492 tattccaacacaaaatacaaa 7512



to top

>ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin (LOC570288), mRNA
          Length = 7913

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 41   caaaatacaaaatgaaacga 60
            ||||||||||||||||||||
Sbjct: 7345 caaaatacaaaatgaaacga 7326



to top

>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 35/39 (89%), Gaps = 2/39 (5%)
 Strand = Plus / Minus

                                                   
Query: 13   gttgcccttgcttccttttattccaacacaaaatacaaa 51
            ||||| |||||||||||  |||||||||||| |||||||
Sbjct: 1351 gttgctcttgcttcctt--attccaacacaagatacaaa 1315



to top

>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19,
             complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    acacaaaatacaaaatgaaa 57
             ||||||||||||||||||||
Sbjct: 13106 acacaaaatacaaaatgaaa 13125



to top

>emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 in linkage group 4,
             complete sequence
          Length = 173564

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    caaaatacaaaatgaaacga 60
             ||||||||||||||||||||
Sbjct: 65724 caaaatacaaaatgaaacga 65705



to top

>dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full insert sequence
          Length = 1703

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   aatacaaaatgaaacgattg 63
            ||||||||||||||||||||
Sbjct: 1599 aatacaaaatgaaacgattg 1580



to top

>emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in linkage group 4,
             complete sequence
          Length = 144062

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    caaaatacaaaatgaaacga 60
             ||||||||||||||||||||
Sbjct: 28373 caaaatacaaaatgaaacga 28354



to top

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 33      ttccaacacaaaatacaaa 51
               |||||||||||||||||||
Sbjct: 1555754 ttccaacacaaaatacaaa 1555772



to top

>gb|AC146618.2| Mus musculus BAC clone RP23-5P3 from chromosome 10, complete sequence
          Length = 197233

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   acacaaaatacaaaatgaa 56
            |||||||||||||||||||
Sbjct: 8449 acacaaaatacaaaatgaa 8467



to top

>emb|CR937052.2| Rattus norvegicus chromosome 1 BAC CH230-445C15, complete sequence
          Length = 151854

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 26    ccttttattccaacacaaaatacaaaa 52
             ||||| |||||| ||||||||||||||
Sbjct: 35636 cctttaattccagcacaaaatacaaaa 35662



to top

>gb|AC112793.5| Mus musculus BAC clone RP23-410D16 from chromosome 2, complete sequence
          Length = 191286

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 26    ccttttattccaacacaaa 44
             |||||||||||||||||||
Sbjct: 46492 ccttttattccaacacaaa 46510



to top

>gb|U28371.1|YSCP9584 Saccharomyces cerevisiae chromosome XVI cosmid 9584
          Length = 32901

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    ttttattccaacacaaaat 46
             |||||||||||||||||||
Sbjct: 22716 ttttattccaacacaaaat 22734



to top

>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 39   cacaaaatacaaaatgaaa 57
            |||||||||||||||||||
Sbjct: 2802 cacaaaatacaaaatgaaa 2784



to top

>gb|AF547984.1| Adoxophyes orana granulovirus, complete genome
          Length = 99657

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccaacacaaaatacaaaat 53
             |||||||||||||||||||
Sbjct: 55496 ccaacacaaaatacaaaat 55514



to top

>emb|AL139078.2|CJ11168X5 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
              5/6
          Length = 263335

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     ttccaacacaaaatacaaa 51
              |||||||||||||||||||
Sbjct: 194924 ttccaacacaaaatacaaa 194942



to top

>gb|AC106800.2| Homo sapiens chromosome 5 clone RP11-447H19, complete sequence
          Length = 177449

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    acaaaatacaaaatgaaac 58
             |||||||||||||||||||
Sbjct: 79322 acaaaatacaaaatgaaac 79340



to top

>gb|AC092700.2| Homo sapiens chromosome 8, clone RP11-661A3, complete sequence
          Length = 201886

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                   
Query: 19   cttgcttccttttattccaacacaaaatacaaaatgaaa 57
            ||||||| ||||||  ||||||||||||| ||| |||||
Sbjct: 8122 cttgctttcttttacaccaacacaaaatagaaactgaaa 8160



to top

>gb|AC068522.7| Homo sapiens chromosome 8, clone RP11-23K11, complete sequence
          Length = 146952

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                     
Query: 19     cttgcttccttttattccaacacaaaatacaaaatgaaa 57
              ||||||| ||||||  ||||||||||||| ||| |||||
Sbjct: 109823 cttgctttcttttacaccaacacaaaatagaaactgaaa 109861



to top

>gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map mi54, complete
             sequence
          Length = 94884

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    tacaaaatgaaacgattgg 64
             |||||||||||||||||||
Sbjct: 16042 tacaaaatgaaacgattgg 16024



to top

>gb|AC005851.3| Arabidopsis thaliana chromosome 2 clone F24D13 map B68, complete
             sequence
          Length = 91261

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    tacaaaatgaaacgattgg 64
             |||||||||||||||||||
Sbjct: 80247 tacaaaatgaaacgattgg 80229



to top

>gb|AC095036.2| Homo sapiens chromosome 1 clone RP11-320E2, complete sequence
          Length = 191499

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 31     tattccaacacaaaatacaaaatgaaa 57
              |||| ||||| ||||||||||||||||
Sbjct: 132370 tatttcaacaaaaaatacaaaatgaaa 132344



to top

>gb|AC079951.35| Homo sapiens 12q BAC RP11-346L11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 191942

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    acaaaatacaaaatgaaac 58
             |||||||||||||||||||
Sbjct: 75309 acaaaatacaaaatgaaac 75291



to top

>gb|AC093832.2| Homo sapiens BAC clone RP11-402L11 from 4, complete sequence
          Length = 187232

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    aaaatacaaaatgaaacga 60
             |||||||||||||||||||
Sbjct: 18939 aaaatacaaaatgaaacga 18957



to top

>emb|BX649437.8| Zebrafish DNA sequence from clone DKEY-28J9 in linkage group 16,
             complete sequence
          Length = 158346

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    acaaaatacaaaatgaaac 58
             |||||||||||||||||||
Sbjct: 79816 acaaaatacaaaatgaaac 79834



to top

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 42      aaaatacaaaatgaaacga 60
               |||||||||||||||||||
Sbjct: 2401001 aaaatacaaaatgaaacga 2401019



to top

>emb|BX539336.7| Zebrafish DNA sequence from clone CH211-128H21 in linkage group 23,
              complete sequence
          Length = 183357

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 28     ttttattccaacacaaaat 46
              |||||||||||||||||||
Sbjct: 117052 ttttattccaacacaaaat 117070



to top

>gb|AC151832.3| Mus musculus BAC clone RP24-68M1 from chromosome 10, complete sequence
          Length = 222815

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     acacaaaatacaaaatgaa 56
              |||||||||||||||||||
Sbjct: 103347 acacaaaatacaaaatgaa 103365



to top

>gb|AC160050.2| Mus musculus BAC clone RP24-467L17 from chromosome 9, complete sequence
          Length = 158502

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 18     ccttgcttccttttattccaacacaaa 44
              ||||| ||||||||||||||| |||||
Sbjct: 147315 ccttggttccttttattccaatacaaa 147289



to top

>gb|AC066612.7|AC066612 Homo sapiens chromosome 15 clone RP11-605F22 map 15q21.1, complete
              sequence
          Length = 190415

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     ttccttttattccaacaca 42
              |||||||||||||||||||
Sbjct: 112367 ttccttttattccaacaca 112385



to top

>gb|AC142416.3| Homo sapiens fosmid clone XXFOS-88136C3 from 4, complete sequence
          Length = 23490

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    acaaaatacaaaatgaaac 58
             |||||||||||||||||||
Sbjct: 10279 acaaaatacaaaatgaaac 10261



to top

>gb|AC020571.9| Homo sapiens BAC clone RP11-387H5 from 2, complete sequence
          Length = 165106

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 32    attccaacacaaaatacaaaatg 54
             |||||||||||||||| ||||||
Sbjct: 75091 attccaacacaaaatagaaaatg 75113



to top

>gb|AC005235.2| Homo sapiens BAC clone RP11-439M9 from 2, complete sequence
          Length = 197911

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   tttattccaacacaaaata 47
            |||||||||||||||||||
Sbjct: 7286 tttattccaacacaaaata 7304



to top

>gb|AC131681.4| Mus musculus BAC clone RP23-353O7 from 9, complete sequence
          Length = 209929

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 18     ccttgcttccttttattccaacacaaa 44
              ||||| ||||||||||||||| |||||
Sbjct: 100012 ccttggttccttttattccaatacaaa 100038



to top

>emb|AL807762.9| Mouse DNA sequence from clone RP23-48F4 on chromosome 4, complete
              sequence
          Length = 264321

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 27     cttttattccaacacaaaa 45
              |||||||||||||||||||
Sbjct: 123200 cttttattccaacacaaaa 123182



to top

>emb|AL732468.10| Mouse DNA sequence from clone RP23-149P17 on chromosome 2, complete
             sequence
          Length = 180645

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 26    ccttttattccaacacaaa 44
             |||||||||||||||||||
Sbjct: 33715 ccttttattccaacacaaa 33733


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,030,014
Number of Sequences: 3902068
Number of extensions: 2030014
Number of successful extensions: 110570
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 110471
Number of HSP's gapped (non-prelim): 99
length of query: 92
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 71
effective length of database: 17,151,101,840
effective search space: 1217728230640
effective search space used: 1217728230640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top