>gb|AC025417.4|AC025417 Genomic sequence for Arabidopsis thaliana BAC T12C24 from chromosome I,
             complete sequence
          Length = 106142

 Score = 40.1 bits (20), Expect = 0.41
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    gcttttattcatggatcact 33
             ||||||||||||||||||||
Sbjct: 82116 gcttttattcatggatcact 82135

>dbj|AP002957.2| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2337I7, complete
             sequences
          Length = 87834

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    gcttttattcatggatcac 32
             |||||||||||||||||||
Sbjct: 80550 gcttttattcatggatcac 80568

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 4       tttcattcccgcttttatt 22
               |||||||||||||||||||
Sbjct: 4811482 tttcattcccgcttttatt 4811500

>gb|AC121155.2| Homo sapiens BAC clone RP11-469P13 from 4, complete sequence
          Length = 92400

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 16    ttttattcatggatcact 33
             ||||||||||||||||||
Sbjct: 71640 ttttattcatggatcact 71623

>emb|BX294444.7| Zebrafish DNA sequence from clone CH211-281E15 in linkage group 14,
             complete sequence
          Length = 169694

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    tcccgcttttattcatgg 27
             ||||||||||||||||||
Sbjct: 37853 tcccgcttttattcatgg 37870

>gb|AC093853.3| Homo sapiens BAC clone RP11-502M1 from 4, complete sequence
          Length = 212207

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 16    ttttattcatggatcact 33
             ||||||||||||||||||
Sbjct: 68353 ttttattcatggatcact 68336

>emb|BX510912.4| Zebrafish DNA sequence from clone CH211-18J22 in linkage group 3,
              complete sequence
          Length = 189210

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 5      ttcattcccgcttttatt 22
              ||||||||||||||||||
Sbjct: 139126 ttcattcccgcttttatt 139109

>emb|CR925810.4| Zebrafish DNA sequence from clone DKEY-250M6 in linkage group 10,
              complete sequence
          Length = 197451

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 3      ctttcattcccgctttta 20
              ||||||||||||||||||
Sbjct: 189589 ctttcattcccgctttta 189606


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 196,504
Number of Sequences: 3902068
Number of extensions: 196504
Number of successful extensions: 43940
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43925
Number of HSP's gapped (non-prelim): 15
length of query: 49
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 29
effective length of database: 17,155,003,908
effective search space: 497495113332
effective search space used: 497495113332
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)