ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart30h05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence Length = 766 Score = 127 bits (64), Expect = 2e-26 Identities = 76/80 (95%) Strand = Plus / Minus Query: 230 tccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcg 289 ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 642 tccagcgggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 583 Query: 290 gcacgagtggttatcaccct 309 || ||||||||||| ||||| Sbjct: 582 gcgcgagtggttatgaccct 563
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 87.7 bits (44), Expect = 2e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 229 ctccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctc 288 |||||| ||||| ||||||||||||||| |||||||| | |||| |||||| |||||||| Sbjct: 6264228 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 6264169 Query: 289 ggcacgagtggt 300 |||||||||||| Sbjct: 6264168 ggcacgagtggt 6264157
>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0516A04 Length = 145107 Score = 87.7 bits (44), Expect = 2e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 229 ctccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctc 288 |||||| ||||| ||||||||||||||| |||||||| | |||| |||||| |||||||| Sbjct: 58304 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 58245 Query: 289 ggcacgagtggt 300 |||||||||||| Sbjct: 58244 ggcacgagtggt 58233
>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full insert sequence Length = 1274 Score = 87.7 bits (44), Expect = 2e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 229 ctccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctc 288 |||||| ||||| ||||||||||||||| |||||||| | |||| |||||| |||||||| Sbjct: 977 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 918 Query: 289 ggcacgagtggt 300 |||||||||||| Sbjct: 917 ggcacgagtggt 906
>ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1223 Score = 79.8 bits (40), Expect = 5e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 ||||| ||||| ||||||||| | ||||||||||||| ||||||||| |||||||||||| Sbjct: 984 gggacactgtttctcttctggtaggcctcctttatcagcttcaggtctacctcggcacga 925 Query: 296 gtggttat 303 || ||||| Sbjct: 924 gttgttat 917
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 79.8 bits (40), Expect = 5e-12 Identities = 61/68 (89%) Strand = Plus / Plus Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 ||||| ||||| ||||||||| | ||||||||||||| ||||||||| |||||||||||| Sbjct: 31716936 gggacactgtttctcttctggtaggcctcctttatcagcttcaggtctacctcggcacga 31716995 Query: 296 gtggttat 303 || ||||| Sbjct: 31716996 gttgttat 31717003
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0627E03 Length = 159861 Score = 79.8 bits (40), Expect = 5e-12 Identities = 61/68 (89%) Strand = Plus / Plus Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 ||||| ||||| ||||||||| | ||||||||||||| ||||||||| |||||||||||| Sbjct: 12734 gggacactgtttctcttctggtaggcctcctttatcagcttcaggtctacctcggcacga 12793 Query: 296 gtggttat 303 || ||||| Sbjct: 12794 gttgttat 12801
>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1288_G09 Length = 109672 Score = 79.8 bits (40), Expect = 5e-12 Identities = 61/68 (89%) Strand = Plus / Plus Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 ||||| ||||| ||||||||| | ||||||||||||| ||||||||| |||||||||||| Sbjct: 96723 gggacactgtttctcttctggtaggcctcctttatcagcttcaggtctacctcggcacga 96782 Query: 296 gtggttat 303 || ||||| Sbjct: 96783 gttgttat 96790
>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full insert sequence Length = 1223 Score = 79.8 bits (40), Expect = 5e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 ||||| ||||| ||||||||| | ||||||||||||| ||||||||| |||||||||||| Sbjct: 984 gggacactgtttctcttctggtaggcctcctttatcagcttcaggtctacctcggcacga 925 Query: 296 gtggttat 303 || ||||| Sbjct: 924 gttgttat 917
>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 Length = 1277 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 229 ctccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctc 288 |||||| || |||||||||||||||||| |||||||||| |||| || ||||||||||| Sbjct: 960 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 901 Query: 289 ggcacgagtggttatcaccct 309 || || ||||| || ||||| Sbjct: 900 agcgcgggtggtgatgaccct 880
>gb|AY105151.1| Zea mays PCO072293 mRNA sequence Length = 1369 Score = 65.9 bits (33), Expect = 7e-08 Identities = 69/81 (85%) Strand = Plus / Minus Query: 229 ctccagggggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctc 288 |||||| || |||||||||||||||||| |||||||||| |||| || ||||||||||| Sbjct: 977 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 918 Query: 289 ggcacgagtggttatcaccct 309 || || ||||| || ||||| Sbjct: 917 agcgcgggtggtgatgaccct 897
>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 Length = 1257 Score = 61.9 bits (31), Expect = 1e-06 Identities = 103/127 (81%) Strand = Plus / Minus Query: 176 agggcaagcatcatatcttcatagtctctggttggggccttggaaacagccttctccagg 235 ||||||||||| ||||| ||||| ||||| |||| | |||| ||||| |||||| Sbjct: 1060 agggcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagc 1001 Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 || || ||||| |||||||| | ||||||||||||| ||||||||| |||||||| ||| Sbjct: 1000 ggcacactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcga 941 Query: 296 gtggtta 302 || |||| Sbjct: 940 gtagtta 934
>gb|AY105105.1| Zea mays PCO122403 mRNA sequence Length = 1401 Score = 61.9 bits (31), Expect = 1e-06 Identities = 103/127 (81%) Strand = Plus / Minus Query: 176 agggcaagcatcatatcttcatagtctctggttggggccttggaaacagccttctccagg 235 ||||||||||| ||||| ||||| ||||| |||| | |||| ||||| |||||| Sbjct: 1154 agggcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagc 1095 Query: 236 gggacgctgttcctcttctggaacgcctcctttatcaccttcaggtccacctcggcacga 295 || || ||||| |||||||| | ||||||||||||| ||||||||| |||||||| ||| Sbjct: 1094 ggcacactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcga 1035 Query: 296 gtggtta 302 || |||| Sbjct: 1034 gtagtta 1028
>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.066 Identities = 23/23 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaaca 133 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene encoding mitochondrial protein, partial cds Length = 465 Score = 44.1 bits (22), Expect = 0.26 Identities = 22/22 (100%) Strand = Plus / Plus Query: 111 atctcttattcctccatcaaac 132 |||||||||||||||||||||| Sbjct: 185 atctcttattcctccatcaaac 206
>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence Length = 191054 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 234 gggggacgctgttcctcttct 254 ||||||||||||||||||||| Sbjct: 157842 gggggacgctgttcctcttct 157822
>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene, partial cds; mitochondrial Length = 427 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 ctcttattcctccatcaaaca 133 ||||||||||||||||||||| Sbjct: 144 ctcttattcctccatcaaaca 164
>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete Sequence, complete sequence Length = 171061 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 234 gggggacgctgttcctcttct 254 ||||||||||||||||||||| Sbjct: 36422 gggggacgctgttcctcttct 36402
>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230026C11 product:hypothetical Beta tubulin containing protein, full insert sequence Length = 1819 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 234 gggggacgctgttcctcttct 254 ||||||||||||||||||||| Sbjct: 1159 gggggacgctgttcctcttct 1139
>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE34324 Length = 629 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 ctcttattcctccatcaaaca 133 ||||||||||||||||||||| Sbjct: 456 ctcttattcctccatcaaaca 476
>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE34130 Length = 625 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 ctcttattcctccatcaaaca 133 ||||||||||||||||||||| Sbjct: 452 ctcttattcctccatcaaaca 472
>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE21982 Length = 629 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 113 ctcttattcctccatcaaaca 133 ||||||||||||||||||||| Sbjct: 456 ctcttattcctccatcaaaca 476
>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain containing 1 (LOC575181), mRNA Length = 7881 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 267 ttatcaccttcaggtccacc 286 |||||||||||||||||||| Sbjct: 5800 ttatcaccttcaggtccacc 5781
>gb|DQ397859.1| Cenarchaeum symbiosum clone C07D01, complete sequence Length = 43795 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 gaacgcctcctttatcacct 275 |||||||||||||||||||| Sbjct: 36708 gaacgcctcctttatcacct 36689
>gb|DQ397853.1| Cenarchaeum symbiosum clone C16D03, complete sequence Length = 42367 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 gaacgcctcctttatcacct 275 |||||||||||||||||||| Sbjct: 16762 gaacgcctcctttatcacct 16781
>gb|DQ397635.1| Cenarchaeum symbiosum clone C05H05, complete sequence Length = 43064 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 gaacgcctcctttatcacct 275 |||||||||||||||||||| Sbjct: 22283 gaacgcctcctttatcacct 22264
>gb|DQ397565.1| Cenarchaeum symbiosum clone C05G03, complete sequence Length = 45533 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 gaacgcctcctttatcacct 275 |||||||||||||||||||| Sbjct: 10436 gaacgcctcctttatcacct 10455
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 205 ggttggggccttggaaacagcctt 228 |||||||||||||||||| ||||| Sbjct: 759038 ggttggggccttggaaaccgcctt 759015
>gb|AC073118.4| Homo sapiens BAC clone RP11-609J13 from 2, complete sequence Length = 107480 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ggagatcaaacatatgacct 157 |||||||||||||||||||| Sbjct: 47476 ggagatcaaacatatgacct 47457
>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence Length = 38997 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tctcttattcctccatcaaa 131 |||||||||||||||||||| Sbjct: 21072 tctcttattcctccatcaaa 21091 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,869,397 Number of Sequences: 3902068 Number of extensions: 2869397 Number of successful extensions: 78304 Number of sequences better than 10.0: 80 Number of HSP's better than 10.0 without gapping: 80 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78184 Number of HSP's gapped (non-prelim): 120 length of query: 309 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 287 effective length of database: 17,147,199,772 effective search space: 4921246334564 effective search space used: 4921246334564 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
