Clone Name	rbart30g08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co...	365	9e-98
2	gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltrans...	293	3e-76
3	gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O...	133	6e-28
4	gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ...	117	4e-23
5	gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas...	117	4e-23
6	gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O...	115	1e-22
7	emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf...	107	3e-20
8	gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O...	103	5e-19
9	gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans...	100	9e-18
10	gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m...	98	3e-17
11	gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferas...	94	5e-16
12	emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca...	90	8e-15
13	emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ...	88	3e-14
14	gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-...	86	1e-13
15	gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-...	84	5e-13
16	gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl...	80	8e-12
17	gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans...	78	3e-11
18	ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA	74	5e-10
19	gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ...	74	5e-10
20	dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon...	74	5e-10
21	gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,...	74	5e-10
22	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	74	5e-10
23	gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr...	74	5e-10
24	dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D...	74	5e-10
25	gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com...	74	5e-10
26	gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co...	74	5e-10
27	gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co...	74	5e-10
28	gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (...	74	5e-10
29	gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com...	74	5e-10
30	gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c...	74	5e-10
31	gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt...	74	5e-10
32	gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co...	74	5e-10
33	gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co...	74	5e-10
34	gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt...	74	5e-10
35	gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com...	74	5e-10
36	gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com...	74	5e-10
37	gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c...	74	5e-10
38	gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c...	74	5e-10
39	gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt...	74	5e-10
40	gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co...	74	5e-10
41	gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co...	74	5e-10
42	gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co...	74	5e-10
43	gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co...	74	5e-10
44	gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com...	74	5e-10
45	gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt...	74	5e-10
46	gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt...	74	5e-10
47	gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co...	74	5e-10
48	gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera...	74	5e-10
49	gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas...	74	5e-10
50	gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g...	74	5e-10
51	gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)...	74	5e-10
52	gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen...	74	5e-10
53	gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge...	74	5e-10
54	gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase...	74	5e-10
55	gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com...	74	5e-10
56	gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c...	74	5e-10
57	gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c...	74	5e-10
58	gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (...	74	5e-10
59	gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com...	74	5e-10
60	dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA...	66	1e-07
61	dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon...	66	1e-07
62	gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic ac...	56	1e-04
63	gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, comple...	46	0.11
64	gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosom...	42	1.7
65	gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosom...	42	1.7
66	ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein...	42	1.7
67	emb|BX037446.1|CNS09122 Single read from an extremity of a full-...	42	1.7
68	gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23...	42	1.7
69	gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23...	42	1.7
70	gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11...	42	1.7
71	gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-...	42	1.7
72	gb|AC123531.4| Mus musculus BAC clone RP24-289C11 from chromosom...	40	6.8
73	gb|AF139593.2| Xanthobacter autotrophicus outer membrane recepto...	40	6.8
74	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	40	6.8
75	gb|AC147430.9| Medicago truncatula clone mth2-71e6, complete seq...	40	6.8
76	gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full ...	40	6.8
77	gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map...	40	6.8
78	gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome	40	6.8
79	ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin...	40	6.8
80	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
81	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
82	gb|AF260441.1|AF260441 HIV-1 isolate 85CD220 from Democratic Rep...	40	6.8
83	dbj|AB085506.1| Uncultured bacterium gene for putative formyltet...	40	6.8
84	gb|AC107317.3| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	6.8
85	dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
86	dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
87	dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
88	dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.8
89	emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i...	40	6.8
90	emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 i...	40	6.8
91	dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full ...	40	6.8
92	emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in l...	40	6.8
93	emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chr...	40	6.8

---

>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score =  365 bits (184), Expect = 9e-98
 Identities = 286/320 (89%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||||||||||||||||||||||  ||  | |||||| ||||||||||||| ||
Sbjct: 1154 ctacttggtgtactccattgcccagaagttcgcaaagatgtagctggccttgacgcctgt 1095

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
            |||||| |||||| |||| |||||||||| |||||| |||| ||||||||||||||||||
Sbjct: 1094 aaaccctgcagccttggctagcttctcgaagtccctgaggttcctttccttgccgccggg 1035

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            |||||||||||||| |||  ||||||| | |||||||||||||| | ||||||| |||||
Sbjct: 1034 gctgtacgccagcaagctggcgtccacacagattaacccctgcgcgttgtttgtcgcgtc 975

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            ||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 974  cgggttcactggcaggatacattccacgttgatcaccttaccatgcgcgggcagtgcgtc 915

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||| || |  ||||||||||||||||| ||||||  ||| ||||| ||
Sbjct: 914  gtagcagttcttgaggagtaccgcacactcgtcgtcgctgaagcaggggagaatccattt 855

                                
Query: 483  catgaggatggcgtctccgg 502
            |||| |||||||||||||||
Sbjct: 854  catggggatggcgtctccgg 835

---

>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA, complete
            cds
          Length = 1436

 Score =  293 bits (148), Expect = 3e-76
 Identities = 277/320 (86%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||| ||||||||||| ||||||||||||||| | |||||||||||| |||||| |||
Sbjct: 1130 ctacttagtgtactccatggcccagaagtcggcgaagatgtaggtggccgtgacgctggt 1071

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
            ||| |||||  || ||||||||||||| ||||||||  ||||||| ||||||||||| ||
Sbjct: 1070 aaagccggcgcccttggcgagcttctccaggtccctgtggtacctctccttgccgcccgg 1011

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            ||||||| | ||||||||||  || |||  ||| ||| ||||||  | ||| ||||||||
Sbjct: 1010 gctgtacacaagcaggctcaaatcgacggcgatcaacgcctgcgcaccgttggtggcgtc 951

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            ||| |||||||||| ||| ||||| |||||||| || ||  |||| || ||||| |||||
Sbjct: 950  cggattcaccggcaagatgcactcgacgttgatgactttggcatgggcgggcagcgcgtc 891

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||
Sbjct: 890  gtagcagttcttgagcagggtggcgcactcgtcgtcgctgaagcagttgaggatccactt 831

                                
Query: 483  catgaggatggcgtctccgg 502
            ||||||||||||||| ||||
Sbjct: 830  catgaggatggcgtcgccgg 811

---

>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1438

 Score =  133 bits (67), Expect = 6e-28
 Identities = 253/315 (80%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || |||||   || |||||| ||||| |||| ||||||||||||
Sbjct: 1144 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1085

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || |||||  |||||||||||  |||||  |||||   |||||| ||| ||||||||||
Sbjct: 1084 gaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgccggg 1025

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1024 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 965

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            |||||||||||||||||| ||||| |||   | |||||| || ||||||||||| |||||
Sbjct: 964  cgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgcgtc 905

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 904  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 845

                           
Query: 483  catgaggatggcgtc 497
            |||||||||||||||
Sbjct: 844  catgaggatggcgtc 830

---

>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA
           sequence
          Length = 1314

 Score =  117 bits (59), Expect = 4e-23
 Identities = 122/143 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 gtggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggc 414
           ||||| |||||||||||||||||||| |||||||||   | |||||| || |||||||||
Sbjct: 904 gtggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggc 845

                                                                       
Query: 415 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgagg 474
           || |||||||||||||||||||||||  | || || |  ||||||||  ||  || ||||
Sbjct: 844 agcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggagg 785

                                  
Query: 475 atccacttcatgaggatggcgtc 497
           |||||||||||||||||||||||
Sbjct: 784 atccacttcatgaggatggcgtc 762

---

>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
           complete cds
          Length = 1371

 Score =  117 bits (59), Expect = 4e-23
 Identities = 122/143 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 gtggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggc 414
           ||||| |||||||||||||||||||| |||||||||   | |||||| || |||||||||
Sbjct: 984 gtggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggc 925

                                                                       
Query: 415 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgagg 474
           || |||||||||||||||||||||||  | || || |  ||||||||  ||  || ||||
Sbjct: 924 agcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggagg 865

                                  
Query: 475 atccacttcatgaggatggcgtc 497
           |||||||||||||||||||||||
Sbjct: 864 atccacttcatgaggatggcgtc 842

---

>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1446

 Score =  115 bits (58), Expect = 1e-22
 Identities = 253/318 (79%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || |||||   || |||||| ||||| |||| ||||||||||||
Sbjct: 1127 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1068

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1067 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1008

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1007 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 948

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            |||||| ||||||||||| ||||| |||   |  ||||| || ||||||||||| |||||
Sbjct: 947  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgcgtc 888

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 887  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 828

                              
Query: 483  catgaggatggcgtctcc 500
            ||||||||||||||||||
Sbjct: 827  catgaggatggcgtctcc 810

---

>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                       
Query: 356 tggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggca 415
           |||| |||||||||||||||||||| ||||| |||   | |||||| || ||||||||||
Sbjct: 804 tggcctccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggca 745

                                                                       
Query: 416 gtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgagga 475
           | |||||||||||||||||||||||  |||| || |  | ||||||  ||  || |||||
Sbjct: 744 gcgcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggagga 685

                                 
Query: 476 tccacttcatgaggatggcgtc 497
           ||||||||||||||||||||||
Sbjct: 684 tccacttcatgaggatggcgtc 663

---

>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1440

 Score =  103 bits (52), Expect = 5e-19
 Identities = 226/284 (79%)
 Strand = Plus / Minus

                                                                        
Query: 214  gcgtaaatgtaggtggccttgacgccggtaaacccggcagccctggcgagcttctcgagg 273
            ||||| ||||| |||| |||||||||||| ||||| ||  ||||||| ||   |||||  
Sbjct: 1122 gcgtagatgtacgtggacttgacgccggtgaacccagctcccctggccagggcctcgaac 1063

                                                                        
Query: 274  tccctcaggtacctttccttgccgccggggctgtacgccagcaggctcacgtccacgctg 333
            ||||||  |||||| ||| ||||||||||| ||| ||| |||| | ||| ||| |||  |
Sbjct: 1062 tccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtcgacgtgg 1003

                                                                        
Query: 334  attaacccctgcgtgctgtttgtggcgtccgggttcaccggcaggatacactccacgttg 393
            |  | |||||||| ||||    |||| |||||||| ||||||||||| ||||| |||   
Sbjct: 1002 aagaccccctgcgagctgggcttggcctccgggttgaccggcaggatgcactcgacgagc 943

                                                                        
Query: 394  atcaccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcg 453
            |  ||||| || ||||||||||| |||||||||||||||||||||||  |||| || |  
Sbjct: 942  acgaccttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgc 883

                                                        
Query: 454  tcgtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
            | ||||||  ||  || |||||||||||||||||||||||||||
Sbjct: 882  tggtcgctccagtcgtggaggatccacttcatgaggatggcgtc 839

---

>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete
            cds
          Length = 1455

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 251/318 (78%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || |||||   || |||||| ||||| |||| ||||||||||||
Sbjct: 1134 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1075

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1074 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1015

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1014 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 955

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            |||||| ||||||||||| ||||  |||   |  ||||| || ||||||||||| |||||
Sbjct: 954  cgggttgaccggcaggatgcactggacgagcacgaccttgccgtgcgccggcagcgcgtc 895

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 894  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 835

                              
Query: 483  catgaggatggcgtctcc 500
            ||||||||||| ||||||
Sbjct: 834  catgaggatggtgtctcc 817

---

>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 115/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 361 tccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcg 420
           ||||||||||| |||||||| |||||||||   | |||||| || ||||||||||  |||
Sbjct: 967 tccgggttcacaggcaggatgcactccacgagcaccaccttgccgtgcgccggcaacgcg 908

                                                                       
Query: 421 tcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccac 480
           ||||||||||||||||||||  | || || |  ||||||||  ||  || ||||||||||
Sbjct: 907 tcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggaggatccac 848

                            
Query: 481 ttcatgaggatggcgtc 497
           |||||||||||||||||
Sbjct: 847 ttcatgaggatggcgtc 831

---

>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial
           cds
          Length = 604

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                       
Query: 355 gtggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggc 414
           ||||| |||||||||||||||| ||| |||||||||   || ||||| || |||| ||||
Sbjct: 536 gtggcttccgggttcaccggcaagatgcactccacgagcattaccttgccgtgcgtcggc 477

                                                                       
Query: 415 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgagg 474
           || ||||||||||||||||| |||||  | ||||| |  ||||||||  ||  || ||||
Sbjct: 476 agcgcgtcgtagcagttcttaagcagcgttgcacagtgctcgtcgctccagtcgtggagg 417

                              
Query: 475 atccacttcatgaggatgg 493
           |||||||||||||||||||
Sbjct: 416 atccacttcatgaggatgg 398

---

>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 356 tggcgtccgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggca 415
           |||| |||||||| ||||||||||| ||||  |||   |  ||||| || ||||||||||
Sbjct: 804 tggcctccgggttgaccggcaggatgcacttgacgagcacgaccttgccgtgcgccggca 745

                                                                       
Query: 416 gtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgagga 475
           | |||||||||||||||||||||||  |||| || |  | ||||||  ||  || |||||
Sbjct: 744 gcgcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggagga 685

                                    
Query: 476 tccacttcatgaggatggcgtctcc 500
           |||||||||||||||||||||||||
Sbjct: 684 tccacttcatgaggatggcgtctcc 660

---

>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 110/132 (83%)
 Strand = Plus / Minus

                                                                        
Query: 366  gttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtcgta 425
            |||||||||||| |  ||||| ||| |||||||||| || | | ||||||| ||||||||
Sbjct: 1010 gttcaccggcagcacgcactcgacgatgatcaccttgccgttctccggcagcgcgtcgta 951

                                                                        
Query: 426  gcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccacttcat 485
            |||||||||||||||  |||| || |   |||||||  ||  || |||||||||||||||
Sbjct: 950  gcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatccacttcat 891

                        
Query: 486  gaggatggcgtc 497
            ||||||||||||
Sbjct: 890  gaggatggcgtc 879



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 184  tacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttga 235
            |||||| || |||| || ||||||  || |||||| ||||||||||||||||
Sbjct: 1192 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1141

---

>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1430

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 247/315 (78%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || ||||||  || |||||| ||||| |||| ||||| ||||| 
Sbjct: 1160 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1101

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || || ||  || ||||||||  |||||  ||||||  |||||| ||| |||| |||||
Sbjct: 1100 gaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccaccggg 1041

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1040 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 981

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            ||||| |||||||||||| ||||||||    | |||||| || ||||| ||||| |||||
Sbjct: 980  cgggtgcaccggcaggatgcactccaccagtaccaccttgccgtgcgctggcagcgcgtc 921

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 920  gtagcagttcttgagcagcgtggcgcaatgctggtcgctccagtcgtggaggatccactt 861

                           
Query: 483  catgaggatggcgtc 497
            ||| |||||||||||
Sbjct: 860  catcaggatggcgtc 846

---

>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
            O-methyltransferase mRNA, complete cds
          Length = 1475

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 249/318 (78%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || |||||   || |||||| ||||| |||| |||||| |||||
Sbjct: 1153 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacaccggt 1094

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| |||| |||||
Sbjct: 1093 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgcccccggg 1034

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1033 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 974

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            |||||| ||||||||||| ||||| |||   |  ||||| || | ||||||||| |||||
Sbjct: 973  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgttcgccggcagcgcgtc 914

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 913  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 854

                              
Query: 483  catgaggatggcgtctcc 500
            |||||||||||| |||||
Sbjct: 853  catgaggatggcatctcc 836

---

>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
            gene, complete cds
          Length = 2012

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 109/132 (82%)
 Strand = Plus / Minus

                                                                        
Query: 366  gttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtcgta 425
            |||||||||||| |  ||||| |||  ||||||||| || | | ||||||| ||||||||
Sbjct: 1829 gttcaccggcagcacgcactcgacgacgatcaccttgccgttctccggcagcgcgtcgta 1770

                                                                        
Query: 426  gcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccacttcat 485
            |||||||||||||||  |||| || |   |||||||  ||  || |||||||||||||||
Sbjct: 1769 gcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatccacttcat 1710

                        
Query: 486  gaggatggcgtc 497
            ||||||||||||
Sbjct: 1709 gaggatggcgtc 1698



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 184  tacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttga 235
            |||||| || |||| || ||||||  || |||||| ||||||||||||||||
Sbjct: 2011 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1960

---

>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete
            cds
          Length = 1436

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 246/315 (78%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || ||||||  || |||||| ||||| |||| ||||| ||||| 
Sbjct: 1171 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1112

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || || ||  |||||||||||  ||||   ||||||  |||||| ||| ||||||| ||
Sbjct: 1111 gaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctgg 1052

                                                                        
Query: 303  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 362
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1051 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 992

                                                                        
Query: 363  cgggttcaccggcaggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 422
            |||||||||||||||||| ||||||||    | ||||||||| |||   ||||| |||||
Sbjct: 991  cgggttcaccggcaggatgcactccaccagcaccaccttaccgtgcattggcagcgcgtc 932

                                                                        
Query: 423  gtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagttgaggatccactt 482
            ||||||||||||||||||  || |||| |  | ||| ||  ||  || ||||||||||||
Sbjct: 931  gtagcagttcttgagcagcgtgccacaatgctggtcactccagtcgtggaggatccactt 872

                           
Query: 483  catgaggatggcgtc 497
            ||| |||||||||||
Sbjct: 871  catcaggatggcgtc 857

---

>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 303  g 303
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 456 gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875

---

>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2549 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2490

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2489 ggaggatccacttcatgaggatggcgtcgccgg 2457



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 184  tacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttga 235
            |||||| || |||| || ||||||  || |||||| ||||||||||||||||
Sbjct: 2778 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 2727

---

>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
           |||||||||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928

                                                                       
Query: 243 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868

            
Query: 303 g 303
           |
Sbjct: 867 g 867



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 774 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 715

                                                     
Query: 456 gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 714 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 673

---

>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 410 ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
           ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 968 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 909

                                            
Query: 470 tgaggatccacttcatgaggatggcgtctccgg 502
            ||||||||||||||||||||||||||| ||||
Sbjct: 908 ggaggatccacttcatgaggatggcgtcgccgg 876



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 184  tacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttga 235
            |||||| || |||| || ||||||  || |||||| ||||||||||||||||
Sbjct: 1197 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1146

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                           
Query: 183     ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
               |||||||||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755

                                                                           
Query: 243     aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
                || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815

                
Query: 303     g 303
               |
Sbjct: 3331816 g 3331816



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                           
Query: 396     caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
               |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 3331909 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 3331968

                                                         
Query: 456     gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
               ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 3331969 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 3332010

---

>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
            mRNA, complete cds
          Length = 1190

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||||||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002

             
Query: 303  g 303
            |
Sbjct: 1001 g 1001



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 908 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 849

                                                     
Query: 456 gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 848 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 807

---

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                          
Query: 183    ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
              |||||||||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322

                                                                          
Query: 243    aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
               || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382

               
Query: 303    g 303
              |
Sbjct: 109383 g 109383



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                          
Query: 396    caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
              |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 109476 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 109535

                                                        
Query: 456    gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
              ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 109536 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 109577

---

>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccgg 2484

---

>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2392 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2333

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2332 ggaggatccacttcatgaggatggcgtcgccgg 2300

---

>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccgg 2627

---

>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccgg 2627

---

>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2551 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2492

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2491 ggaggatccacttcatgaggatggcgtcgccgg 2459

---

>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2644 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2585

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2584 ggaggatccacttcatgaggatggcgtcgccgg 2552

---

>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2467 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2408

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2407 ggaggatccacttcatgaggatggcgtcgccgg 2375

---

>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccgg 2484

---

>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccgg 2627

---

>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2997 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2938

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2937 ggaggatccacttcatgaggatggcgtcgccgg 2905

---

>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccgg 2345

---

>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccgg 2345

---

>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2943 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2884

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2883 ggaggatccacttcatgaggatggcgtcgccgg 2851

---

>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2433 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2374

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2373 ggaggatccacttcatgaggatggcgtcgccgg 2341

---

>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2896 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2837

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2836 ggaggatccacttcatgaggatggcgtcgccgg 2804

---

>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2948 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2889

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2888 ggaggatccacttcatgaggatggcgtcgccgg 2856

---

>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2686 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2627

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2626 ggaggatccacttcatgaggatggcgtcgccgg 2594

---

>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccgg 2651

---

>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccgg 2651

---

>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2742 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2683

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2682 ggaggatccacttcatgaggatggcgtcgccgg 2650

---

>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2925 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2866

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2865 ggaggatccacttcatgaggatggcgtcgccgg 2833

---

>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2951 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2892

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2891 ggaggatccacttcatgaggatggcgtcgccgg 2859

---

>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2542 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2483

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2482 ggaggatccacttcatgaggatggcgtcgccgg 2450

---

>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2849 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2790

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2789 ggaggatccacttcatgaggatggcgtcgccgg 2757

---

>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2856 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2797

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2796 ggaggatccacttcatgaggatggcgtcgccgg 2764

---

>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2899 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2840

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2839 ggaggatccacttcatgaggatggcgtcgccgg 2807

---

>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2903 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2844

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2843 ggaggatccacttcatgaggatggcgtcgccgg 2811

---

>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2938 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2879

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2878 ggaggatccacttcatgaggatggcgtcgccgg 2846

---

>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2865 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2806

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2805 ggaggatccacttcatgaggatggcgtcgccgg 2773

---

>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2834 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2775

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 2774 ggaggatccacttcatgaggatggcgtcgccgg 2742

---

>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
            cds
          Length = 2041

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1814 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1755

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 1754 ggaggatccacttcatgaggatggcgtcgccgg 1722

---

>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccgg 1671

---

>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete
            cds
          Length = 2074

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1835 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1776

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 1775 ggaggatccacttcatgaggatggcgtcgccgg 1743

---

>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccgg 1671

---

>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 410  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgcttaagcagt 469
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1914 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1855

                                             
Query: 470  tgaggatccacttcatgaggatggcgtctccgg 502
             ||||||||||||||||||||||||||| ||||
Sbjct: 1854 ggaggatccacttcatgaggatggcgtcgccgg 1822

---

>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Minus

                                                                       
Query: 183 ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
           |||||| ||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748

                                                                       
Query: 243 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688

            
Query: 303 g 303
           |
Sbjct: 687 g 687



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 594 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 535

                                                     
Query: 456 gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 534 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 493

---

>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
            insert sequence
          Length = 1425

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Minus

                                                                        
Query: 183  ctacttggtgtactccattgcccagaagtcggcgtaaatgtaggtggccttgacgccggt 242
            |||||| ||| |||| || ||||||  || |||||| |||||||||||||||| ||||||
Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 243  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 302
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 303  g 303
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 455
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 456 gtcgcttaagcagttgaggatccacttcatgaggatggcgtc 497
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875

---

>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid
           O-methyltransferase mRNA, complete cds
          Length = 1408

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 410 ccggcagtgcgtcgtagcagttcttgag 437
           ||||||||||||||||||||||||||||
Sbjct: 936 ccggcagtgcgtcgtagcagttcttgag 909

---

>gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, complete sequence
          Length = 169408

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 145   caagaacacagcagcatgctata 167
             |||||||||||||||||||||||
Sbjct: 96328 caagaacacagcagcatgctata 96350

---

>gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosome 18, complete
             sequence
          Length = 173704

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 464   agcagttgaggatccacttca 484
             |||||||||||||||||||||
Sbjct: 32332 agcagttgaggatccacttca 32312

---

>gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosome 18, complete sequence
          Length = 186489

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 464    agcagttgaggatccacttca 484
              |||||||||||||||||||||
Sbjct: 133655 agcagttgaggatccacttca 133635

---

>ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein (Afu5g04270) partial
            mRNA
          Length = 2127

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 257  tggcgagcttctcgaggtccctcag 281
            |||||| ||||||||||||||||||
Sbjct: 1930 tggcgatcttctcgaggtccctcag 1906

---

>emb|BX037446.1|CNS09122 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 3-PRIME end
          of clone FK0AAA9DF09 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 42 cttccttttattcgaacacaa 62
          |||||||||||||||||||||
Sbjct: 25 cttccttttattcgaacacaa 45

---

>gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23C-23D, BAC clone
             BACR48B06, complete sequence
          Length = 184554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 38    cttgcttccttttattcgaacacaa 62
             |||||||||||||||||||| ||||
Sbjct: 29824 cttgcttccttttattcgaatacaa 29800

---

>gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23D-23F, BAC clone
             BACR11E09, complete sequence
          Length = 169931

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 38    cttgcttccttttattcgaacacaa 62
             |||||||||||||||||||| ||||
Sbjct: 88188 cttgcttccttttattcgaatacaa 88164

---

>gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11 of 83 of the complete
             sequence
          Length = 286920

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 38    cttgcttccttttattcgaacacaa 62
             |||||||||||||||||||| ||||
Sbjct: 28588 cttgcttccttttattcgaatacaa 28612

---

>gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-Ser7) gene
          Length = 3485

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 38  cttgcttccttttattcgaacacaa 62
           |||||||||||||||||||| ||||
Sbjct: 239 cttgcttccttttattcgaatacaa 215

---

>gb|AC123531.4| Mus musculus BAC clone RP24-289C11 from chromosome 15, complete
             sequence
          Length = 165766

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 17    atggaggacacgcatgttgcccttgctt 44
             ||||| |||| |||||||||||||||||
Sbjct: 70575 atggaagacatgcatgttgcccttgctt 70602

---

>gb|AF139593.2| Xanthobacter autotrophicus outer membrane receptor-like protein
           gene, partial cds; and methylene tetrahydromethanopterin
           dehydrogenase (mtdB), methenyl tetrahydromethanopterin
           cyclohydrolase (mch), putative tetrahydromethanopterin
           biosynthesis protein, conserved hypothetical protein,
           putative tetrahydromethanopterin biosynthesis protein,
           putative cytochrome C protein,
           formyltransferase/cyclohydrolase complex subunit C
           (fhcC), formyltransferase/cyclohydrolase complex subunit
           D (fhcD), formyltransferase/cyclohydrolase complex
           subunit A (fhcA), formyltransferase/cyclohydrolase
           complex subunit B (fhcB), conserved hypothetical
           protein, and putative protein genes, complete cds
          Length = 13310

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 gtggcgtccgggttcaccggcagg 378
           ||||||||| ||||||||||||||
Sbjct: 586 gtggcgtccaggttcaccggcagg 563

---

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 301     gggctgtacgccagcaggct 320
               ||||||||||||||||||||
Sbjct: 1331511 gggctgtacgccagcaggct 1331530

---

>gb|AC147430.9| Medicago truncatula clone mth2-71e6, complete sequence
          Length = 125478

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tgaaaaatttcaagatggag 22
             ||||||||||||||||||||
Sbjct: 60019 tgaaaaatttcaagatggag 60038

---

>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA
           sequence
          Length = 1308

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 367 ttcaccggcaggatacactccacgttgatcaccttaccat 406
           |||||||||||||| | ||||||| ||| |||||| ||||
Sbjct: 997 ttcaccggcaggatgccctccacgatgaccaccttgccat 958

---

>gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map PR1, complete
            sequence
          Length = 89685

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 43   ttccttttattcgaacacaaaata 66
            ||||||| ||||||||||||||||
Sbjct: 1413 ttcctttaattcgaacacaaaata 1390

---

>gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome
          Length = 146454

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 107   tacggtcgattaagatttattagaaatt 134
             |||||| ||| |||||||||||||||||
Sbjct: 80246 tacggttgatgaagatttattagaaatt 80219

---

>ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin (LOC570288), mRNA
          Length = 7913

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   caaaatacaaaatgaaacga 79
            ||||||||||||||||||||
Sbjct: 7345 caaaatacaaaatgaaacga 7326

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 294     gccgccggggctgtacgcca 313
               ||||||||||||||||||||
Sbjct: 5399480 gccgccggggctgtacgcca 5399499

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 377     ggatacactccacgttgatc 396
               ||||||||||||||||||||
Sbjct: 6810538 ggatacactccacgttgatc 6810557

---

>gb|AF260441.1|AF260441 HIV-1 isolate 85CD220 from Democratic Republic of the Congo, env
           glycoprotein, C2-V3 region (env) gene, partial cds
          Length = 522

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 335 ttaacccctgcgtgctgttt 354
           ||||||||||||||||||||
Sbjct: 420 ttaacccctgcgtgctgttt 401

---

>dbj|AB085506.1| Uncultured bacterium gene for putative formyltetrahydrofolate
           synthetase, partial cds, clone:FPB08
          Length = 1057

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 201 tgcccagaagtcggcgtaaatgta 224
           ||||||||| ||||||||||||||
Sbjct: 794 tgcccagaactcggcgtaaatgta 817

---

>gb|AC107317.3| Mus musculus strain C57BL6/J chromosome 6 clone RP23-340A17, complete
              sequence
          Length = 228371

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 1      cttgaaaaatttcaagatggagga 24
              |||||||||| |||||||||||||
Sbjct: 100052 cttgaaaaatatcaagatggagga 100075

---

>dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0529B09
          Length = 138188

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   gccgccggggctgtacgcca 313
             ||||||||||||||||||||
Sbjct: 30414 gccgccggggctgtacgcca 30433

---

>dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0758B01
          Length = 159206

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 377   ggatacactccacgttgatc 396
             ||||||||||||||||||||
Sbjct: 28264 ggatacactccacgttgatc 28283

---

>dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1131G07
          Length = 133992

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 377    ggatacactccacgttgatc 396
              ||||||||||||||||||||
Sbjct: 131591 ggatacactccacgttgatc 131610

---

>dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-174-C12, full
           insert sequence
          Length = 2189

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 377 ggatacactccacgttgatc 396
           ||||||||||||||||||||
Sbjct: 791 ggatacactccacgttgatc 810

---

>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19,
             complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    acacaaaatacaaaatgaaa 76
             ||||||||||||||||||||
Sbjct: 13106 acacaaaatacaaaatgaaa 13125

---

>emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 in linkage group 4,
             complete sequence
          Length = 173564

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    caaaatacaaaatgaaacga 79
             ||||||||||||||||||||
Sbjct: 65724 caaaatacaaaatgaaacga 65705

---

>dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full insert sequence
          Length = 1703

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 63   aatacaaaatgaaacgattg 82
            ||||||||||||||||||||
Sbjct: 1599 aatacaaaatgaaacgattg 1580

---

>emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in linkage group 4,
             complete sequence
          Length = 144062

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    caaaatacaaaatgaaacga 79
             ||||||||||||||||||||
Sbjct: 28373 caaaatacaaaatgaaacga 28354

---

>emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chromosome 4, complete
             sequence
          Length = 189040

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   agaacacagcagcatgctat 166
             ||||||||||||||||||||
Sbjct: 51136 agaacacagcagcatgctat 51155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,711,825
Number of Sequences: 3902068
Number of extensions: 4711825
Number of successful extensions: 82509
Number of sequences better than 10.0: 93
Number of HSP's better than 10.0 without gapping: 93
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82148
Number of HSP's gapped (non-prelim): 344
length of query: 502
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 480
effective length of database: 17,147,199,772
effective search space: 8230655890560
effective search space used: 8230655890560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---