ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart30f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009135.1| Triticum aestivum clone wl1n.pk0038.e3:fis, full ... 226 5e-56
2gb|AY104432.1| Zea mays PCO120449 mRNA sequence 226 5e-56
3gb|DQ430456.1| Sorghum propinquum locus pSHR0146.2 genomic sequence 145 2e-31
4gb|DQ430455.1| Sorghum bicolor voucher PI585454 locus pSHR0146.2... 129 9e-27
5gb|DQ430454.1| Sorghum bicolor voucher PI267539 locus pSHR0146.2... 129 9e-27
6gb|DQ430453.1| Sorghum bicolor voucher PI267408 locus pSHR0146.2... 129 9e-27
7gb|DQ430452.1| Sorghum bicolor voucher PI221607 locus pSHR0146.2... 129 9e-27
8gb|DQ430451.1| Sorghum bicolor voucher PI152702 locus pSHR0146.2... 129 9e-27
9gb|DQ430450.1| Sorghum bicolor voucher NSL92371 locus pSHR0146.2... 129 9e-27
10gb|DQ430449.1| Sorghum bicolor voucher NSL87902 locus pSHR0146.2... 129 9e-27
11gb|DQ430448.1| Sorghum bicolor voucher NSL87666 locus pSHR0146.2... 129 9e-27
12gb|DQ430447.1| Sorghum bicolor voucher NSL77217 locus pSHR0146.2... 129 9e-27
13gb|DQ430446.1| Sorghum bicolor voucher NSL77034 locus pSHR0146.2... 129 9e-27
14gb|DQ430445.1| Sorghum bicolor voucher NSL56174 locus pSHR0146.2... 129 9e-27
15gb|DQ430444.1| Sorghum bicolor voucher NSL56003 locus pSHR0146.2... 129 9e-27
16gb|DQ430443.1| Sorghum bicolor voucher NSL55243 locus pSHR0146.2... 129 9e-27
17gb|DQ430442.1| Sorghum bicolor voucher NSL51365 locus pSHR0146.2... 129 9e-27
18gb|DQ430441.1| Sorghum bicolor voucher NSL51030 locus pSHR0146.2... 129 9e-27
19gb|DQ430440.1| Sorghum bicolor voucher NSL50875 locus pSHR0146.2... 129 9e-27
20gb|DQ430439.1| Sorghum bicolor voucher BTx623 locus pSHR0146.2 g... 129 9e-27
21gb|AC093493.2| Oryza sativa (japonica cultivar-group) chromosome... 90 8e-15
22dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
23gb|AY622311.1| Rhodotorula glutinis thymine dioxygenase mRNA, co... 44 0.42
24dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.42
25ref|NM_201350.1| Rattus norvegicus SH3/ankyrin domain gene 2 (Sh... 42 1.7
26emb|AJ339219.1|HSA339219 Homo sapiens genomic sequence surroundi... 42 1.7
27gb|AY298755.1| Rattus norvegicus Shank2E (Shank2) mRNA, complete... 42 1.7
28gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome 40 6.6
29ref|XM_470097.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.6
30gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 6.6
31gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 6.6
32gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 6.6
33gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, c... 40 6.6
34gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit... 40 6.6
35gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion... 40 6.6
36gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 6.6
37gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion... 40 6.6
38gb|CP000001.1| Bacillus cereus E33L, complete genome 40 6.6
39gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 6.6
40gb|AF329815.1| Danio rerio insulin-like growth factor 1 receptor... 40 6.6
41gb|AC090079.6| Homo sapiens chromosome 17, clone CTD-2535P7, com... 40 6.6
42gb|AY043191.1| Danio rerio insulin-like growth factor I receptor... 40 6.6
43ref|XM_677864.1| PREDICTED: Danio rerio similar to IGF-IRb recep... 40 6.6
44gb|AC148690.1| Macaca mulatta Major Histocompatibility Complex B... 40 6.6
45gb|AC148682.1| Macaca mulatta Major Histocompatibility Complex M... 40 6.6
46dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
47dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 6.6
48gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genom... 40 6.6
49emb|BX088692.7| Zebrafish DNA sequence from clone CH211-208A20 i... 40 6.6
50emb|AL928976.4| Zebrafish DNA sequence from clone CH211-134B16, ... 40 6.6
51emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.6
52gb|AC117205.3| Mus musculus BAC clone RP23-257K20 from 10, compl... 40 6.6
53gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 6.6
54dbj|D86951.1| Mesocricetus auratus mRNA for CYP3A31, complete cds 40 6.6

>gb|BT009135.1| Triticum aestivum clone wl1n.pk0038.e3:fis, full insert mRNA
           sequence
          Length = 659

 Score =  226 bits (114), Expect = 5e-56
 Identities = 200/229 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 ggcgatgcggccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggcc 316
           ||||| || |||||||||||||||||||||||| || |  |||||||| || |||| |||
Sbjct: 485 ggcgacgctgccgaggcggacggcgttgacgtagtccctggggctgtgcgacgcgatgcc 426

                                                                       
Query: 317 ggggacgagcaggccggaggcgcgatagagcagggagacggcgccctcgcggtagtcctt 376
           ||| ||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 425 gggcacgagcaggccggtggcgcggtagagcagcgagacggcgccctcgcggtagtcctt 366

                                                                       
Query: 377 gccggccctcgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacat 436
           |||  || | |||||||||||||| ||||| |  ||||||||   |||||||||||||||
Sbjct: 365 gccctccttggcccacaggaaggcgcccttgaagaggtccccccacgcgttgccgtacat 306

                                                            
Query: 437 ggacagcaggtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||||||||||||  ||||||||||||||   ||||||||||||||||
Sbjct: 305 ggacagcaggtacctggggtcgaagtagttcttgttgggcgcgtcgccg 257



to top

>gb|AY104432.1| Zea mays PCO120449 mRNA sequence
          Length = 2218

 Score =  226 bits (114), Expect = 5e-56
 Identities = 200/229 (87%)
 Strand = Plus / Minus

                                                                        
Query: 257  ggcgatgcggccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggcc 316
            ||||| || |||||||||||||||||||||||| || |  |||||||| || |||| |||
Sbjct: 1923 ggcgacgctgccgaggcggacggcgttgacgtagtccctggggctgtgcgacgcgatgcc 1864

                                                                        
Query: 317  ggggacgagcaggccggaggcgcgatagagcagggagacggcgccctcgcggtagtcctt 376
            ||| ||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1863 gggcacgagcaggccggtggcgcggtagagcagcgagacggcgccctcgcggtagtcctt 1804

                                                                        
Query: 377  gccggccctcgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacat 436
            |||  || | |||||||||||||| ||||| |  ||||||||   |||||||||||||||
Sbjct: 1803 gccctccttggcccacaggaaggcgcccttgaagaggtccccccacgcgttgccgtacat 1744

                                                             
Query: 437  ggacagcaggtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
            ||||||||||||||  ||||||||||||||   ||||||||||||||||
Sbjct: 1743 ggacagcaggtacctggggtcgaagtagttcttgttgggcgcgtcgccg 1695



to top

>gb|DQ430456.1| Sorghum propinquum locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  145 bits (73), Expect = 2e-31
 Identities = 183/220 (83%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || ||||||||||| ||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcagggacacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggtcgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430455.1| Sorghum bicolor voucher PI585454 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430454.1| Sorghum bicolor voucher PI267539 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430453.1| Sorghum bicolor voucher PI267408 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430452.1| Sorghum bicolor voucher PI221607 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430451.1| Sorghum bicolor voucher PI152702 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430450.1| Sorghum bicolor voucher NSL92371 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430449.1| Sorghum bicolor voucher NSL87902 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430448.1| Sorghum bicolor voucher NSL87666 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430447.1| Sorghum bicolor voucher NSL77217 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430446.1| Sorghum bicolor voucher NSL77034 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430445.1| Sorghum bicolor voucher NSL56174 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430444.1| Sorghum bicolor voucher NSL56003 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430443.1| Sorghum bicolor voucher NSL55243 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430442.1| Sorghum bicolor voucher NSL51365 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430441.1| Sorghum bicolor voucher NSL51030 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430440.1| Sorghum bicolor voucher NSL50875 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|DQ430439.1| Sorghum bicolor voucher BTx623 locus pSHR0146.2 genomic sequence
          Length = 733

 Score =  129 bits (65), Expect = 9e-27
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 gccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacgag 325
           |||||||||||||||||||||||| || |  ||||| || || |||| |||||| |||||
Sbjct: 686 gccgaggcggacggcgttgacgtagtccctagggctatgcgacgcgatgccgggcacgag 627

                                                                       
Query: 326 caggccggaggcgcgatagagcagggagacggcgccctcgcggtagtccttgccggccct 385
           ||| || | ||| || |||||||  |||||||||||||| | ||| ||||||||  || |
Sbjct: 626 cagtccagtggcacggtagagcaacgagacggcgccctccctgtaatccttgccctcctt 567

                                                                       
Query: 386 cgcccacaggaaggctcccttcaccaggtccccaagcgcgttgccgtacatggacagcag 445
            | ||||||||| || ||||| | ||| |||||   ||| || || ||||||||||||||
Sbjct: 566 ggtccacaggaacgcgcccttgaacagatccccccacgcattcccatacatggacagcag 507

                                                   
Query: 446 gtaccgcgggtcgaagtagttggggttgggcgcgtcgccg 485
           ||||| ||||| ||||||||| ||||| ||||||||||||
Sbjct: 506 gtacctcgggttgaagtagttcgggttcggcgcgtcgccg 467



to top

>gb|AC093493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0072C16,
              complete sequence
          Length = 159525

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 95/112 (84%)
 Strand = Plus / Plus

                                                                          
Query: 265    ggccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacga 324
              |||||||||||| ||| ||||| || || || ||||| ||||||||||||||||||| ||
Sbjct: 103596 ggccgaggcggatggcattgacatagtcacgagggctatgggaggcgaggccggggaaga 103655

                                                                  
Query: 325    gcaggccggaggcgcgatagagcagggagacggcgccctcgcggtagtcctt 376
              | ||||||| |||||| ||||  | ||| |||| |||||| |||||||||||
Sbjct: 103656 ggaggccggcggcgcggtagacgatggacacggggccctcccggtagtcctt 103707



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 95/112 (84%)
 Strand = Plus / Plus

                                                                           
Query: 265     ggccgaggcggacggcgttgacgtantcgcgcgggctgtgggaggcgaggccggggacga 324
               |||||||||||| ||| ||||| || || || ||||| ||||||||||||||||||| ||
Sbjct: 3009580 ggccgaggcggatggcattgacatagtcacgagggctatgggaggcgaggccggggaaga 3009639

                                                                   
Query: 325     gcaggccggaggcgcgatagagcagggagacggcgccctcgcggtagtcctt 376
               | ||||||| |||||| ||||  | ||| |||| |||||| |||||||||||
Sbjct: 3009640 ggaggccggcggcgcggtagacgatggacacggggccctcccggtagtcctt 3009691



to top

>gb|AY622311.1| Rhodotorula glutinis thymine dioxygenase mRNA, complete cds
          Length = 1148

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 359 gccctcgcggtagtccttgccg 380
           ||||||||||||||||||||||
Sbjct: 455 gccctcgcggtagtccttgccg 434



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 312     aggccggggacgagcaggccgg 333
               ||||||||||||||||||||||
Sbjct: 5824147 aggccggggacgagcaggccgg 5824126



to top

>ref|NM_201350.1| Rattus norvegicus SH3/ankyrin domain gene 2 (Shank2), transcript
           variant 1, mRNA
          Length = 5625

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 cccacaggaaggctcccttca 408
           |||||||||||||||||||||
Sbjct: 68  cccacaggaaggctcccttca 48



to top

>emb|AJ339219.1|HSA339219 Homo sapiens genomic sequence surrounding NotI site, clone
           NR5-DG21RS
          Length = 691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 299 gctgtgggaggcgaggccggg 319
           |||||||||||||||||||||
Sbjct: 447 gctgtgggaggcgaggccggg 467



to top

>gb|AY298755.1| Rattus norvegicus Shank2E (Shank2) mRNA, complete cds
          Length = 5625

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 cccacaggaaggctcccttca 408
           |||||||||||||||||||||
Sbjct: 68  cccacaggaaggctcccttca 48



to top

>gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome
          Length = 569630

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    ccttagacttagagtgactt 253
              ||||||||||||||||||||
Sbjct: 143129 ccttagacttagagtgactt 143148



to top

>ref|XM_470097.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 5247

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 266 gccgaggcggacggcgttga 285
           ||||||||||||||||||||
Sbjct: 522 gccgaggcggacggcgttga 503



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      tcaattatttattgccggga 54
               ||||||||||||||||||||
Sbjct: 3284106 tcaattatttattgccggga 3284087



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      tcaattatttattgccggga 54
               ||||||||||||||||||||
Sbjct: 3211714 tcaattatttattgccggga 3211695



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      tcaattatttattgccggga 54
               ||||||||||||||||||||
Sbjct: 3212280 tcaattatttattgccggga 3212261



to top

>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence
          Length = 199604

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 400   ctcccttcaccaggtcccca 419
             ||||||||||||||||||||
Sbjct: 17844 ctcccttcaccaggtcccca 17825



to top

>gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mitochondrion, complete
              genome
          Length = 701046

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    ccttagacttagagtgactt 253
              ||||||||||||||||||||
Sbjct: 484117 ccttagacttagagtgactt 484136



to top

>gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion, complete genome
          Length = 569553

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    ccttagacttagagtgactt 253
              ||||||||||||||||||||
Sbjct: 497773 ccttagacttagagtgactt 497792



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 266      gccgaggcggacggcgttga 285
                ||||||||||||||||||||
Sbjct: 33921081 gccgaggcggacggcgttga 33921100



to top

>gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion, complete genome
          Length = 535825

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    ccttagacttagagtgactt 253
              ||||||||||||||||||||
Sbjct: 151896 ccttagacttagagtgactt 151915



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      tcaattatttattgccggga 54
               ||||||||||||||||||||
Sbjct: 3280400 tcaattatttattgccggga 3280381



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 257     ggcgatgcggccgaggcgga 276
               ||||||||||||||||||||
Sbjct: 1524799 ggcgatgcggccgaggcgga 1524818



to top

>gb|AF329815.1| Danio rerio insulin-like growth factor 1 receptor mRNA, partial cds
          Length = 3035

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  ggaggcgaggccggggacgagcag 328
            |||||||||| |||||||||||||
Sbjct: 1154 ggaggcgaggacggggacgagcag 1131



to top

>gb|AC090079.6| Homo sapiens chromosome 17, clone CTD-2535P7, complete sequence
          Length = 200477

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    taatatagcgcgcacacaca 136
              ||||||||||||||||||||
Sbjct: 174443 taatatagcgcgcacacaca 174424



to top

>gb|AY043191.1| Danio rerio insulin-like growth factor I receptor mRNA, partial cds
          Length = 3285

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  ggaggcgaggccggggacgagcag 328
            |||||||||| |||||||||||||
Sbjct: 1384 ggaggcgaggacggggacgagcag 1361



to top

>ref|XM_677864.1| PREDICTED: Danio rerio similar to IGF-IRb receptor (LOC555371), mRNA
          Length = 6179

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  ggaggcgaggccggggacgagcag 328
            |||||||||| |||||||||||||
Sbjct: 4340 ggaggcgaggacggggacgagcag 4317



to top

>gb|AC148690.1| Macaca mulatta Major Histocompatibility Complex BAC MMU227F07, complete
             sequence
          Length = 202515

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    ttttattcatgaaggccttg 32
             ||||||||||||||||||||
Sbjct: 56974 ttttattcatgaaggccttg 56955



to top

>gb|AC148682.1| Macaca mulatta Major Histocompatibility Complex MMU151L13, complete
              sequence
          Length = 199819

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     ttttattcatgaaggccttg 32
              ||||||||||||||||||||
Sbjct: 161026 ttttattcatgaaggccttg 161007



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    ttttattcatgaaggccttg 32
             ||||||||||||||||||||
Sbjct: 69252 ttttattcatgaaggccttg 69233



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 266      gccgaggcggacggcgttga 285
                ||||||||||||||||||||
Sbjct: 34011553 gccgaggcggacggcgttga 34011572



to top

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 13      ttttattcatgaaggccttg 32
               ||||||||||||||||||||
Sbjct: 3196493 ttttattcatgaaggccttg 3196512



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 13      ttttattcatgaaggccttg 32
               ||||||||||||||||||||
Sbjct: 3104737 ttttattcatgaaggccttg 3104756



to top

>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence, complete
              sequence
          Length = 172337

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    gccgaggcggacggcgttga 285
              ||||||||||||||||||||
Sbjct: 136610 gccgaggcggacggcgttga 136591



to top

>emb|BX088692.7| Zebrafish DNA sequence from clone CH211-208A20 in linkage group 7,
             complete sequence
          Length = 210074

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 305   ggaggcgaggccggggacgagcag 328
             |||||||||| |||||||||||||
Sbjct: 79894 ggaggcgaggacggggacgagcag 79917



to top

>emb|AL928976.4| Zebrafish DNA sequence from clone CH211-134B16, complete sequence
          Length = 173937

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 305    ggaggcgaggccggggacgagcag 328
              |||||||||| |||||||||||||
Sbjct: 157133 ggaggcgaggacggggacgagcag 157110



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 468     gggttgggcgcgtcgccggc 487
               ||||||||||||||||||||
Sbjct: 3192310 gggttgggcgcgtcgccggc 3192329



to top

>gb|AC117205.3| Mus musculus BAC clone RP23-257K20 from 10, complete sequence
          Length = 177430

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 400   ctcccttcaccaggtcccca 419
             ||||||||||||||||||||
Sbjct: 55956 ctcccttcaccaggtcccca 55975



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      tcaattatttattgccggga 54
               ||||||||||||||||||||
Sbjct: 3211587 tcaattatttattgccggga 3211568



to top

>dbj|D86951.1| Mesocricetus auratus mRNA for CYP3A31, complete cds
          Length = 1972

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    ttcaattgcattttattcatgaag 26
            |||| |||||||||||||||||||
Sbjct: 1658 ttcatttgcattttattcatgaag 1635


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,763,039
Number of Sequences: 3902068
Number of extensions: 3763039
Number of successful extensions: 66771
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66377
Number of HSP's gapped (non-prelim): 376
length of query: 489
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 467
effective length of database: 17,147,199,772
effective search space: 8007742293524
effective search space used: 8007742293524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top