ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart30f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY529459.1| Peromyscus keeni voucher AF17160 cytochrome b gen... 42 0.14
2gb|AY529458.1| Peromyscus keeni voucher AF15200 cytochrome b gen... 42 0.14
3gb|AY529457.1| Peromyscus keeni voucher AF17165 cytochrome b gen... 42 0.14
4gb|AY529456.1| Peromyscus keeni voucher AF17164 cytochrome b gen... 42 0.14
5gb|AY529455.1| Peromyscus keeni voucher AF4593 cytochrome b gene... 42 0.14
6gb|AY529454.1| Peromyscus keeni voucher AF4594 cytochrome b gene... 42 0.14
7gb|AY529453.1| Peromyscus keeni voucher AF22088 cytochrome b gen... 42 0.14
8gb|AY529452.1| Peromyscus keeni voucher AF12570 cytochrome b gen... 42 0.14
9gb|AY529451.1| Peromyscus keeni voucher AF12534 cytochrome b gen... 42 0.14
10gb|AY529450.1| Peromyscus keeni voucher AF8758 cytochrome b gene... 42 0.14
11gb|AY529442.1| Peromyscus keeni voucher AF17878 cytochrome b gen... 42 0.14
12gb|AY529441.1| Peromyscus keeni voucher AF12465 cytochrome b gen... 42 0.14
13gb|AY529440.1| Peromyscus keeni voucher AF19763 cytochrome b gen... 42 0.14
14gb|AY529439.1| Peromyscus keeni voucher AF12608 cytochrome b gen... 42 0.14
15gb|AY529438.1| Peromyscus keeni voucher AF12606 cytochrome b gen... 42 0.14
16gb|AY529437.1| Peromyscus keeni voucher AF34545 cytochrome b gen... 42 0.14
17gb|AY529436.1| Peromyscus keeni voucher AF34544 cytochrome b gen... 42 0.14
18gb|AY529435.1| Peromyscus keeni voucher AF34549 cytochrome b gen... 42 0.14
19gb|AY529434.1| Peromyscus keeni voucher AF34548 cytochrome b gen... 42 0.14
20gb|AY529433.1| Peromyscus keeni voucher AF34547 cytochrome b gen... 42 0.14
21gb|AY529432.1| Peromyscus keeni voucher AF34546 cytochrome b gen... 42 0.14
22gb|AY529431.1| Peromyscus keeni voucher AF34543 cytochrome b gen... 42 0.14
23gb|AY529428.1| Peromyscus keeni voucher AF19762 cytochrome b gen... 42 0.14
24gb|AY529427.1| Peromyscus keeni voucher AF19760 cytochrome b gen... 42 0.14
25gb|AY529426.1| Peromyscus keeni voucher AF19758 cytochrome b gen... 42 0.14
26gb|AY529425.1| Peromyscus keeni voucher AF19755 cytochrome b gen... 42 0.14
27gb|AY529424.1| Peromyscus keeni voucher AF19754 cytochrome b gen... 42 0.14
28gb|AY529423.1| Peromyscus keeni voucher AF19763 cytochrome b gen... 42 0.14
29gb|AY529422.1| Peromyscus keeni voucher AF19761 cytochrome b gen... 42 0.14
30gb|AY529421.1| Peromyscus keeni voucher AF19757 cytochrome b gen... 42 0.14
31gb|AY529420.1| Peromyscus keeni voucher AF29750 cytochrome b gen... 42 0.14
32gb|AY529419.1| Peromyscus keeni voucher AF29750 cytochrome b gen... 42 0.14
33gb|AY529418.1| Peromyscus keeni voucher AF29706 cytochrome b gen... 42 0.14
34gb|AY529417.1| Peromyscus keeni voucher AF29789 cytochrome b gen... 42 0.14
35gb|AY529416.1| Peromyscus keeni voucher AF35789 cytochrome b gen... 42 0.14
36gb|AY529415.1| Peromyscus keeni voucher AF35787 cytochrome b gen... 42 0.14
37gb|AY529414.1| Peromyscus keeni voucher AF35782 cytochrome b gen... 42 0.14
38gb|AY529413.1| Peromyscus keeni voucher AF12739 cytochrome b gen... 42 0.14
39gb|AY529412.1| Peromyscus keeni voucher AF12747 cytochrome b gen... 42 0.14
40gb|AY529411.1| Peromyscus keeni voucher AF12744 cytochrome b gen... 42 0.14
41gb|AY529410.1| Peromyscus keeni voucher AF12738 cytochrome b gen... 42 0.14
42gb|AY529409.1| Peromyscus keeni voucher AF8709 cytochrome b gene... 42 0.14
43gb|AY529408.1| Peromyscus keeni voucher AF7952 cytochrome b gene... 42 0.14
44gb|AY529407.1| Peromyscus keeni voucher AF12740 cytochrome b gen... 42 0.14
45gb|AY529406.1| Peromyscus keeni voucher AF12746 cytochrome b gen... 42 0.14
46gb|AY529405.1| Peromyscus keeni voucher AF6889 cytochrome b gene... 42 0.14
47gb|AY529404.1| Peromyscus keeni voucher AF6878 cytochrome b gene... 42 0.14
48gb|AY529403.1| Peromyscus keeni voucher AF6901 cytochrome b gene... 42 0.14
49gb|AY529402.1| Peromyscus keeni voucher AF6877 cytochrome b gene... 42 0.14
50gb|AY529401.1| Peromyscus keeni voucher AF6879 cytochrome b gene... 42 0.14
51gb|AY529400.1| Peromyscus keeni voucher AF6882 cytochrome b gene... 42 0.14
52gb|AY529399.1| Peromyscus keeni voucher AF6893 cytochrome b gene... 42 0.14
53gb|AY529398.1| Peromyscus keeni voucher AF6890 cytochrome b gene... 42 0.14
54gb|AY529397.1| Peromyscus keeni voucher AF6881 cytochrome b gene... 42 0.14
55gb|AY529396.1| Peromyscus keeni voucher AF35526 cytochrome b gen... 42 0.14
56gb|AY529395.1| Peromyscus keeni voucher AF30562 cytochrome b gen... 42 0.14
57gb|AY529394.1| Peromyscus keeni voucher AF16765 cytochrome b gen... 42 0.14
58gb|AY529393.1| Peromyscus keeni voucher AF16762 cytochrome b gen... 42 0.14
59gb|AY529392.1| Peromyscus keeni voucher AF16761 cytochrome b gen... 42 0.14
60gb|AY529391.1| Peromyscus keeni voucher AF16759 cytochrome b gen... 42 0.14
61gb|AY529390.1| Peromyscus keeni voucher AF16757 cytochrome b gen... 42 0.14
62gb|AY529389.1| Peromyscus keeni voucher AF16764 cytochrome b gen... 42 0.14
63gb|AY529388.1| Peromyscus keeni voucher AF16763 cytochrome b gen... 42 0.14
64gb|AY529387.1| Peromyscus keeni voucher AF16760 cytochrome b gen... 42 0.14
65gb|AY529386.1| Peromyscus keeni voucher AF16758 cytochrome b gen... 42 0.14
66gb|AY529385.1| Peromyscus keeni voucher AF16756 cytochrome b gen... 42 0.14
67gb|AY529384.1| Peromyscus keeni voucher AF7626 cytochrome b gene... 42 0.14
68gb|AY529383.1| Peromyscus keeni voucher AF7624 cytochrome b gene... 42 0.14
69gb|AY529381.1| Peromyscus keeni voucher AF7617 cytochrome b gene... 42 0.14
70gb|AY529380.1| Peromyscus keeni voucher AF7625 cytochrome b gene... 42 0.14
71gb|AY529379.1| Peromyscus keeni voucher AF7622 cytochrome b gene... 42 0.14
72gb|AY529378.1| Peromyscus keeni voucher AF7620 cytochrome b gene... 42 0.14
73gb|AY529377.1| Peromyscus keeni voucher AF7619 cytochrome b gene... 42 0.14
74gb|AY529376.1| Peromyscus keeni voucher AF7618 cytochrome b gene... 42 0.14
75gb|AY529375.1| Peromyscus keeni voucher AF7615 cytochrome b gene... 42 0.14
76gb|AY529374.1| Peromyscus keeni voucher AF12745 cytochrome b gen... 42 0.14
77gb|AY529373.1| Peromyscus keeni voucher AF12743 cytochrome b gen... 42 0.14
78gb|AY529372.1| Peromyscus keeni voucher AF12742 cytochrome b gen... 42 0.14
79gb|AY529371.1| Peromyscus keeni voucher AF12741 cytochrome b gen... 42 0.14
80gb|AY529370.1| Peromyscus keeni voucher AF2471 cytochrome b gene... 42 0.14
81gb|AY529369.1| Peromyscus keeni voucher AF2472 cytochrome b gene... 42 0.14
82gb|AY529368.1| Peromyscus keeni voucher AF2470 cytochrome b gene... 42 0.14
83gb|AY529367.1| Peromyscus keeni voucher AF2469 cytochrome b gene... 42 0.14
84gb|AY529366.1| Peromyscus keeni voucher AF2468 cytochrome b gene... 42 0.14
85gb|AY529365.1| Peromyscus keeni voucher AF2424 cytochrome b gene... 42 0.14
86gb|AY529364.1| Peromyscus keeni voucher AF2423 cytochrome b gene... 42 0.14
87gb|AY529363.1| Peromyscus keeni voucher AF2422 cytochrome b gene... 42 0.14
88gb|AY529362.1| Peromyscus keeni voucher AF2421 cytochrome b gene... 42 0.14
89gb|AY529361.1| Peromyscus keeni voucher AF2420 cytochrome b gene... 42 0.14
90gb|AY529357.1| Peromyscus keeni voucher AF16772 cytochrome b gen... 42 0.14
91gb|AY529356.1| Peromyscus keeni voucher AF35791 cytochrome b gen... 42 0.14
92gb|AY529355.1| Peromyscus keeni voucher AF35790 cytochrome b gen... 42 0.14
93gb|AY529354.1| Peromyscus keeni voucher AF35788 cytochrome b gen... 42 0.14
94gb|AY529353.1| Peromyscus keeni voucher AF35786 cytochrome b gen... 42 0.14
95gb|AY529352.1| Peromyscus keeni voucher AF35785 cytochrome b gen... 42 0.14
96gb|AY529351.1| Peromyscus keeni voucher AF35784 cytochrome b gen... 42 0.14
97gb|AY529350.1| Peromyscus keeni voucher AF35783 cytochrome b gen... 42 0.14
98gb|AY529349.1| Peromyscus keeni voucher AF35529 cytochrome b gen... 42 0.14
99gb|AY529348.1| Peromyscus keeni voucher AF35528 cytochrome b gen... 42 0.14
100gb|AY529347.1| Peromyscus keeni voucher AF35527 cytochrome b gen... 42 0.14
101gb|AY529346.1| Peromyscus keeni voucher AF35525 cytochrome b gen... 42 0.14
102gb|AY529345.1| Peromyscus keeni voucher AF35524 cytochrome b gen... 42 0.14
103gb|AY529344.1| Peromyscus keeni voucher AF35523 cytochrome b gen... 42 0.14
104gb|AY529343.1| Peromyscus keeni voucher AF35522 cytochrome b gen... 42 0.14
105gb|AY529342.1| Peromyscus keeni voucher AF30563 cytochrome b gen... 42 0.14
106gb|AY529341.1| Peromyscus keeni voucher AF16771 cytochrome b gen... 42 0.14
107gb|AY529340.1| Peromyscus keeni voucher AF16770 cytochrome b gen... 42 0.14
108gb|AY529339.1| Peromyscus keeni voucher AF16603 cytochrome b gen... 42 0.14
109gb|AY529338.1| Peromyscus keeni voucher AF16602 cytochrome b gen... 42 0.14
110gb|AY529337.1| Peromyscus keeni voucher AF16601 cytochrome b gen... 42 0.14
111gb|AY529336.1| Peromyscus keeni voucher AF16600 cytochrome b gen... 42 0.14
112gb|AY529335.1| Peromyscus keeni voucher AF10108 cytochrome b gen... 42 0.14
113gb|AY529334.1| Peromyscus keeni voucher AF10107 cytochrome b gen... 42 0.14
114gb|AY529333.1| Peromyscus keeni voucher AF10106 cytochrome b gen... 42 0.14
115gb|AY529332.1| Peromyscus keeni voucher AF10104 cytochrome b gen... 42 0.14
116gb|AY529331.1| Peromyscus keeni voucher AF10103 cytochrome b gen... 42 0.14
117gb|AY529330.1| Peromyscus keeni voucher AF10101 cytochrome b gen... 42 0.14
118gb|AY529329.1| Peromyscus keeni voucher AF10100 cytochrome b gen... 42 0.14
119gb|AY529328.1| Peromyscus keeni voucher AF10099 cytochrome b gen... 42 0.14
120gb|AY529327.1| Peromyscus keeni voucher AF10105 cytochrome b gen... 42 0.14
121gb|AY529326.1| Peromyscus keeni voucher AF10102 cytochrome b gen... 42 0.14
122gb|AY529325.1| Peromyscus keeni voucher AF34371 cytochrome b gen... 42 0.14
123gb|AY529324.1| Peromyscus keeni voucher AF34370 cytochrome b gen... 42 0.14
124gb|AY529323.1| Peromyscus keeni voucher AF34372 cytochrome b gen... 42 0.14
125gb|AY529322.1| Peromyscus keeni voucher AF34369 cytochrome b gen... 42 0.14
126gb|AY529321.1| Peromyscus keeni voucher AF34368 cytochrome b gen... 42 0.14
127gb|AY529320.1| Peromyscus keeni voucher AF34367 cytochrome b gen... 42 0.14
128gb|AY529319.1| Peromyscus keeni voucher AF34309 cytochrome b gen... 42 0.14
129gb|AY529318.1| Peromyscus keeni voucher AF34205 cytochrome b gen... 42 0.14
130gb|AY529317.1| Peromyscus keeni voucher AF34203 cytochrome b gen... 42 0.14
131gb|AY529316.1| Peromyscus keeni voucher AF34202 cytochrome b gen... 42 0.14
132gb|AY529315.1| Peromyscus keeni voucher AF26420 cytochrome b gen... 42 0.14
133gb|AY529314.1| Peromyscus keeni voucher AF26419 cytochrome b gen... 42 0.14
134gb|AY529313.1| Peromyscus keeni voucher AF26418 cytochrome b gen... 42 0.14
135gb|AY529312.1| Peromyscus keeni voucher AF26415 cytochrome b gen... 42 0.14
136gb|AY529311.1| Peromyscus keeni voucher AF26414 cytochrome b gen... 42 0.14
137gb|AY529310.1| Peromyscus keeni voucher AF26412 cytochrome b gen... 42 0.14
138gb|AY529309.1| Peromyscus keeni voucher AF26411 cytochrome b gen... 42 0.14
139gb|AY529308.1| Peromyscus keeni voucher AF26410 cytochrome b gen... 42 0.14
140gb|AY529307.1| Peromyscus keeni voucher AF26413 cytochrome b gen... 42 0.14
141gb|AY529306.1| Peromyscus keeni voucher AF26417 cytochrome b gen... 42 0.14
142gb|AY529305.1| Peromyscus keeni voucher AF10334 cytochrome b gen... 42 0.14
143gb|AY529304.1| Peromyscus keeni voucher AF10333 cytochrome b gen... 42 0.14
144gb|AY529303.1| Peromyscus keeni voucher AF10332 cytochrome b gen... 42 0.14
145gb|AY529302.1| Peromyscus keeni voucher AF10331 cytochrome b gen... 42 0.14
146gb|AY529301.1| Peromyscus keeni voucher AF10330 cytochrome b gen... 42 0.14
147gb|AY529300.1| Peromyscus keeni voucher AF10329 cytochrome b gen... 42 0.14
148gb|AY529299.1| Peromyscus keeni voucher AF10328 cytochrome b gen... 42 0.14
149gb|AY529298.1| Peromyscus keeni voucher AF10327 cytochrome b gen... 42 0.14
150gb|AY529297.1| Peromyscus keeni voucher AF10326 cytochrome b gen... 42 0.14
151gb|AY529296.1| Peromyscus keeni voucher AF10322 cytochrome b gen... 42 0.14
152gb|AY529287.1| Peromyscus keeni voucher AF7038 cytochrome b gene... 42 0.14
153gb|AY529286.1| Peromyscus keeni voucher AF25652 cytochrome b gen... 42 0.14
154gb|AY529285.1| Peromyscus keeni voucher AF25651 cytochrome b gen... 42 0.14
155gb|AY529284.1| Peromyscus keeni voucher AF25649 cytochrome b gen... 42 0.14
156gb|AY529283.1| Peromyscus keeni voucher AF25647 cytochrome b gen... 42 0.14
157gb|AY529282.1| Peromyscus keeni voucher AF25646 cytochrome b gen... 42 0.14
158gb|AY529281.1| Peromyscus keeni voucher AF4802 cytochrome b gene... 42 0.14
159gb|AY529280.1| Peromyscus keeni voucher AF4801 cytochrome b gene... 42 0.14
160gb|AY529279.1| Peromyscus keeni voucher AF4795 cytochrome b gene... 42 0.14
161gb|AY529278.1| Peromyscus keeni voucher AF4794 cytochrome b gene... 42 0.14
162gb|AY529277.1| Peromyscus keeni voucher AF4809 cytochrome b gene... 42 0.14
163gb|AY529276.1| Peromyscus keeni voucher AF4803 cytochrome b gene... 42 0.14
164gb|AY529275.1| Peromyscus keeni voucher AF4800 cytochrome b gene... 42 0.14
165gb|AY529274.1| Peromyscus keeni voucher AF4799 cytochrome b gene... 42 0.14
166gb|AY529273.1| Peromyscus keeni voucher AF4798 cytochrome b gene... 42 0.14
167gb|AY529272.1| Peromyscus keeni voucher AF4797 cytochrome b gene... 42 0.14
168gb|AY529271.1| Peromyscus keeni voucher AF2633 cytochrome b gene... 42 0.14
169gb|AY529270.1| Peromyscus keeni voucher AF2634 cytochrome b gene... 42 0.14
170gb|AY529269.1| Peromyscus keeni voucher AF4414 cytochrome b gene... 42 0.14
171gb|AY529268.1| Peromyscus keeni voucher AF4412 cytochrome b gene... 42 0.14
172gb|AY529267.1| Peromyscus keeni voucher AF4410 cytochrome b gene... 42 0.14
173gb|AY529266.1| Peromyscus keeni voucher AF4418 cytochrome b gene... 42 0.14
174gb|AY529265.1| Peromyscus keeni voucher AF4417 cytochrome b gene... 42 0.14
175gb|AY529264.1| Peromyscus keeni voucher AF4416 cytochrome b gene... 42 0.14
176gb|AY529263.1| Peromyscus keeni voucher AF4415 cytochrome b gene... 42 0.14
177gb|AY529262.1| Peromyscus keeni voucher AF4413 cytochrome b gene... 42 0.14
178gb|AY529261.1| Peromyscus keeni voucher AF4411 cytochrome b gene... 42 0.14
179gb|AY529260.1| Peromyscus keeni voucher AF4409 cytochrome b gene... 42 0.14
180gb|AY529259.1| Peromyscus keeni voucher AF7028 cytochrome b gene... 42 0.14
181gb|AY529258.1| Peromyscus keeni voucher AF7027 cytochrome b gene... 42 0.14
182gb|AY529257.1| Peromyscus keeni voucher AF7026 cytochrome b gene... 42 0.14
183gb|AY529256.1| Peromyscus keeni voucher AF7025 cytochrome b gene... 42 0.14
184gb|AY529255.1| Peromyscus keeni voucher AF7019 cytochrome b gene... 42 0.14
185gb|AY529254.1| Peromyscus keeni voucher AF29790 cytochrome b gen... 42 0.14
186gb|AY529253.1| Peromyscus keeni voucher AF29707 cytochrome b gen... 42 0.14
187gb|AY529252.1| Peromyscus keeni voucher AF29752 cytochrome b gen... 42 0.14
188gb|AY529251.1| Peromyscus keeni voucher AF25654 cytochrome b gen... 42 0.14
189gb|AY529250.1| Peromyscus keeni voucher AF25653 cytochrome b gen... 42 0.14
190gb|AY529249.1| Peromyscus keeni voucher AF25648 cytochrome b gen... 42 0.14
191gb|AY529248.1| Peromyscus keeni voucher AF25645 cytochrome b gen... 42 0.14
192gb|AY529247.1| Peromyscus keeni voucher AF25644 cytochrome b gen... 42 0.14
193gb|AY529246.1| Peromyscus keeni voucher AF2632 cytochrome b gene... 42 0.14
194gb|AY529245.1| Peromyscus keeni voucher AF2631 cytochrome b gene... 42 0.14
195gb|AY529244.1| Peromyscus keeni voucher AF2630 cytochrome b gene... 42 0.14
196gb|AY529243.1| Peromyscus keeni voucher AF2628 cytochrome b gene... 42 0.14
197gb|AY529242.1| Peromyscus keeni voucher AF2627 cytochrome b gene... 42 0.14
198gb|AY529241.1| Peromyscus keeni voucher AF2626 cytochrome b gene... 42 0.14
199gb|AY529240.1| Peromyscus keeni voucher AF2625 cytochrome b gene... 42 0.14
200gb|AY529239.1| Peromyscus keeni voucher AF2624 cytochrome b gene... 42 0.14
201gb|AY529238.1| Peromyscus keeni voucher AF15816 cytochrome b gen... 42 0.14
202gb|AY529237.1| Peromyscus keeni voucher AF15814 cytochrome b gen... 42 0.14
203gb|AY529236.1| Peromyscus keeni voucher AF15813 cytochrome b gen... 42 0.14
204gb|AY529235.1| Peromyscus keeni voucher AF15812 cytochrome b gen... 42 0.14
205gb|AY529234.1| Peromyscus keeni voucher AF15811 cytochrome b gen... 42 0.14
206gb|AY529233.1| Peromyscus keeni voucher AF15805 cytochrome b gen... 42 0.14
207gb|AY529232.1| Peromyscus keeni voucher AF15792 cytochrome b gen... 42 0.14
208gb|AY529231.1| Peromyscus keeni voucher AF15787 cytochrome b gen... 42 0.14
209gb|AY529230.1| Peromyscus keeni voucher AF15786 cytochrome b gen... 42 0.14
210gb|AY529229.1| Peromyscus keeni voucher AF15785 cytochrome b gen... 42 0.14
211gb|AY529228.1| Peromyscus keeni voucher AF39602 cytochrome b gen... 42 0.14
212gb|AY529227.1| Peromyscus keeni voucher AF39601 cytochrome b gen... 42 0.14
213gb|AY529226.1| Peromyscus keeni voucher AF12506 cytochrome b gen... 42 0.14
214gb|AY529225.1| Peromyscus keeni voucher AF12505 cytochrome b gen... 42 0.14
215gb|AY529224.1| Peromyscus keeni voucher AF8767 cytochrome b gene... 42 0.14
216gb|AY529223.1| Peromyscus keeni voucher AF17906 cytochrome b gen... 42 0.14
217gb|AY529222.1| Peromyscus keeni voucher AF17905 cytochrome b gen... 42 0.14
218gb|AY529221.1| Peromyscus keeni voucher AF17904 cytochrome b gen... 42 0.14
219gb|AY529220.1| Peromyscus keeni voucher AF16872 cytochrome b gen... 42 0.14
220gb|AY529219.1| Peromyscus keeni voucher AF16871 cytochrome b gen... 42 0.14
221gb|AY529218.1| Peromyscus keeni voucher AF16870 cytochrome b gen... 42 0.14
222gb|AY529217.1| Peromyscus keeni voucher AF16869 cytochrome b gen... 42 0.14
223gb|AY529216.1| Peromyscus keeni voucher AF16868 cytochrome b gen... 42 0.14
224gb|AY529215.1| Peromyscus keeni voucher AF16867 cytochrome b gen... 42 0.14
225gb|AY529214.1| Peromyscus keeni voucher AF16866 cytochrome b gen... 42 0.14
226gb|AY529213.1| Peromyscus keeni voucher AF26175 cytochrome b gen... 42 0.14
227gb|AY529212.1| Peromyscus keeni voucher AF26176 cytochrome b gen... 42 0.14
228gb|AY529211.1| Peromyscus keeni voucher AF26171 cytochrome b gen... 42 0.14
229gb|AY529210.1| Peromyscus keeni voucher AF26173 cytochrome b gen... 42 0.14
230gb|AY529209.1| Peromyscus keeni voucher AF26170 cytochrome b gen... 42 0.14
231gb|AY529208.1| Peromyscus keeni voucher AF26169 cytochrome b gen... 42 0.14
232gb|AY529207.1| Peromyscus keeni voucher AF26168 cytochrome b gen... 42 0.14
233gb|AY529206.1| Peromyscus keeni cytochrome b gene, partial cds; ... 42 0.14
234gb|AY529205.1| Peromyscus keeni voucher AF26161 cytochrome b gen... 42 0.14
235gb|AY529204.1| Peromyscus keeni voucher AF26160 cytochrome b gen... 42 0.14
236gb|AY184600.1| Peromyscus maniculatus clone AF4593 cytochrome b ... 42 0.14
237gb|AY184599.1| Peromyscus maniculatus clone AF12544 cytochrome b... 42 0.14
238gb|AY184598.1| Peromyscus maniculatus clone AF12545 cytochrome b... 42 0.14
239gb|AY184597.1| Peromyscus maniculatus clone AF12536 cytochrome b... 42 0.14
240gb|AY184596.1| Peromyscus maniculatus clone SNV046 cytochrome b ... 42 0.14
241gb|AY184595.1| Peromyscus maniculatus clone SNV045 cytochrome b ... 42 0.14
242gb|AY184594.1| Peromyscus maniculatus clone XGZ421 cytochrome b ... 42 0.14
243gb|AY184593.1| Peromyscus maniculatus clone SNV168 cytochrome b ... 42 0.14
244gb|AY184592.1| Peromyscus maniculatus clone SNV167 cytochrome b ... 42 0.14
245gb|AY184591.1| Peromyscus maniculatus clone JEB041 cytochrome b ... 42 0.14
246gb|AY184590.1| Peromyscus maniculatus clone XGZ093 cytochrome b ... 42 0.14
247gb|AY184589.1| Peromyscus maniculatus clone AF4362 cytochrome b ... 42 0.14
248gb|AY184588.1| Peromyscus maniculatus clone XGZ071 cytochrome b ... 42 0.14
249gb|AY184587.1| Peromyscus maniculatus clone XGZ062 cytochrome b ... 42 0.14
250gb|AY184586.1| Peromyscus maniculatus clone AF4361 cytochrome b ... 42 0.14
251gb|AY184585.1| Peromyscus maniculatus clone AF4360 cytochrome b ... 42 0.14
252gb|AY184584.1| Peromyscus maniculatus clone AF4357 cytochrome b ... 42 0.14
253gb|AY184583.1| Peromyscus maniculatus clone AF4355 cytochrome b ... 42 0.14
254gb|AY184582.1| Peromyscus maniculatus clone XGZ349 cytochrome b ... 42 0.14
255gb|AY184581.1| Peromyscus maniculatus clone SNV174 cytochrome b ... 42 0.14
256gb|AY184580.1| Peromyscus maniculatus clone XGZ109 cytochrome b ... 42 0.14
257gb|AY184579.1| Peromyscus maniculatus clone XGZ104 cytochrome b ... 42 0.14
258gb|AY184578.1| Peromyscus maniculatus clone XGZ366 cytochrome b ... 42 0.14
259gb|AY184577.1| Peromyscus maniculatus clone XGZ335 cytochrome b ... 42 0.14
260gb|AY184576.1| Peromyscus maniculatus clone XGZ348 cytochrome b ... 42 0.14
261gb|AY184575.1| Peromyscus maniculatus clone XGZ334 cytochrome b ... 42 0.14
262gb|AY184574.1| Peromyscus maniculatus clone SNV065 cytochrome b ... 42 0.14
263gb|AY184573.1| Peromyscus maniculatus clone AF12543 cytochrome b... 42 0.14
264gb|AY184572.1| Peromyscus maniculatus clone XGZ426 cytochrome b ... 42 0.14
265gb|AY184571.1| Peromyscus maniculatus clone XGZ415 cytochrome b ... 42 0.14
266gb|AY184570.1| Peromyscus maniculatus clone XGZ058 cytochrome b ... 42 0.14
267gb|AY184569.1| Peromyscus maniculatus clone SNV135 cytochrome b ... 42 0.14
268gb|AY184568.1| Peromyscus maniculatus clone SNV064 cytochrome b ... 42 0.14
269gb|AY184567.1| Peromyscus maniculatus clone SNV051 cytochrome b ... 42 0.14
270gb|AY184566.1| Peromyscus maniculatus clone XGZ023 cytochrome b ... 42 0.14
271gb|AY184565.1| Peromyscus maniculatus clone DP96053 cytochrome b... 42 0.14
272gb|AY184564.1| Peromyscus maniculatus clone SNV140 cytochrome b ... 42 0.14
273gb|AY184563.1| Peromyscus maniculatus clone SNV139 cytochrome b ... 42 0.14
274gb|AY184562.1| Peromyscus maniculatus clone SNV138 cytochrome b ... 42 0.14
275gb|AY184561.1| Peromyscus maniculatus clone SNV137 cytochrome b ... 42 0.14
276gb|AY184560.1| Peromyscus maniculatus clone SNV134 cytochrome b ... 42 0.14
277gb|AY184559.1| Peromyscus maniculatus clone SNV128 cytochrome b ... 42 0.14
278gb|AY184558.1| Peromyscus maniculatus clone SNV066 cytochrome b ... 42 0.14
279gb|AY184557.1| Peromyscus maniculatus clone SNV061 cytochrome b ... 42 0.14
280gb|AY184556.1| Peromyscus maniculatus clone SNV058 cytochrome b ... 42 0.14
281gb|AY184555.1| Peromyscus maniculatus clone JEB018 cytochrome b ... 42 0.14
282gb|AY184554.1| Peromyscus maniculatus clone DP96071 cytochrome b... 42 0.14
283gb|AY184553.1| Peromyscus maniculatus clone DP96062 cytochrome b... 42 0.14
284gb|AY184552.1| Peromyscus maniculatus clone DP96054 cytochrome b... 42 0.14
285gb|AY184551.1| Peromyscus maniculatus clone DP95070 cytochrome b... 42 0.14
286gb|AF119261.1|AF119261 Peromyscus maniculatus cytochrome b gene,... 42 0.14
287emb|X89787.1|MTPKCYTB P.keeni mitochondrial DNA for cyt b gene 42 0.14
288gb|AY529295.1| Peromyscus keeni voucher AF12613 cytochrome b gen... 40 0.57
289gb|AY529294.1| Peromyscus keeni voucher AF12612 cytochrome b gen... 40 0.57
290gb|AY529293.1| Peromyscus keeni voucher AF12611 cytochrome b gen... 40 0.57
291gb|AY529292.1| Peromyscus keeni voucher AF12610 cytochrome b gen... 40 0.57
292gb|AY529291.1| Peromyscus keeni voucher AF12609 cytochrome b gen... 40 0.57
293gb|AY529290.1| Peromyscus keeni voucher AF7022 cytochrome b gene... 40 0.57
294gb|AY529289.1| Peromyscus keeni voucher AF7021 cytochrome b gene... 40 0.57
295gb|AY529288.1| Peromyscus keeni voucher AF7020 cytochrome b gene... 40 0.57
296gb|AY859473.1| Peromyscus maniculatus isolate BYU14073 cytochrom... 40 0.57
297gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 40 0.57
298gb|AC159449.1| Trypanosoma brucei chromosome 4 clone RPCI93-5D20... 40 0.57
299gb|DQ000484.1| Peromyscus maniculatus voucher TK11695 cytochrome... 40 0.57
300gb|AC099771.9| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP... 40 0.57
301gb|AC069444.17| Homo sapiens 3 BAC RP11-169N13 (Roswell Park Can... 40 0.57
302gb|AY041199.1| Peromyscus maniculatus cytochrome b (cyt b) gene,... 40 0.57
303gb|AY184756.1| Peromyscus maniculatus clone XGZ317 cytochrome b ... 40 0.57
304gb|AY184755.1| Peromyscus maniculatus clone HEH141 cytochrome b ... 40 0.57
305gb|AY184754.1| Peromyscus maniculatus clone SNV190 cytochrome b ... 40 0.57
306gb|AY184753.1| Peromyscus maniculatus clone SNV047 cytochrome b ... 40 0.57
307gb|AY184752.1| Peromyscus maniculatus clone XGZ325 cytochrome b ... 40 0.57
308gb|AY184751.1| Peromyscus maniculatus clone XGZ318 cytochrome b ... 40 0.57
309gb|AY184750.1| Peromyscus maniculatus clone XGZ332 cytochrome b ... 40 0.57
310gb|AY184749.1| Peromyscus maniculatus clone XGZ321 cytochrome b ... 40 0.57
311gb|AY184748.1| Peromyscus maniculatus clone AJS140 cytochrome b ... 40 0.57
312gb|AY184747.1| Peromyscus maniculatus clone AF12903 cytochrome b... 40 0.57
313gb|AY184746.1| Peromyscus maniculatus clone HEH132 cytochrome b ... 40 0.57
314gb|AY184745.1| Peromyscus maniculatus clone HEH128 cytochrome b ... 40 0.57
315gb|AY184744.1| Peromyscus maniculatus clone AF12892 cytochrome b... 40 0.57
316gb|AY184743.1| Peromyscus maniculatus clone AF12891 cytochrome b... 40 0.57
317gb|AY184742.1| Peromyscus maniculatus clone AF12890 cytochrome b... 40 0.57
318gb|AY184741.1| Peromyscus maniculatus clone AF12889 cytochrome b... 40 0.57
319gb|AY184740.1| Peromyscus maniculatus clone XGZ054 cytochrome b ... 40 0.57
320gb|AY184739.1| Peromyscus maniculatus clone XGZ050 cytochrome b ... 40 0.57
321gb|AY184738.1| Peromyscus maniculatus clone XGZ433 cytochrome b ... 40 0.57
322gb|AY184737.1| Peromyscus maniculatus clone XGZ432 cytochrome b ... 40 0.57
323gb|AY184736.1| Peromyscus maniculatus clone XGZ018 cytochrome b ... 40 0.57
324gb|AY184735.1| Peromyscus maniculatus clone XGZ007 cytochrome b ... 40 0.57
325gb|AY184734.1| Peromyscus maniculatus clone NCP893 cytochrome b ... 40 0.57
326gb|AY184733.1| Peromyscus maniculatus clone NCP892 cytochrome b ... 40 0.57
327gb|AY184732.1| Peromyscus maniculatus clone XGZ298 cytochrome b ... 40 0.57
328gb|AY184731.1| Peromyscus maniculatus clone AJS136 cytochrome b ... 40 0.57
329gb|AY184730.1| Peromyscus maniculatus clone XGZ428 cytochrome b ... 40 0.57
330gb|AY184729.1| Peromyscus maniculatus clone AJS132 cytochrome b ... 40 0.57
331gb|AY184728.1| Peromyscus maniculatus clone XGZ418 cytochrome b ... 40 0.57
332gb|AY184727.1| Peromyscus maniculatus clone XGZ411 cytochrome b ... 40 0.57
333gb|AY184726.1| Peromyscus maniculatus clone XGZ431 cytochrome b ... 40 0.57
334gb|AY184725.1| Peromyscus maniculatus clone XGZ429 cytochrome b ... 40 0.57
335gb|AY184724.1| Peromyscus maniculatus clone XGZ410 cytochrome b ... 40 0.57
336gb|AY184723.1| Peromyscus maniculatus clone XGZ409 cytochrome b ... 40 0.57
337gb|AY184722.1| Peromyscus maniculatus clone XGZ408 cytochrome b ... 40 0.57
338gb|AY184721.1| Peromyscus maniculatus clone XGZ407 cytochrome b ... 40 0.57
339gb|AY184720.1| Peromyscus maniculatus clone XGZ371 cytochrome b ... 40 0.57
340gb|AY184719.1| Peromyscus maniculatus clone XGZ049 cytochrome b ... 40 0.57
341gb|AY184718.1| Peromyscus maniculatus clone XGZ038 cytochrome b ... 40 0.57
342gb|AY184717.1| Peromyscus maniculatus clone XGZ036 cytochrome b ... 40 0.57
343gb|AY184716.1| Peromyscus maniculatus clone SNV192 cytochrome b ... 40 0.57
344gb|AY184715.1| Peromyscus maniculatus clone NCP902 cytochrome b ... 40 0.57
345gb|AY184714.1| Peromyscus maniculatus clone JEB044 cytochrome b ... 40 0.57
346gb|AY184713.1| Peromyscus maniculatus clone HEH124 cytochrome b ... 40 0.57
347gb|AY184712.1| Peromyscus maniculatus clone EM289 cytochrome b (... 40 0.57
348gb|AY184711.1| Peromyscus maniculatus clone DP96065 cytochrome b... 40 0.57
349gb|AY184710.1| Peromyscus maniculatus clone XGZ368 cytochrome b ... 40 0.57
350gb|AY184709.1| Peromyscus maniculatus clone XGZ292 cytochrome b ... 40 0.57
351gb|AY184707.1| Peromyscus maniculatus clone XGZ288 cytochrome b ... 40 0.57
352gb|AY184706.1| Peromyscus maniculatus clone XGZ132 cytochrome b ... 40 0.57
353gb|AY184705.1| Peromyscus maniculatus clone XGZ004 cytochrome b ... 40 0.57
354gb|AY184704.1| Peromyscus maniculatus clone GJK158 cytochrome b ... 40 0.57
355gb|AY184703.1| Peromyscus maniculatus clone GJK152 cytochrome b ... 40 0.57
356gb|AY184702.1| Peromyscus maniculatus clone XGZ310 cytochrome b ... 40 0.57
357gb|AY184701.1| Peromyscus maniculatus clone XGZ305 cytochrome b ... 40 0.57
358gb|AY184700.1| Peromyscus maniculatus clone XGZ286 cytochrome b ... 40 0.57
359gb|AY184699.1| Peromyscus maniculatus clone EM290 cytochrome b (... 40 0.57
360gb|AY184698.1| Peromyscus maniculatus clone AJS145 cytochrome b ... 40 0.57
361gb|AY184697.1| Peromyscus maniculatus clone AJS131 cytochrome b ... 40 0.57
362gb|AY184696.1| Peromyscus maniculatus clone XGZ314 cytochrome b ... 40 0.57
363gb|AY184695.1| Peromyscus maniculatus clone XGZ311 cytochrome b ... 40 0.57
364gb|AY184694.1| Peromyscus maniculatus clone XGZ290 cytochrome b ... 40 0.57
365gb|AY184693.1| Peromyscus maniculatus clone XGZ170 cytochrome b ... 40 0.57
366gb|AY184692.1| Peromyscus maniculatus clone XGZ163 cytochrome b ... 40 0.57
367gb|AY184691.1| Peromyscus maniculatus clone XGZ159 cytochrome b ... 40 0.57
368gb|AY184690.1| Peromyscus maniculatus clone XGZ129 cytochrome b ... 40 0.57
369gb|AY184689.1| Peromyscus maniculatus clone XGZ128 cytochrome b ... 40 0.57
370gb|AY184688.1| Peromyscus maniculatus clone XGZ005 cytochrome b ... 40 0.57
371gb|AY184687.1| Peromyscus maniculatus clone SNV022 cytochrome b ... 40 0.57
372gb|AY184686.1| Peromyscus maniculatus clone SNV018 cytochrome b ... 40 0.57
373gb|AY184685.1| Peromyscus maniculatus clone GJK156 cytochrome b ... 40 0.57
374gb|AY184684.1| Peromyscus maniculatus clone GJK155 cytochrome b ... 40 0.57
375gb|AY184683.1| Peromyscus maniculatus clone EM295 cytochrome b (... 40 0.57
376gb|AY184682.1| Peromyscus maniculatus clone EM294 cytochrome b (... 40 0.57
377gb|AY184681.1| Peromyscus maniculatus clone EM292 cytochrome b (... 40 0.57
378gb|AY184680.1| Peromyscus maniculatus clone AJS139 cytochrome b ... 40 0.57
379gb|AY184679.1| Peromyscus maniculatus clone AJS134 cytochrome b ... 40 0.57
380gb|AF155398.1|AF155398 Peromyscus melanotis cytochrome b gene, p... 40 0.57
381gb|AC120041.5| Homo sapiens chromosome 8, clone RP11-478M19, com... 40 0.57
382gb|AC104257.12| Homo sapiens chromosome 8, clone CTD-2501M5, com... 40 0.57
383gb|AY322508.1| Peromyscus maniculatus genotype TK72331 cytochrom... 40 0.57
384emb|X89791.1|MTPMCYTB P.melanotis mitochondrial DNA for cyt b gene 40 0.57
385gb|AY529449.1| Peromyscus keeni voucher AF17961 cytochrome b gen... 38 2.2
386gb|AY529448.1| Peromyscus keeni voucher AF17882 cytochrome b gen... 38 2.2
387gb|AY529447.1| Peromyscus keeni voucher AF12491 cytochrome b gen... 38 2.2
388gb|AY529446.1| Peromyscus keeni voucher AF12489 cytochrome b gen... 38 2.2
389gb|AY529445.1| Peromyscus keeni voucher AF12488 cytochrome b gen... 38 2.2
390gb|AY529444.1| Peromyscus keeni voucher AF12468 cytochrome b gen... 38 2.2
391gb|AY529443.1| Peromyscus keeni voucher AF12464 cytochrome b gen... 38 2.2
392gb|AY529382.1| Peromyscus keeni voucher AF7621 cytochrome b gene... 38 2.2
393gb|AC164116.4| Mus musculus BAC clone RP24-242F4 from chromosome... 38 2.2
394gb|AC151783.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 38 2.2
395gb|AC154510.2| Mus musculus BAC clone RP23-210I20 from chromosom... 38 2.2
396gb|AC079606.6| Trypanosoma brucei chromosome 2 clone RPCI93-3B10... 38 2.2
397gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence 38 2.2
398gb|AY237248.1| Potorous longipes isolate Hardy cytochrome b (cyt... 38 2.2
399gb|AY237233.1| Potorous longipes isolate 43G cytochrome b (cytb)... 38 2.2
400gb|AY237232.1| Potorous longipes isolate 119 cytochrome b (cytb)... 38 2.2
401gb|AC124685.5| Mus musculus BAC clone RP24-385O22 from chromosom... 38 2.2
402emb|AL732566.5| Mouse DNA sequence from clone RP24-357P21 on chr... 38 2.2
403emb|AL671256.1|TBN19B2 Trypanosoma brucei VO2 VSG expression sit... 38 2.2
404gb|AC146752.24| Medicago truncatula clone mth2-62d4, complete se... 38 2.2
405dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 38 2.2
406gb|AC097476.2| Homo sapiens BAC clone RP11-109N11 from 4, comple... 38 2.2
407gb|AC011361.4|AC011361 Homo sapiens chromosome 5 clone CTC-482N1... 38 2.2
408dbj|AP004856.3| Oryza sativa (japonica cultivar-group) genomic D... 38 2.2
409emb|Z33279.1|MC375 M.capricolum DNA for CONTIG MC375 38 2.2
410dbj|AP000808.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 2.2
411dbj|AP003732.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 2.2
412emb|AL772313.12| Mouse DNA sequence from clone RP23-128J10 on ch... 38 2.2
413gb|AY513847.1| Chionomys nivalis haplotype 3 cytochrome b (cytb)... 36 8.8
414gb|AY513846.1| Chionomys nivalis haplotype 2 cytochrome b (cytb)... 36 8.8
415gb|AY513845.1| Chionomys nivalis haplotype 1 cytochrome b (cytb)... 36 8.8
416gb|AC132266.4| Mus musculus BAC clone RP24-380L14 from chromosom... 36 8.8
417gb|AY485685.1| Myotis seabrai voucher 4183 cytochrome b gene, co... 36 8.8
418gb|AY485684.1| Myotis seabrai voucher SP4121 cytochrome b gene, ... 36 8.8
419gb|AY485683.1| Myotis seabrai voucher SP 4174 cytochrome b gene,... 36 8.8
420gb|AF157906.1| Spermophilus undulatus isolate S55 cytochrome b (... 36 8.8
421gb|DQ355838.1| Ryegrass mosaic virus isolate US2 NIb protein gen... 36 8.8
422gb|DQ355837.1| Ryegrass mosaic virus isolate US1 NIb protein gen... 36 8.8
423gb|AY540004.1| Homo sapiens clone EX2G-2 MID1 mRNA, partial sequ... 36 8.8
424gb|AE006387.1| Lactococcus lactis subsp. lactis IL1403 section 1... 36 8.8
425gb|AC146377.5| Pan troglodytes BAC clone RP43-79B6 from 7, compl... 36 8.8
426gb|AC144775.2| Mus musculus BAC clone RP24-152K24 from chromosom... 36 8.8
427gb|AC158136.11| Mus musculus chromosome 7, clone RP23-58I15, com... 36 8.8
428gb|AC002067.2| Homo sapiens BAC clone CTB-126M9 from 7, complete... 36 8.8
429ref|XM_808358.1| Trypanosoma cruzi strain CL Brener UDP-glucose/... 36 8.8
430emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome 36 8.8
431gb|AC125094.5| Mus musculus BAC clone RP24-176L12 from chromosom... 36 8.8
432gb|AC146759.29| Medicago truncatula clone mth2-173e19, complete ... 36 8.8
433gb|AC163628.5| Mus musculus BAC clone RP23-138F21 from chromosom... 36 8.8
434emb|AL591624.6| Human DNA sequence from clone RP11-143A22 on chr... 36 8.8
435emb|AL445250.4| Human DNA sequence from clone RP11-199A24 on chr... 36 8.8
436emb|AL139087.13| Human DNA sequence from clone RP11-83D23 on chr... 36 8.8
437emb|CR381637.5| Zebrafish DNA sequence from clone DKEY-225P19 in... 36 8.8
438emb|CR555306.1| Azoarcus sp. EbN1 complete genome 36 8.8
439gb|AC161816.5| Mus musculus BAC clone RP23-308L3 from chromosome... 36 8.8
440gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosom... 36 8.8
441emb|AL672199.16| Mouse DNA sequence from clone RP23-171O21 on ch... 36 8.8
442emb|AJ632306.1| Cotesia congregata virus complete genome, segmen... 36 8.8
443emb|BX950214.7| Zebrafish DNA sequence from clone CH211-214C2 in... 36 8.8
444emb|BX548248.9| Zebrafish DNA sequence from clone DKEY-245P14 in... 36 8.8
445gb|AC118653.6| Homo sapiens chromosome 17, clone CTD-2319F6, com... 36 8.8
446gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, compl... 36 8.8
447emb|BX530023.5| Zebrafish DNA sequence from clone DKEYP-50D11 in... 36 8.8
448emb|AJ537597.1|BAG537597 Bacillus agaradhaerens cel gene for put... 36 8.8
449emb|AJ537596.1|UNK537596 Uncultured bacterium cel gene for cellu... 36 8.8
450gb|AC008008.2| Homo sapiens Xp22 PAC RPCI6-102 (Roswell Park Can... 36 8.8
451ref|NM_078867.2| Drosophila melanogaster Dynein heavy chain at 3... 36 8.8
452gb|AC096768.3| Homo sapiens BAC clone RP11-722P15 from 4, comple... 36 8.8
453gb|AC092627.2| Homo sapiens BAC clone RP11-271B8 from 4, complet... 36 8.8
454ref|XM_692396.1| PREDICTED: Danio rerio similar to phosphofurin ... 36 8.8
455gb|AC140419.8| Mus musculus BAC clone RP24-435P9 from chromosome... 36 8.8
456gb|AC010121.7|AC010121 Drosophila melanogaster, chromosome 2L, r... 36 8.8
457gb|AC006448.14|AC006448 Homo sapiens chromosome 17, clone RP11-4... 36 8.8
458gb|AC064864.4| Homo sapiens BAC clone RP11-407M6 from 2, complet... 36 8.8
459dbj|AP005756.3| Oryza sativa (japonica cultivar-group) genomic D... 36 8.8
460gb|AE003655.3| Drosophila melanogaster chromosome 2L, section 64... 36 8.8
461gb|AC118685.10| Mus musculus chromosome 5, clone RP23-412L2, com... 36 8.8
462gb|AC079682.29| Mus musculus strain C57BL/6J chromosome 3 clone ... 36 8.8
463emb|CR753832.8| Zebrafish DNA sequence from clone DKEY-71C18 in ... 36 8.8
464gb|U65949.1|MMU65949 Mus musculus hepatocyte growth factor-like ... 36 8.8
465gb|AF035818.1|AF035818 Ryegrass mosaic virus strain RGMV-AV, com... 36 8.8
466gb|AC136008.5| Mus musculus BAC clone RP24-68J1 from 6, complete... 36 8.8
467gb|AC131122.4| Mus musculus BAC clone RP24-553B2 from 3, complet... 36 8.8
468gb|AC133200.3| Mus musculus BAC clone RP23-292C19 from 3, comple... 36 8.8
469dbj|AP006700.1| Lotus japonicus genomic DNA, chromosome 2, clone... 36 8.8
470gb|U46182.1|SSU46182 Spermophilus spilosoma cytochrome b gene, m... 36 8.8
471emb|AL731808.26| Mouse DNA sequence from clone RP23-286E6 on chr... 36 8.8
472emb|AL672297.7| Mouse DNA sequence from clone RP23-137E3 on chro... 36 8.8

>gb|AY529459.1| Peromyscus keeni voucher AF17160 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529458.1| Peromyscus keeni voucher AF15200 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529457.1| Peromyscus keeni voucher AF17165 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529456.1| Peromyscus keeni voucher AF17164 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529455.1| Peromyscus keeni voucher AF4593 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529454.1| Peromyscus keeni voucher AF4594 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529453.1| Peromyscus keeni voucher AF22088 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529452.1| Peromyscus keeni voucher AF12570 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529451.1| Peromyscus keeni voucher AF12534 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529450.1| Peromyscus keeni voucher AF8758 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529442.1| Peromyscus keeni voucher AF17878 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529441.1| Peromyscus keeni voucher AF12465 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529440.1| Peromyscus keeni voucher AF19763 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529439.1| Peromyscus keeni voucher AF12608 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529438.1| Peromyscus keeni voucher AF12606 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529437.1| Peromyscus keeni voucher AF34545 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529436.1| Peromyscus keeni voucher AF34544 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529435.1| Peromyscus keeni voucher AF34549 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529434.1| Peromyscus keeni voucher AF34548 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529433.1| Peromyscus keeni voucher AF34547 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529432.1| Peromyscus keeni voucher AF34546 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529431.1| Peromyscus keeni voucher AF34543 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529428.1| Peromyscus keeni voucher AF19762 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529427.1| Peromyscus keeni voucher AF19760 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529426.1| Peromyscus keeni voucher AF19758 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529425.1| Peromyscus keeni voucher AF19755 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529424.1| Peromyscus keeni voucher AF19754 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529423.1| Peromyscus keeni voucher AF19763 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529422.1| Peromyscus keeni voucher AF19761 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529421.1| Peromyscus keeni voucher AF19757 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529420.1| Peromyscus keeni voucher AF29750 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529419.1| Peromyscus keeni voucher AF29750 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529418.1| Peromyscus keeni voucher AF29706 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529417.1| Peromyscus keeni voucher AF29789 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529416.1| Peromyscus keeni voucher AF35789 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529415.1| Peromyscus keeni voucher AF35787 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529414.1| Peromyscus keeni voucher AF35782 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529413.1| Peromyscus keeni voucher AF12739 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529412.1| Peromyscus keeni voucher AF12747 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529411.1| Peromyscus keeni voucher AF12744 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529410.1| Peromyscus keeni voucher AF12738 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529409.1| Peromyscus keeni voucher AF8709 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529408.1| Peromyscus keeni voucher AF7952 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529407.1| Peromyscus keeni voucher AF12740 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529406.1| Peromyscus keeni voucher AF12746 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529405.1| Peromyscus keeni voucher AF6889 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529404.1| Peromyscus keeni voucher AF6878 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529403.1| Peromyscus keeni voucher AF6901 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529402.1| Peromyscus keeni voucher AF6877 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529401.1| Peromyscus keeni voucher AF6879 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529400.1| Peromyscus keeni voucher AF6882 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529399.1| Peromyscus keeni voucher AF6893 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529398.1| Peromyscus keeni voucher AF6890 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529397.1| Peromyscus keeni voucher AF6881 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529396.1| Peromyscus keeni voucher AF35526 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529395.1| Peromyscus keeni voucher AF30562 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529394.1| Peromyscus keeni voucher AF16765 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529393.1| Peromyscus keeni voucher AF16762 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529392.1| Peromyscus keeni voucher AF16761 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529391.1| Peromyscus keeni voucher AF16759 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529390.1| Peromyscus keeni voucher AF16757 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529389.1| Peromyscus keeni voucher AF16764 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529388.1| Peromyscus keeni voucher AF16763 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529387.1| Peromyscus keeni voucher AF16760 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529386.1| Peromyscus keeni voucher AF16758 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529385.1| Peromyscus keeni voucher AF16756 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529384.1| Peromyscus keeni voucher AF7626 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529383.1| Peromyscus keeni voucher AF7624 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529381.1| Peromyscus keeni voucher AF7617 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529380.1| Peromyscus keeni voucher AF7625 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529379.1| Peromyscus keeni voucher AF7622 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529378.1| Peromyscus keeni voucher AF7620 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529377.1| Peromyscus keeni voucher AF7619 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529376.1| Peromyscus keeni voucher AF7618 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529375.1| Peromyscus keeni voucher AF7615 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529374.1| Peromyscus keeni voucher AF12745 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529373.1| Peromyscus keeni voucher AF12743 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529372.1| Peromyscus keeni voucher AF12742 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529371.1| Peromyscus keeni voucher AF12741 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529370.1| Peromyscus keeni voucher AF2471 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529369.1| Peromyscus keeni voucher AF2472 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529368.1| Peromyscus keeni voucher AF2470 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529367.1| Peromyscus keeni voucher AF2469 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529366.1| Peromyscus keeni voucher AF2468 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529365.1| Peromyscus keeni voucher AF2424 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529364.1| Peromyscus keeni voucher AF2423 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529363.1| Peromyscus keeni voucher AF2422 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529362.1| Peromyscus keeni voucher AF2421 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529361.1| Peromyscus keeni voucher AF2420 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529357.1| Peromyscus keeni voucher AF16772 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529356.1| Peromyscus keeni voucher AF35791 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529355.1| Peromyscus keeni voucher AF35790 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529354.1| Peromyscus keeni voucher AF35788 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529353.1| Peromyscus keeni voucher AF35786 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529352.1| Peromyscus keeni voucher AF35785 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529351.1| Peromyscus keeni voucher AF35784 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529350.1| Peromyscus keeni voucher AF35783 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529349.1| Peromyscus keeni voucher AF35529 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529348.1| Peromyscus keeni voucher AF35528 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529347.1| Peromyscus keeni voucher AF35527 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529346.1| Peromyscus keeni voucher AF35525 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529345.1| Peromyscus keeni voucher AF35524 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529344.1| Peromyscus keeni voucher AF35523 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529343.1| Peromyscus keeni voucher AF35522 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529342.1| Peromyscus keeni voucher AF30563 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529341.1| Peromyscus keeni voucher AF16771 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529340.1| Peromyscus keeni voucher AF16770 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529339.1| Peromyscus keeni voucher AF16603 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529338.1| Peromyscus keeni voucher AF16602 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529337.1| Peromyscus keeni voucher AF16601 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529336.1| Peromyscus keeni voucher AF16600 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529335.1| Peromyscus keeni voucher AF10108 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529334.1| Peromyscus keeni voucher AF10107 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529333.1| Peromyscus keeni voucher AF10106 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529332.1| Peromyscus keeni voucher AF10104 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529331.1| Peromyscus keeni voucher AF10103 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529330.1| Peromyscus keeni voucher AF10101 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529329.1| Peromyscus keeni voucher AF10100 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529328.1| Peromyscus keeni voucher AF10099 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529327.1| Peromyscus keeni voucher AF10105 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529326.1| Peromyscus keeni voucher AF10102 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529325.1| Peromyscus keeni voucher AF34371 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529324.1| Peromyscus keeni voucher AF34370 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529323.1| Peromyscus keeni voucher AF34372 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529322.1| Peromyscus keeni voucher AF34369 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529321.1| Peromyscus keeni voucher AF34368 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529320.1| Peromyscus keeni voucher AF34367 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529319.1| Peromyscus keeni voucher AF34309 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529318.1| Peromyscus keeni voucher AF34205 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529317.1| Peromyscus keeni voucher AF34203 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529316.1| Peromyscus keeni voucher AF34202 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529315.1| Peromyscus keeni voucher AF26420 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529314.1| Peromyscus keeni voucher AF26419 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529313.1| Peromyscus keeni voucher AF26418 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529312.1| Peromyscus keeni voucher AF26415 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529311.1| Peromyscus keeni voucher AF26414 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529310.1| Peromyscus keeni voucher AF26412 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529309.1| Peromyscus keeni voucher AF26411 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529308.1| Peromyscus keeni voucher AF26410 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529307.1| Peromyscus keeni voucher AF26413 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529306.1| Peromyscus keeni voucher AF26417 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529305.1| Peromyscus keeni voucher AF10334 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529304.1| Peromyscus keeni voucher AF10333 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529303.1| Peromyscus keeni voucher AF10332 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529302.1| Peromyscus keeni voucher AF10331 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529301.1| Peromyscus keeni voucher AF10330 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529300.1| Peromyscus keeni voucher AF10329 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529299.1| Peromyscus keeni voucher AF10328 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529298.1| Peromyscus keeni voucher AF10327 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529297.1| Peromyscus keeni voucher AF10326 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529296.1| Peromyscus keeni voucher AF10322 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529287.1| Peromyscus keeni voucher AF7038 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529286.1| Peromyscus keeni voucher AF25652 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529285.1| Peromyscus keeni voucher AF25651 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529284.1| Peromyscus keeni voucher AF25649 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529283.1| Peromyscus keeni voucher AF25647 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529282.1| Peromyscus keeni voucher AF25646 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529281.1| Peromyscus keeni voucher AF4802 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529280.1| Peromyscus keeni voucher AF4801 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529279.1| Peromyscus keeni voucher AF4795 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529278.1| Peromyscus keeni voucher AF4794 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529277.1| Peromyscus keeni voucher AF4809 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529276.1| Peromyscus keeni voucher AF4803 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529275.1| Peromyscus keeni voucher AF4800 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529274.1| Peromyscus keeni voucher AF4799 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529273.1| Peromyscus keeni voucher AF4798 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529272.1| Peromyscus keeni voucher AF4797 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529271.1| Peromyscus keeni voucher AF2633 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529270.1| Peromyscus keeni voucher AF2634 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529269.1| Peromyscus keeni voucher AF4414 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529268.1| Peromyscus keeni voucher AF4412 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529267.1| Peromyscus keeni voucher AF4410 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529266.1| Peromyscus keeni voucher AF4418 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529265.1| Peromyscus keeni voucher AF4417 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529264.1| Peromyscus keeni voucher AF4416 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529263.1| Peromyscus keeni voucher AF4415 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529262.1| Peromyscus keeni voucher AF4413 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529261.1| Peromyscus keeni voucher AF4411 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529260.1| Peromyscus keeni voucher AF4409 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529259.1| Peromyscus keeni voucher AF7028 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529258.1| Peromyscus keeni voucher AF7027 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529257.1| Peromyscus keeni voucher AF7026 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529256.1| Peromyscus keeni voucher AF7025 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529255.1| Peromyscus keeni voucher AF7019 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529254.1| Peromyscus keeni voucher AF29790 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529253.1| Peromyscus keeni voucher AF29707 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529252.1| Peromyscus keeni voucher AF29752 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529251.1| Peromyscus keeni voucher AF25654 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529250.1| Peromyscus keeni voucher AF25653 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529249.1| Peromyscus keeni voucher AF25648 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529248.1| Peromyscus keeni voucher AF25645 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529247.1| Peromyscus keeni voucher AF25644 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529246.1| Peromyscus keeni voucher AF2632 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529245.1| Peromyscus keeni voucher AF2631 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529244.1| Peromyscus keeni voucher AF2630 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529243.1| Peromyscus keeni voucher AF2628 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529242.1| Peromyscus keeni voucher AF2627 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529241.1| Peromyscus keeni voucher AF2626 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529240.1| Peromyscus keeni voucher AF2625 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529239.1| Peromyscus keeni voucher AF2624 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529238.1| Peromyscus keeni voucher AF15816 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529237.1| Peromyscus keeni voucher AF15814 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529236.1| Peromyscus keeni voucher AF15813 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529235.1| Peromyscus keeni voucher AF15812 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529234.1| Peromyscus keeni voucher AF15811 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529233.1| Peromyscus keeni voucher AF15805 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529232.1| Peromyscus keeni voucher AF15792 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529231.1| Peromyscus keeni voucher AF15787 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529230.1| Peromyscus keeni voucher AF15786 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529229.1| Peromyscus keeni voucher AF15785 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529228.1| Peromyscus keeni voucher AF39602 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529227.1| Peromyscus keeni voucher AF39601 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529226.1| Peromyscus keeni voucher AF12506 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529225.1| Peromyscus keeni voucher AF12505 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529224.1| Peromyscus keeni voucher AF8767 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529223.1| Peromyscus keeni voucher AF17906 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529222.1| Peromyscus keeni voucher AF17905 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529221.1| Peromyscus keeni voucher AF17904 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529220.1| Peromyscus keeni voucher AF16872 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529219.1| Peromyscus keeni voucher AF16871 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529218.1| Peromyscus keeni voucher AF16870 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529217.1| Peromyscus keeni voucher AF16869 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529216.1| Peromyscus keeni voucher AF16868 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529215.1| Peromyscus keeni voucher AF16867 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529214.1| Peromyscus keeni voucher AF16866 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529213.1| Peromyscus keeni voucher AF26175 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529212.1| Peromyscus keeni voucher AF26176 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529211.1| Peromyscus keeni voucher AF26171 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529210.1| Peromyscus keeni voucher AF26173 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529209.1| Peromyscus keeni voucher AF26170 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529208.1| Peromyscus keeni voucher AF26169 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529207.1| Peromyscus keeni voucher AF26168 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529206.1| Peromyscus keeni cytochrome b gene, partial cds; mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529205.1| Peromyscus keeni voucher AF26161 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY529204.1| Peromyscus keeni voucher AF26160 cytochrome b gene, partial cds;
          mitochondrial
          Length = 560

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 17 attaattaaaatcatcaatgaatct 41



to top

>gb|AY184600.1| Peromyscus maniculatus clone AF4593 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184599.1| Peromyscus maniculatus clone AF12544 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184598.1| Peromyscus maniculatus clone AF12545 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184597.1| Peromyscus maniculatus clone AF12536 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184596.1| Peromyscus maniculatus clone SNV046 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184595.1| Peromyscus maniculatus clone SNV045 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184594.1| Peromyscus maniculatus clone XGZ421 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184593.1| Peromyscus maniculatus clone SNV168 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184592.1| Peromyscus maniculatus clone SNV167 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184591.1| Peromyscus maniculatus clone JEB041 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184590.1| Peromyscus maniculatus clone XGZ093 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184589.1| Peromyscus maniculatus clone AF4362 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184588.1| Peromyscus maniculatus clone XGZ071 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184587.1| Peromyscus maniculatus clone XGZ062 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51



to top

>gb|AY184586.1| Peromyscus maniculatus clone AF4361 cytochrome b (cytb) gene,
          partial cds; mitochondrial gene for mitochondrial
          product
          Length = 479

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 25 attaattaaaatcatcaatggatct 49
          |||||||||||||||||||| ||||
Sbjct: 27 attaattaaaatcatcaatgaatct 51


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 851,391
Number of Sequences: 3902068
Number of extensions: 851391
Number of successful extensions: 64137
Number of sequences better than 10.0: 472
Number of HSP's better than 10.0 without gapping: 473
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63548
Number of HSP's gapped (non-prelim): 589
length of query: 61
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 40
effective length of database: 17,151,101,840
effective search space: 686044073600
effective search space used: 686044073600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top