ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart30d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, com... 40 0.38
2gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p... 40 0.38
3gb|AC093492.3| Oryza sativa (japonica cultivar-group) chromosome... 38 1.5
4gb|AC121541.31| Mus musculus chromosome 5, clone RP24-132B11, co... 38 1.5
5gb|AC147484.21| Medicago truncatula clone mth2-52b4, complete se... 38 1.5
6dbj|AK154941.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 38 1.5
7dbj|AK049785.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 38 1.5
8dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 38 1.5
9gb|AC139718.1| Homo sapiens BAC clone RP11-269F21 from 4, comple... 38 1.5
10gb|AC139333.4| Mus musculus BAC clone RP24-83F12 from 3, complet... 38 1.5
11gb|AC166173.3| Mus musculus BAC clone RP23-101K10 from chromosom... 38 1.5
12gb|AC123732.9| Mus musculus chromosome 1, clone RP23-459I8, comp... 36 6.0
13gb|AC131592.10| Mus musculus chromosome 1, clone RP24-547I3, com... 36 6.0
14gb|AC126408.6| Mus musculus chromosome 13, clone RP23-216P14, co... 36 6.0
15gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 36 6.0
16gb|AC133205.3| Mus musculus BAC clone RP23-108P11 from chromosom... 36 6.0
17gb|AC153529.7| Mus musculus 10 BAC RP23-239G23 (Roswell Park Can... 36 6.0
18emb|AL627069.10| Mouse DNA sequence from clone RP23-385C16 on ch... 36 6.0
19emb|AL928645.6| Mouse DNA sequence from clone RP23-452N23 on chr... 36 6.0
20gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare str... 36 6.0
21gb|AC067773.4| Homo sapiens chromosome 8, clone RP11-706J10, com... 36 6.0
22gb|AC013509.5|AC013509 Homo sapiens chromosome , clone RP11-115I... 36 6.0
23dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.0
24gb|AC159114.7| Mus musculus BAC RP23-370L19 (Roswell Park Cance... 36 6.0
25gb|AC068655.3|AC068655 Genomic Sequence For Arabidopsis thaliana... 36 6.0
26gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana... 36 6.0
27emb|BX649384.6| Zebrafish DNA sequence from clone CH211-199G17 i... 36 6.0
28gb|DQ323045.1| Phaseolus vulgaris clone BAC-71F18, complete sequ... 36 6.0

>gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, complete sequence
          Length = 197616

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 1      acacaaccaatgttcacataaatc 24
              ||||||||||| ||||||||||||
Sbjct: 115312 acacaaccaatattcacataaatc 115289



to top

>gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p21-p11, complete
             sequence
          Length = 213611

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     acacaaccaatgttcacataaatc 24
             ||||||||||| ||||||||||||
Sbjct: 64629 acacaaccaatattcacataaatc 64606



to top

>gb|AC093492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0059G01, complete sequence
          Length = 141661

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     caatgttcacataaatcaa 26
             |||||||||||||||||||
Sbjct: 66473 caatgttcacataaatcaa 66491



to top

>gb|AC121541.31| Mus musculus chromosome 5, clone RP24-132B11, complete sequence
          Length = 171770

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     caaccaatgttcacataaa 22
             |||||||||||||||||||
Sbjct: 18543 caaccaatgttcacataaa 18561



to top

>gb|AC147484.21| Medicago truncatula clone mth2-52b4, complete sequence
          Length = 119559

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     caatgttcacataaatcaa 26
             |||||||||||||||||||
Sbjct: 85546 caatgttcacataaatcaa 85564



to top

>dbj|AK154941.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630112C03
            product:Rap2 interacting protein x homolog [Homo
            sapiens], full insert sequence
          Length = 3535

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 4    caaccaatgttcacataaa 22
            |||||||||||||||||||
Sbjct: 2932 caaccaatgttcacataaa 2914



to top

>dbj|AK049785.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530049N02
           product:unclassifiable, full insert sequence
          Length = 921

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 4   caaccaatgttcacataaa 22
           |||||||||||||||||||
Sbjct: 290 caaccaatgttcacataaa 272



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 8       caatgttcacataaatcaa 26
               |||||||||||||||||||
Sbjct: 3079229 caatgttcacataaatcaa 3079247



to top

>gb|AC139718.1| Homo sapiens BAC clone RP11-269F21 from 4, complete sequence
          Length = 127342

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     taaatcaacctccctaaca 37
              |||||||||||||||||||
Sbjct: 103662 taaatcaacctccctaaca 103680



to top

>gb|AC139333.4| Mus musculus BAC clone RP24-83F12 from 3, complete sequence
          Length = 162197

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 5     aaccaatgttcacataaatcaac 27
             |||||||||||||||||| ||||
Sbjct: 82623 aaccaatgttcacataaaacaac 82601



to top

>gb|AC166173.3| Mus musculus BAC clone RP23-101K10 from chromosome 3, complete sequence
          Length = 196177

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 5     aaccaatgttcacataaatcaac 27
             |||||||||||||||||| ||||
Sbjct: 12029 aaccaatgttcacataaaacaac 12051



to top

>gb|AC123732.9| Mus musculus chromosome 1, clone RP23-459I8, complete sequence
          Length = 158620

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     aatgttcacataaatcaa 26
             ||||||||||||||||||
Sbjct: 91762 aatgttcacataaatcaa 91745



to top

>gb|AC131592.10| Mus musculus chromosome 1, clone RP24-547I3, complete sequence
          Length = 154667

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 20    aaatcaacctccctaaca 37
             ||||||||||||||||||
Sbjct: 90538 aaatcaacctccctaaca 90555



to top

>gb|AC126408.6| Mus musculus chromosome 13, clone RP23-216P14, complete sequence
          Length = 238967

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    tcaacctccctaacacca 40
             ||||||||||||||||||
Sbjct: 81267 tcaacctccctaacacca 81284



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 11       tgttcacataaatcaacc 28
                ||||||||||||||||||
Sbjct: 13792631 tgttcacataaatcaacc 13792648



to top

>gb|AC133205.3| Mus musculus BAC clone RP23-108P11 from chromosome 13, complete
            sequence
          Length = 205640

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 23   tcaacctccctaacacca 40
            ||||||||||||||||||
Sbjct: 5111 tcaacctccctaacacca 5128



to top

>gb|AC153529.7| Mus musculus 10 BAC RP23-239G23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 153084

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    atgttcacataaatcaac 27
             ||||||||||||||||||
Sbjct: 86909 atgttcacataaatcaac 86892



to top

>emb|AL627069.10| Mouse DNA sequence from clone RP23-385C16 on chromosome 11 Contains the
             Mrps24 gene for mitochondrial ribosomal protein S24, a
             novel gene, a ubiquitin-conjugating enzyme E2D (Ube2d)
             pseudogene, the Dbnl gene for drebrin-like, the Pgam2 gene
             for phosphoglycerate mutase 2, a pseudogene similar to
             part of H+ transporting mitochondrial F0 complex ATP
             synthase subunit F Atp5j, the Polm gene for polymerase
             (DNA directed) mu, the Aebp1 gene for AE binding protein
             1, the Pold2 gene for polymerase (DNA directed) delta 2
             regulatory subunit, novel gene (1600028I17Rik) and seven
             CpG islands, complete sequence
          Length = 195129

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    ccctaacaccaagctaca 47
             ||||||||||||||||||
Sbjct: 15661 ccctaacaccaagctaca 15644



to top

>emb|AL928645.6| Mouse DNA sequence from clone RP23-452N23 on chromosome 4 Contains part
             of the Ptprd gene for receptor type protein tyrosine
             phosphatase D, complete sequence
          Length = 172513

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     accaatgttcacataaat 23
             ||||||||||||||||||
Sbjct: 36192 accaatgttcacataaat 36175



to top

>gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0048D11, from chromosome 3, complete sequence
          Length = 158911

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    tgttcacataaatcaacc 28
             ||||||||||||||||||
Sbjct: 69159 tgttcacataaatcaacc 69176



to top

>gb|AC067773.4| Homo sapiens chromosome 8, clone RP11-706J10, complete sequence
          Length = 174397

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 20     aaatcaacctccctaacaccaa 41
              ||||||||||| ||||||||||
Sbjct: 126849 aaatcaacctctctaacaccaa 126870



to top

>gb|AC013509.5|AC013509 Homo sapiens chromosome , clone RP11-115I9, complete sequence
          Length = 151544

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 20    aaatcaacctccctaacaccaa 41
             ||||||||||| ||||||||||
Sbjct: 80211 aaatcaacctctctaacaccaa 80190



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 11       tgttcacataaatcaacc 28
                ||||||||||||||||||
Sbjct: 13787606 tgttcacataaatcaacc 13787623



to top

>gb|AC159114.7| Mus musculus  BAC RP23-370L19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 169393

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     atgttcacataaatcaac 27
              ||||||||||||||||||
Sbjct: 128153 atgttcacataaatcaac 128170



to top

>gb|AC068655.3|AC068655 Genomic Sequence For Arabidopsis thaliana Clone F17K4 From Chromosome
             V, complete sequence
          Length = 89453

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    taaatcaacctccctaac 36
             ||||||||||||||||||
Sbjct: 86411 taaatcaacctccctaac 86428



to top

>gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana Clone T1A4 From Chromosome V,
             complete sequence
          Length = 85746

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    taaatcaacctccctaac 36
             ||||||||||||||||||
Sbjct: 12473 taaatcaacctccctaac 12490



to top

>emb|BX649384.6| Zebrafish DNA sequence from clone CH211-199G17 in linkage group 19,
              complete sequence
          Length = 190998

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 9      aatgttcacataaatcaacctc 30
              |||||||| |||||||||||||
Sbjct: 188088 aatgttcaaataaatcaacctc 188067



to top

>gb|DQ323045.1| Phaseolus vulgaris clone BAC-71F18, complete sequence
          Length = 157468

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 8     caatgttcacataaatcaacct 29
             ||||||||||| ||||||||||
Sbjct: 72629 caatgttcacaaaaatcaacct 72650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 315,296
Number of Sequences: 3902068
Number of extensions: 315296
Number of successful extensions: 79227
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79101
Number of HSP's gapped (non-prelim): 126
length of query: 47
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 27
effective length of database: 17,155,003,908
effective search space: 463185105516
effective search space used: 463185105516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top