Clone Name | rbart30d01 |
---|---|
Clone Library Name | barley_pub |
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 482 bits (243), Expect = e-133 Identities = 249/251 (99%) Strand = Plus / Minus Query: 36 gaattcacaggttttacacaagtaaattgacagggtcgatcgtcacaggtttcacagcac 95 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1020 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 961 Query: 96 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 960 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 901 Query: 156 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 900 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 841 Query: 216 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcg 275 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 840 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 781 Query: 276 ggagatgaaga 286 ||||||||||| Sbjct: 780 ggagatgaaga 770
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Plus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 8319519 acggacggacgggcgggcggg 8319499
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Plus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 8317354 acggacggacgggcgggcggg 8317334
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 95.6 bits (48), Expect = 7e-17 Identities = 57/60 (95%) Strand = Plus / Minus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 227 ggcggcggtgagcttagtagtcggtggtggggagttgctcgtgggtgcgggagatga 283 ||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 242 agtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 801 Score = 56.0 bits (28), Expect = 6e-05 Identities = 65/76 (85%), Gaps = 6/76 (7%) Strand = Plus / Minus Query: 3 aactcaactgaacttgaaattactcggg-----cggacgaattcacaggttttacacaag 57 ||||||||| |||||||||||||||||| ||| |||||||||| |||||||| ||| Sbjct: 1101 aactcaactcaacttgaaattactcgggcgggacgggcgaattcaca-gttttacagaag 1043 Query: 58 taaattgacagggtcg 73 |||||||||| |||| Sbjct: 1042 caaattgacagtgtcg 1027 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 aagcaaacttaaacgactcatg 169 |||||||||||||||||||||| Sbjct: 977 aagcaaacttaaacgactcatg 956
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 77.8 bits (39), Expect = 2e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 ||||||||||||||||||||| |||||||||||| |||||||||||| Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 707
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 69.9 bits (35), Expect = 4e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 |||||||||||||| |||||| |||||||||||| |||||||||||| Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaaga 804
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 69.9 bits (35), Expect = 4e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 |||||||||||||| |||||| |||||||||||| |||||||||||| Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaaga 708
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 69.9 bits (35), Expect = 4e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 |||||| |||||||||||||| |||||||||||| |||||||||||| Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaaga 780
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 69.9 bits (35), Expect = 4e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 |||||||||||||| |||||| |||||||||||| |||||||||||| Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaaga 803
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 69.9 bits (35), Expect = 4e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 240 ttagtagtcggtggtggggagttgctcgtgggtgcgggagatgaaga 286 |||||||||||||| |||||| |||||||||||| |||||||||||| Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaaga 800
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 67.9 bits (34), Expect = 2e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 238 gcttagtagtcggtggtggggagttgctcgtgggtgcgggag 279 ||||||||||||||||||||||| |||||||||||| ||||| Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggag 796
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 50.1 bits (25), Expect = 0.004 Identities = 34/37 (91%) Strand = Plus / Minus Query: 238 gcttagtagtcggtggtggggagttgctcgtgggtgc 274 ||||||||||| | ||||||||| ||||||||||||| Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823
>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene) Length = 716 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 241 tagtagtcggtggtggggagttgctcgtgggtg 273 |||||||| ||||| |||||||||||||||||| Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence Length = 134793 Score = 46.1 bits (23), Expect = 0.061 Identities = 23/23 (100%) Strand = Plus / Plus Query: 210 cgggcgggcggggggcaggcggc 232 ||||||||||||||||||||||| Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds Length = 9803 Score = 46.1 bits (23), Expect = 0.061 Identities = 23/23 (100%) Strand = Plus / Minus Query: 210 cgggcgggcggggggcaggcggc 232 ||||||||||||||||||||||| Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA Length = 6870 Score = 46.1 bits (23), Expect = 0.061 Identities = 23/23 (100%) Strand = Plus / Minus Query: 210 cgggcgggcggggggcaggcggc 232 ||||||||||||||||||||||| Sbjct: 688 cgggcgggcggggggcaggcggc 666
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 11 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 1 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 10 (LOC479191), mRNA Length = 4663 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 9 (LOC479191), mRNA Length = 4438 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 7 (LOC479191), mRNA Length = 4777 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 6 (LOC479191), mRNA Length = 4696 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 3 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.24 Identities = 31/34 (91%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggggggcaggcggcgg 234 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome Length = 3630528 Score = 44.1 bits (22), Expect = 0.24 Identities = 22/22 (100%) Strand = Plus / Plus Query: 244 tagtcggtggtggggagttgct 265 |||||||||||||||||||||| Sbjct: 774000 tagtcggtggtggggagttgct 774021
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence Length = 136354 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 94084 acggacggacgggcgggcggg 94104
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete sequence Length = 160805 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 155955 acggacggacgggcgggcggg 155935
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence Length = 166421 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 7846 acggacggacgggcgggcggg 7826
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence Length = 240151 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 37973 acggacggacgggcgggcggg 37953
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence Length = 148259 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 37509 acggacggacgggcgggcggg 37489 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 198 cacacggacggacgggcgggcggg 221 ||||||||||||||| |||||||| Sbjct: 37516 cacacggacggacggacgggcggg 37493
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA clone MGC:19255 IMAGE:3967218), complete cds Length = 2176 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 23 acggacggacgggcgggcggg 43
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome Length = 9778 Score = 42.1 bits (21), Expect = 0.95 Identities = 24/25 (96%) Strand = Plus / Minus Query: 210 cgggcgggcggggggcaggcggcgg 234 ||||||||| ||||||||||||||| Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta), mRNA Length = 2547 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1 Length = 68478 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 42894 acggacggacgggcgggcggg 42914 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 198 cacacggacggacgggcgggcggg 221 ||||||||||||||| |||||||| Sbjct: 42887 cacacggacggacggacgggcggg 42910
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 27616 acggacggacgggcgggcggg 27596
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920074L06 product:Rab geranylgeranyl transferase, a subunit, full insert sequence Length = 2422 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 41 acggacggacgggcgggcggg 61
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11, complete sequence Length = 126040 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 56775 acggacggacgggcgggcggg 56755
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1), mRNA Length = 1544 Score = 42.1 bits (21), Expect = 0.95 Identities = 24/25 (96%) Strand = Plus / Plus Query: 202 cggacggacgggcgggcggggggca 226 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2466 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2435 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2492 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2338 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2395 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20, complete sequence Length = 80017 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 44968 acggacggacgggcgggcggg 44988
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23, complete sequence Length = 142417 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 45131 acggacggacgggcgggcggg 45151
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence Length = 207280 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 13760 acggacggacgggcgggcggg 13780
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 0.95 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 ggcgggcggggggcaggcggcggtg 236 ||||||||||||||| ||||||||| Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480
>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete sequence Length = 251037 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 108741 acggacggacgggcgggcggg 108721
>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13, complete sequence Length = 121689 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 73151 acggacggacgggcgggcggg 73131
>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA, complete cds Length = 1544 Score = 42.1 bits (21), Expect = 0.95 Identities = 24/25 (96%) Strand = Plus / Plus Query: 202 cggacggacgggcgggcggggggca 226 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds Length = 4536 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcggg 221 ||||||||||||||||||||| Sbjct: 745 acggacggacgggcgggcggg 765
>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete sequence Length = 181893 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 94623 acggacggacgggcgggcgg 94642
>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence Length = 197907 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 cgggcgggcggggggcaggc 229 |||||||||||||||||||| Sbjct: 122681 cgggcgggcggggggcaggc 122700
>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit variant 1-like mRNA, complete sequence Length = 1190 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 210 cgggcgggcggggggcaggcggcg 233 ||||||||||| |||||||||||| Sbjct: 38 cgggcgggcggcgggcaggcggcg 15
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence Length = 124050 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 72221 acggacggacgggcgggcgg 72202
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 40.1 bits (20), Expect = 3.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 242 agtagtcggtggtggggagttgctcgtgggtg 273 ||||||||||||| ||||| || ||||||||| Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtg 736
>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete sequence Length = 153947 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 attcattcattcaaagcaaa 154 |||||||||||||||||||| Sbjct: 143356 attcattcattcaaagcaaa 143337
>gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, complete sequence Length = 154859 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 gatggattcattcattcaaa 149 |||||||||||||||||||| Sbjct: 68036 gatggattcattcattcaaa 68017
>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR Length = 3811 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 cgggcgggcggggggcaggc 229 |||||||||||||||||||| Sbjct: 3619 cgggcgggcggggggcaggc 3600
>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33 Contains 3' end of the DAB1 gene for disabled homolog 1 (Drosophila), a novel gene and the 5' end of a novel gene, complete sequence Length = 60856 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 gatggattcattcattcaaa 149 |||||||||||||||||||| Sbjct: 53885 gatggattcattcattcaaa 53904
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 242 agtagtcggtggtggggagttgctcgtg 269 ||||||||||||| ||||| |||||||| Sbjct: 787 agtagtcggtggttgggagctgctcgtg 760
>gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, promoter and 5' untranslated region Length = 1201 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 883 acggacggacgggcgggcgg 864
>gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, promoter and 5' untranslated region Length = 1197 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 884 acggacggacgggcgggcgg 865
>gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, promoter and 5' untranslated region Length = 1195 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 882 acggacggacgggcgggcgg 863
>emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 in linkage group 17, complete sequence Length = 141987 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 gggatggattcattcattca 147 |||||||||||||||||||| Sbjct: 10001 gggatggattcattcattca 10020
>gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, complete sequence Length = 177355 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 aatgggatggattcattcattcaa 148 |||||||| ||||||||||||||| Sbjct: 47407 aatgggattgattcattcattcaa 47384
>tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (HDC08154) gene, complete cds Length = 1399 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 1381 acggacggacgggcgggcgg 1362
>dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds, strain:OUH643 Length = 5119 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 797 acggacggacgggcgggcgg 778
>dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch synthase I Length = 5190 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch synthase I, complete cds Length = 5190 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, complete sequence Length = 171987 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 aatgggatggattcattcattcaa 148 |||||||| ||||||||||||||| Sbjct: 31404 aatgggattgattcattcattcaa 31381
>gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170900 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 32025 acggacggacgggcgggcgg 32006
>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21, complete sequence Length = 153142 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 66723 acggacggacgggcgggcgg 66704
>emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 in linkage group 7, complete sequence Length = 182186 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 16609 acggacggacgggcgggcgg 16590
>gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplast, complete genome Length = 164921 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 aactgaacttgaaattactc 27 |||||||||||||||||||| Sbjct: 98129 aactgaacttgaaattactc 98148
>gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, complete sequence Length = 180708 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 aatgggatggattcattcattcaa 148 |||||||| ||||||||||||||| Sbjct: 146597 aatgggattgattcattcattcaa 146620
>gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, complete sequence Length = 132353 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 aatgggatggattcattcattcaa 148 |||||||| ||||||||||||||| Sbjct: 74998 aatgggattgattcattcattcaa 74975
>gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, complete sequence Length = 194754 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 aatgggatggattcattcattcaa 148 |||||||| ||||||||||||||| Sbjct: 116188 aatgggattgattcattcattcaa 116211
>dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds Length = 4535 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 400 acggacggacgggcgggcgg 381
>dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound starch synthase I, complete cds, strain:OUH602 Length = 5190 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 822 acggacggacgggcgggcgg 803
>emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus Length = 2311 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 133 acggacggacgggcgggcgg 114
>emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch synthase (EC 2.4.1.11) Length = 5153 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 938 acggacggacgggcgggcgg 919
>emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 in linkage group 20, complete sequence Length = 163231 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 60247 acggacggacgggcgggcgg 60266
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 40.1 bits (20), Expect = 3.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 238 gcttagtagtcggtggtggggagttgctcgtgggtg 273 ||||| || |||||||| ||||| |||||||||||| Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtg 382
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete sequence Length = 304419 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 80644 acggacggacgggcgggcgg 80625
>gb|AC116680.21| Mus musculus chromosome 12, clone RP23-476M16, complete sequence Length = 215303 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 aactcaactgaacttgaaat 22 |||||||||||||||||||| Sbjct: 198046 aactcaactgaacttgaaat 198065
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 161987 acggacggacgggcgggcgg 162006
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete sequence Length = 170964 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 119772 acggacggacgggcgggcgg 119791
>dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cultivar:Shonupana Length = 802 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 384 acggacggacgggcgggcgg 365
>dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cultivar:Senbon hadaka Length = 1011 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 acggacggacgggcgggcgg 220 |||||||||||||||||||| Sbjct: 399 acggacggacgggcgggcgg 380
>emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chromosome 2, complete sequence Length = 100090 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 attcattcattcaaagcaaa 154 |||||||||||||||||||| Sbjct: 53765 attcattcattcaaagcaaa 53784 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,440,207 Number of Sequences: 3902068 Number of extensions: 2440207 Number of successful extensions: 59215 Number of sequences better than 10.0: 102 Number of HSP's better than 10.0 without gapping: 104 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 58959 Number of HSP's gapped (non-prelim): 256 length of query: 286 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 264 effective length of database: 17,147,199,772 effective search space: 4526860739808 effective search space used: 4526860739808 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)