>ref|XM_513139.1| PREDICTED: Pan troglodytes similar to cytochrome P450 4Z1
           (LOC456556), mRNA
          Length = 1809

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   aacggcacatgggtattttt 26
           ||||||||||||||||||||
Sbjct: 375 aacggcacatgggtattttt 356

>gb|U41548.2| Caenorhabditis elegans cosmid M02F4, complete sequence
          Length = 26835

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 20   tatttttattacacggttaa 39
            ||||||||||||||||||||
Sbjct: 7582 tatttttattacacggttaa 7601

>gb|AY696295.1| Homo sapiens cytochrome P450 (CYP4Z2P) mRNA, complete cds,
           alternatively spliced
          Length = 1197

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   aacggcacatgggtattttt 26
           ||||||||||||||||||||
Sbjct: 240 aacggcacatgggtattttt 221

>gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosome 10, complete sequence
          Length = 195132

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 35     gttaagtaggcagcactagtagtggact 62
              ||||||| |||||| |||||||||||||
Sbjct: 112178 gttaagtgggcagcgctagtagtggact 112205

>gb|AY262057.1| Homo sapiens cytochrome P450 (CYP4Z2P) pseudogene mRNA, complete
           sequence
          Length = 1436

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   aacggcacatgggtattttt 26
           ||||||||||||||||||||
Sbjct: 243 aacggcacatgggtattttt 224

>emb|AL731892.6| Human DNA sequence from clone RP11-346M5 on chromosome 1 Contains the
             5' end of a cytochrome P450 4Z1 (CYP4Z1) pseudogene, a
             tubulin alpha pseudogene, the CYP4A11 gene for cytochrome
             P450 family 4 subfamily A polypeptide 11, complete
             sequence
          Length = 123921

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     aacggcacatgggtattttt 26
             ||||||||||||||||||||
Sbjct: 16172 aacggcacatgggtattttt 16191

>dbj|AK097373.1| Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar
           to CYTOCHROME P450 4A1 (EC 1.14.15.3)
          Length = 2608

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   aacggcacatgggtattttt 26
           ||||||||||||||||||||
Sbjct: 281 aacggcacatgggtattttt 262

>ref|NR_002788.1| Homo sapiens cytochrome P450 4Z2 pseudogene (CYP4Z2P) on chromosome
           1
          Length = 2608

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   aacggcacatgggtattttt 26
           ||||||||||||||||||||
Sbjct: 281 aacggcacatgggtattttt 262

>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence
          Length = 207157

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 35     gttaagtaggcagcactagtagtggact 62
              ||||||| |||||| |||||||||||||
Sbjct: 195804 gttaagtgggcagcgctagtagtggact 195777

>gb|AF039039.2| Caenorhabditis elegans cosmid T08B1, complete sequence
          Length = 32472

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 11   gcacatgggtatttttattacac 33
            |||| ||||||||||||||||||
Sbjct: 9254 gcacctgggtatttttattacac 9276

>emb|AL137139.9| Human DNA sequence from clone RP11-134O15 on chromosome 13 Contains the
             3' end of the CLYBL gene for citrate lyase beta like (CLB
             bA134O15.1) and a CpG island, complete sequence
          Length = 174128

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 110   agggataaaacctggtgat 128
             |||||||||||||||||||
Sbjct: 49542 agggataaaacctggtgat 49524

>gb|AC122707.2| Homo sapiens chromosome 5 clone RP11-158J3, complete sequence
          Length = 180483

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 7     aacggcacatgggtatttttatt 29
             ||||||||||||| |||||||||
Sbjct: 32018 aacggcacatgggcatttttatt 31996

>emb|AL807248.7| Mouse DNA sequence from clone RP23-400M20 on chromosome X, complete
             sequence
          Length = 190178

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    catgggtatttttattaca 32
             |||||||||||||||||||
Sbjct: 67838 catgggtatttttattaca 67820


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 883,814
Number of Sequences: 3902068
Number of extensions: 883814
Number of successful extensions: 47935
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47920
Number of HSP's gapped (non-prelim): 15
length of query: 131
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 110
effective length of database: 17,151,101,840
effective search space: 1886621202400
effective search space used: 1886621202400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)