>ref|XM_803427.1| Trypanosoma cruzi strain CL Brener trichohyalin
           (Tc00.1047053509595.70) partial mRNA
          Length = 1854

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 345 atgagttgcagttgcggttg 364
           ||||||||||||||||||||
Sbjct: 425 atgagttgcagttgcggttg 444

>gb|AC107374.3| Homo sapiens chromosome 8, clone CTD-2320L14, complete sequence
          Length = 105335

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    acagactagagagcaagcat 101
             ||||||||||||||||||||
Sbjct: 56901 acagactagagagcaagcat 56920

>dbj|AK158314.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
            library, clone:F930102L22 product:hypothetical protein,
            full insert sequence
          Length = 2209

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 102  gcaggctaagctagctacctaagc 125
            ||||||||||||||||| ||||||
Sbjct: 1889 gcaggctaagctagctatctaagc 1866

>gb|AC134566.5| Mus musculus BAC clone RP24-196G8 from 3, complete sequence
          Length = 147839

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ataatataattcacaattga 55
             ||||||||||||||||||||
Sbjct: 40376 ataatataattcacaattga 40395

>emb|AL627085.13| Mouse DNA sequence from clone RP23-374N19 on chromosome 4, complete
             sequence
          Length = 79097

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 102   gcaggctaagctagctacctaagc 125
             ||||||||||||||||| ||||||
Sbjct: 16089 gcaggctaagctagctatctaagc 16066


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,478,733
Number of Sequences: 3902068
Number of extensions: 2478733
Number of successful extensions: 47227
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47221
Number of HSP's gapped (non-prelim): 6
length of query: 402
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 380
effective length of database: 17,147,199,772
effective search space: 6515935913360
effective search space used: 6515935913360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)