>ref|XM_423299.1| PREDICTED: Gallus gallus similar to hypothetical protein
           DKFZp762K2015 (LOC425546), partial mRNA
          Length = 456

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 21  tctatggcatcgatcttccg 40
           ||||||||||||||||||||
Sbjct: 169 tctatggcatcgatcttccg 150

>gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 208555

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 6     cttctctctactacatctatggca 29
             ||||| ||||||||||||||||||
Sbjct: 44811 cttctgtctactacatctatggca 44788

>dbj|AK054244.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330001L02
           product:similar to FLS485 [Homo sapiens], full insert
           sequence
          Length = 1554

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 6   cttctctctactacatctatggca 29
           ||||| ||||||||||||||||||
Sbjct: 510 cttctgtctactacatctatggca 533

>ref|XM_575636.1| PREDICTED: Rattus norvegicus similar to Fls485 protein (LOC500286),
            mRNA
          Length = 1323

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 6    cttctctctactacatctatggca 29
            ||||| ||||||||||||||||||
Sbjct: 1235 cttctgtctactacatctatggca 1258

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 71      gccggtgtggtggcctggg 89
               |||||||||||||||||||
Sbjct: 3711772 gccggtgtggtggcctggg 3711754

>gb|AC161534.5| Mus musculus chromosome 1, clone RP24-127D13, complete sequence
          Length = 137652

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     ttctctctactacatctat 25
             |||||||||||||||||||
Sbjct: 68996 ttctctctactacatctat 68978

>dbj|AK089728.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830011I17 product:unclassifiable, full
            insert sequence
          Length = 3068

 Score = 38.2 bits (19), Expect = 4.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 7    ttctctctactacatctat 25
            |||||||||||||||||||
Sbjct: 2978 ttctctctactacatctat 2996


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 924,069
Number of Sequences: 3902068
Number of extensions: 924069
Number of successful extensions: 46441
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46411
Number of HSP's gapped (non-prelim): 30
length of query: 96
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 75
effective length of database: 17,151,101,840
effective search space: 1286332638000
effective search space used: 1286332638000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)