ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart29c08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ539160.1|TAE539160 Triticum aestivum sdh2-rps14 gene 321 1e-84
2ref|XM_479819.1| Oryza sativa (japonica cultivar-group), mRNA 268 2e-68
3ref|XM_507565.1| PREDICTED Oryza sativa (japonica cultivar-group... 268 2e-68
4ref|XM_507564.1| PREDICTED Oryza sativa (japonica cultivar-group... 268 2e-68
5ref|XM_507563.1| PREDICTED Oryza sativa (japonica cultivar-group... 268 2e-68
6dbj|D10414.1|RICK7 Oryza sativa mRNA for succinate dehydrogenase... 268 2e-68
7dbj|AK104421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
8dbj|AK104304.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
9dbj|AK104303.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
10dbj|AB017428.1| Oryza sativa (japonica cultivar-group) mRNA for ... 268 2e-68
11ref|XM_507102.2| PREDICTED Oryza sativa (japonica cultivar-group... 264 2e-67
12dbj|AK059815.1| Oryza sativa (japonica cultivar-group) cDNA clon... 264 2e-67
13dbj|AK099077.1| Oryza sativa (japonica cultivar-group) cDNA clon... 260 4e-66
14gb|AF457978.1| Zea mays clone cen3n.pk0018.h7, mRNA sequence 222 8e-55
15emb|AJ012374.1|ZMA012374 Zea mays nuclear sdh2-rps14 gene 212 8e-52
16dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 210 3e-51
17dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic D... 210 3e-51
18dbj|AB017429.1| Oryza sativa (japonica cultivar-group) rps14 and... 210 3e-51
19ref|NM_001040483.1| Bos taurus succinate dehydrogenase complex, ... 84 5e-13
20gb|BC102067.1| Bos taurus succinate dehydrogenase complex, subun... 84 5e-13
21gb|DQ213695.1| Taeniopygia guttata clone 0058P0019H12 succinate ... 78 3e-11
22emb|CR942628.2| Xenopus tropicalis finished cDNA, clone TNeu087p20 78 3e-11
23gb|U31902.1|PDU31902 Paracoccus denitrificans succinate dehydrog... 76 1e-10
24gb|BC106300.1| Xenopus laevis succinate dehydrogenase complex, s... 70 7e-09
25gb|BC043859.1| Xenopus laevis succinate dehydrogenase complex, s... 70 7e-09
26gb|AE012320.1| Xanthomonas campestris pv. campestris str. ATCC 3... 68 3e-08
27gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 68 3e-08
28dbj|AP006723.2| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
29ref|XM_479820.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
30ref|XM_507103.1| PREDICTED Oryza sativa (japonica cultivar-group... 66 1e-07
31gb|BC051934.1| Mus musculus succinate dehydrogenase complex, sub... 66 1e-07
32ref|NM_023374.3| Mus musculus succinate dehydrogenase complex, s... 66 1e-07
33dbj|AK153045.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 66 1e-07
34dbj|AK169839.1| Mus musculus 2 days neonate thymus thymic cells ... 66 1e-07
35dbj|AK169252.1| Mus musculus 17 days pregnant adult female amnio... 66 1e-07
36dbj|AK009660.1| Mus musculus adult male tongue cDNA, RIKEN full-... 66 1e-07
37dbj|AK003052.1| Mus musculus adult male brain cDNA, RIKEN full-l... 66 1e-07
38dbj|AK190493.1| Mus musculus cDNA, clone:Y1G0102O16, strand:minu... 66 1e-07
39dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 66 1e-07
40dbj|AK102607.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
41dbj|AK059789.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
42dbj|AB017427.1| Oryza sativa (japonica cultivar-group) mRNA for ... 66 1e-07
43ref|XM_845169.1| PREDICTED: Canis familiaris similar to Succinat... 64 4e-07
44ref|XM_535392.2| PREDICTED: Canis familiaris similar to Succinat... 64 4e-07
45gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 60 7e-06
46gb|AY550052.1| Sus scrofa succinate dehydrogenase iron-protein s... 60 7e-06
47emb|BX014230.1|CNS08J56 Single read from an extremity of a full-... 60 7e-06
48dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 60 7e-06
49ref|XM_308512.2| Anopheles gambiae str. PEST ENSANGP00000024398 ... 60 7e-06
50emb|AL645625.15| Mouse DNA sequence from clone RP23-183L1 on chr... 60 7e-06
51gb|BT017381.1| Zea mays clone EL01N0326E03.c mRNA sequence 58 3e-05
52gb|AY682984.1| Xanthomonas citri succinate dehydrogenase subunit... 58 3e-05
53gb|BC013509.1| Mus musculus succinate dehydrogenase complex, sub... 58 3e-05
54ref|XM_914820.2| PREDICTED: Mus musculus similar to succinate de... 58 3e-05
55emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 58 3e-05
56gb|BC018580.1| Mus musculus succinate dehydrogenase complex, sub... 58 3e-05
57gb|AE011843.1| Xanthomonas axonopodis pv. citri str. 306, secti... 58 3e-05
58gb|CP000264.1| Jannaschia sp. CCS1, complete genome 58 3e-05
59dbj|AK003533.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 58 3e-05
60ref|XM_216558.2| PREDICTED: Rattus norvegicus succinate dehydrog... 58 3e-05
61dbj|AK181550.1| Mus musculus cDNA, clone:Y0G0118I23, strand:plus... 58 3e-05
62gb|AY661544.1| Xanthomonas oryzae pv. oryzae succinate dehydroge... 56 1e-04
63ref|XM_859608.1| PREDICTED: Canis familiaris similar to Succinat... 56 1e-04
64ref|XM_845487.1| PREDICTED: Canis familiaris similar to Succinat... 56 1e-04
65gb|CP000316.1| Polaromonas sp. JS666, complete genome 56 1e-04
66dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 56 1e-04
67ref|XM_685549.1| PREDICTED: Danio rerio similar to Sdhb-prov pro... 56 1e-04
68gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 56 1e-04
69gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 56 1e-04
70gb|AY118923.1| Drosophila melanogaster LD23740 full insert cDNA 52 0.002
71ref|NM_057753.3| Drosophila melanogaster Succinate dehydrogenase... 52 0.002
72gb|AC008340.5| Drosophila melanogaster, chromosome 2R, region 42... 52 0.002
73gb|AC007549.5|AC007549 Drosophila melanogaster, chromosome 2R, r... 52 0.002
74gb|AE003790.2| Drosophila melanogaster chromosome 2R, section 7 ... 52 0.002
75gb|L27705.1|DROSDHB Drosophila melanogaster succinate dehydrogen... 52 0.002
76ref|XM_513112.1| PREDICTED: Pan troglodytes succinate dehydrogen... 50 0.007
77gb|BC007840.2| Homo sapiens succinate dehydrogenase complex, sub... 50 0.007
78emb|CR733346.2|CNS0GSNQ Tetraodon nigroviridis full-length cDNA 50 0.007
79emb|CR705776.2|CNS0G7J0 Tetraodon nigroviridis full-length cDNA 50 0.007
80emb|CR704266.2|CNS0G6D2 Tetraodon nigroviridis full-length cDNA 50 0.007
81emb|CR689174.2|CNS0FUPU Tetraodon nigroviridis full-length cDNA 50 0.007
82emb|CR687900.2|CNS0FTQG Tetraodon nigroviridis full-length cDNA 50 0.007
83emb|CR661751.2|CNS0F9KT Tetraodon nigroviridis full-length cDNA 50 0.007
84emb|CR658529.1|CNS0F73B Tetraodon nigroviridis full-length cDNA 50 0.007
85emb|CR650202.1|CNS0F0O0 Tetraodon nigroviridis full-length cDNA 50 0.007
86emb|AL049569.13|HSDJ37C10 Human DNA sequence from clone RP1-37C1... 50 0.007
87emb|AL163191.2|SPAC140 S.pombe chromosome I cosmid c140 50 0.007
88gb|AE006011.1| Caulobacter crescentus CB15 section 337 of 359 of... 50 0.007
89ref|NM_003000.1| Homo sapiens succinate dehydrogenase complex, s... 50 0.007
90emb|CR610874.1| full-length cDNA clone CS0DI041YC11 of Placenta ... 50 0.007
91emb|CR606201.1| full-length cDNA clone CS0DI064YA14 of Placenta ... 50 0.007
92emb|CR596760.1| full-length cDNA clone CS0DI052YP22 of Placenta ... 50 0.007
93emb|CR596635.1| full-length cDNA clone CS0DK004YD20 of HeLa cell... 50 0.007
94emb|CR595888.1| full-length cDNA clone CS0DI035YE01 of Placenta ... 50 0.007
95emb|CR593493.1| full-length cDNA clone CS0DL011YN10 of B cells (... 50 0.007
96ref|NM_001018964.1| Schizosaccharomyces pombe 972h- hypothetical... 50 0.007
97dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 50 0.007
98gb|AF007569.1|AF007569 Bradyrhizobium japonicum GstR (gstR) gene... 50 0.007
99gb|U17248.1|HSU17248 Human succinate dehydrogenase iron-protein ... 50 0.007
100gb|U17885.1|HSSDHBS7 Human succinate dehydrogenase iron-protein ... 50 0.007
101gb|M32246.1|HUMCOMIIP Human succinate-ubiquinone oxidoreductase ... 50 0.007
102dbj|D10245.1|HUMSDHBMT Homo sapiens mRNA for mitochondrial succi... 50 0.007
103dbj|AB066516.1| Macaca fascicularis brain cDNA clone:QmoA-10618,... 48 0.026
104gb|DQ145263.1| Drosophila miranda neo-Y SdhB gene, partial sequence 46 0.10
105gb|DQ145262.1| Drosophila miranda neo-X SdhB gene, partial sequence 46 0.10
106gb|DQ066192.1| Ixodes scapularis isolate ISUFL97 succinate dehyd... 46 0.10
107gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 46 0.10
108gb|AC108013.5| Homo sapiens BAC clone RP13-538M20 from 4, comple... 44 0.41
109emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 44 0.41
110gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 1.6
111ref|XM_654844.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.6
112emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete ch... 42 1.6
113gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome... 42 1.6
114emb|CR701692.1|CNS0G4DK Tetraodon nigroviridis full-length cDNA 42 1.6
115emb|CR699236.1|CNS0G2HC Tetraodon nigroviridis full-length cDNA 42 1.6
116emb|CR695417.2|CNS0FZJ9 Tetraodon nigroviridis full-length cDNA 42 1.6
117emb|CR688415.2|CNS0FU4R Tetraodon nigroviridis full-length cDNA 42 1.6
118emb|CR681198.2|CNS0FOKA Tetraodon nigroviridis full-length cDNA 42 1.6
119emb|CR676594.2|CNS0FL0U Tetraodon nigroviridis full-length cDNA 42 1.6
120emb|CR665870.1|CNS0FCR8 Tetraodon nigroviridis full-length cDNA 42 1.6
121emb|CR659456.2|CNS0F7T2 Tetraodon nigroviridis full-length cDNA 42 1.6
122emb|BX664727.7| Human DNA sequence from clone RP11-146D12 on chr... 42 1.6
123emb|AL928636.8| Human DNA sequence from clone RP13-417F5 on chro... 42 1.6
124emb|AL589765.19| Human DNA sequence from clone RP11-98D18 on chr... 42 1.6
125emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on ch... 42 1.6
126emb|AL513187.6| Human DNA sequence from clone RP11-436H6 on chro... 42 1.6
127emb|AL359878.13| Human DNA sequence from clone RP11-363N22 on ch... 42 1.6
128emb|AL358174.12| Human DNA sequence from clone RP11-387H19 on ch... 42 1.6
129gb|AC079271.4| Homo sapiens chromosome 10 clone RP11-455I1, comp... 42 1.6
130emb|AL162723.12| Human DNA sequence from clone RP13-428K23 on ch... 42 1.6
131emb|AL158824.11| Human DNA sequence from clone RP11-165N19 on ch... 42 1.6
132emb|AL133321.11| Human DNA sequence from clone RP13-17E1 on chro... 42 1.6
133emb|AL078623.28|HSJ1069C8 Human DNA sequence from clone RP5-1069... 42 1.6
134emb|AL023655.1|HS242N11 Human DNA sequence from clone RP1-242N11... 42 1.6
135emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.6
136emb|BX640433.1| Bordetella parapertussis strain 12822, complete ... 42 1.6
137emb|BX640418.1| Bordetella pertussis strain Tohama I, complete g... 42 1.6
138gb|AC159305.3| Mus musculus BAC clone RP23-205D10 from chromosom... 42 1.6
139emb|CR937102.1| Single read from an extremity of a cDNA clone ma... 42 1.6
140emb|AL832798.1|HSM804109 Homo sapiens genomic DNA; cDNA DKFZp667... 42 1.6
141gb|AC022536.13| Homo sapiens chromosome 10 clone RP11-38M7, comp... 42 1.6
142gb|AC090605.7| Homo sapiens chromosome 15, clone RP11-261P5, com... 42 1.6
143gb|AC008492.3| Homo sapiens chromosome 5 clone CTC-427F23, compl... 42 1.6
144gb|AC104445.2| Homo sapiens chromosome 3 clone RP11-444P10, comp... 42 1.6
145gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, comp... 42 1.6
146gb|AC100800.2| Homo sapiens chromosome 8, clone RP11-161I2, comp... 42 1.6
147gb|AF320597.1|AF320597 Mus musculus C lectin-related protein E p... 42 1.6
148gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ... 42 1.6
149gb|AC008621.8| Homo sapiens chromosome 5 clone CTB-147K10, compl... 42 1.6
150emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase... 42 1.6
151gb|AC124915.5| Homo sapiens chromosome 3 clone RP11-717N7, compl... 42 1.6
152gb|AC008486.6|AC008486 Homo sapiens chromosome 5 clone CTC-421B9... 42 1.6
153gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, co... 42 1.6
154gb|AC068660.3|AC068660 Homo sapiens chromosome 5 clone CTC-349J2... 42 1.6
155gb|AC096734.3| Homo sapiens BAC clone RP11-109E24 from 4, comple... 42 1.6
156gb|AC108037.3| Homo sapiens BAC clone RP11-168E17 from 4, comple... 42 1.6
157gb|AC068276.7| Homo sapiens BAC clone RP11-127H13 from 2, comple... 42 1.6
158gb|AC012077.4|AC012077 Homo sapiens BAC clone RP11-524G14 from Y... 42 1.6
159gb|AC074213.7| Homo sapiens BAC clone RP11-34K3 from 2, complete... 42 1.6
160gb|AC062016.5| Homo sapiens BAC clone RP11-59P4 from 2, complete... 42 1.6
161gb|AC079465.5| Homo sapiens chromosome 5 clone CTD-2124P24, comp... 42 1.6
162gb|AC133134.2| Homo sapiens chromosome 5 clone RP11-120B7, compl... 42 1.6
163emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 m... 42 1.6
164emb|AL160314.7|CNS01RH3 Human chromosome 14 DNA sequence BAC C-2... 42 1.6
165gb|AC174446.2| Mus musculus BAC clone RP23-356N23 from chromosom... 42 1.6
166gb|AC153486.6| Mus musculus 6 BAC RP23-27E5 (Roswell Park Cancer... 42 1.6
167gb|AC004072.1|AC004072 Human Chromosome X clone bWXD342, complet... 42 1.6
168ref|NM_113653.2| Arabidopsis thaliana SDH2-1 AT3G27380 (SDH2-1) ... 40 6.4
169ref|NM_123430.1| Arabidopsis thaliana SDH2-2 AT5G40650 (SDH2-2) ... 40 6.4
170ref|XM_480600.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.4
171ref|NM_213191.1| Danio rerio zgc:77067 (zgc:77067), mRNA 40 6.4
172gb|AY735609.1| Arabidopsis thaliana chromosome 3 hypothetical pr... 40 6.4
173gb|AY735608.1| Arabidopsis thaliana chromosome 3 hypothetical pr... 40 6.4
174gb|AC115301.7| Mus musculus BAC clone RP24-83E2 from chromosome ... 40 6.4
175gb|AC147092.3| Pan troglodytes BAC clone RP43-55E11 from 7, comp... 40 6.4
176gb|AC112143.5| Mus musculus BAC clone RP23-29E2 from chromosome ... 40 6.4
177ref|XM_752668.1| Ustilago maydis 521 hypothetical protein (UM016... 40 6.4
178gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome ... 40 6.4
179gb|AC092989.6| Homo sapiens 3 BAC RP11-237P21 (Roswell Park Canc... 40 6.4
180gb|AC006000.3| Homo sapiens PAC clone RP4-741M6 from 7, complete... 40 6.4
181ref|XM_662081.1| Cryptosporidium hominis TU502 WD repeat protein... 40 6.4
182gb|AE014075.1| Escherichia coli CFT073, complete genome 40 6.4
183emb|CR383667.11| Zebrafish DNA sequence from clone CH211-229P19 ... 40 6.4
184gb|AC138015.24| Medicago truncatula clone mth2-34m6, complete se... 40 6.4
185gb|AC090618.11| Homo sapiens chromosome 17, clone RP11-763E3, co... 40 6.4
186emb|AL929302.16| Human DNA sequence from clone RP11-716A19 on ch... 40 6.4
187emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chr... 40 6.4
188gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.4
189gb|BT010276.1| Drosophila melanogaster RE08772 full insert cDNA 40 6.4
190emb|AL356603.11| Human DNA sequence from clone RP11-500B2 on chr... 40 6.4
191emb|AL353790.15| Human DNA sequence from clone RP11-337N19 on ch... 40 6.4
192emb|AL353707.14| Human DNA sequence from clone RP11-553J6 on chr... 40 6.4
193emb|AL158194.16| Human DNA sequence from clone RP11-429E17 on ch... 40 6.4
194emb|AL158070.11| Human DNA sequence from clone RP11-235C23 on ch... 40 6.4
195gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, c... 40 6.4
196emb|AL139233.8| Human DNA sequence from clone RP1-44A19 on chrom... 40 6.4
197emb|AL121968.10|HSJ196B13 Human DNA sequence from clone RP1-196B... 40 6.4
198emb|AL121942.9|HSDJ249N8 Human DNA sequence from clone RP1-249N8... 40 6.4
199emb|AL050403.16|HSDJ697P8 Human DNA sequence from clone RP4-697P... 40 6.4
200gb|AY123036.1| Arabidopsis thaliana putative succinate dehydroge... 40 6.4
201gb|AY074299.1| Arabidopsis thaliana putative succinate dehydroge... 40 6.4
202gb|AY063053.1| Arabidopsis thaliana putative succinate dehydroge... 40 6.4
203gb|AY035013.1| Arabidopsis thaliana putative succinate dehydroge... 40 6.4
204emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genom... 40 6.4
205emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 40 6.4
206gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosom... 40 6.4
207emb|AJ278911.1|ATH278911 Arabidopsis thaliana mRNA for mitochond... 40 6.4
208emb|AJ278910.1|ATH278910 Arabidopsis thaliana mRNA for mitochond... 40 6.4
209gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Ca... 40 6.4
210gb|BC065992.1| Danio rerio zgc:77067, mRNA (cDNA clone MGC:77067... 40 6.4
211gb|AC021311.8| Homo sapiens chromosome 8, clone RP11-697L23, com... 40 6.4
212gb|AC007110.3| Homo sapiens chromosome 6, clone hRPK.472_J_18, c... 40 6.4
213gb|AC055782.9| Homo sapiens chromosome 15, clone RP11-528P19, co... 40 6.4
214gb|AC103592.2| Homo sapiens chromosome 1 clone RP11-335E14, comp... 40 6.4
215gb|AC024375.13| Homo sapiens chromosome 15, clone RP11-572A8, co... 40 6.4
216gb|AC100812.2| Homo sapiens chromosome 8, clone CTD-2532N20, com... 40 6.4
217gb|AC022420.6| Homo sapiens chromosome 5 clone CTD-2040G12, comp... 40 6.4
218gb|AC143337.27| Medicago truncatula clone mth2-35d19, complete s... 40 6.4
219gb|AC015922.17| Homo sapiens chromosome 17, clone CTD-3157E16, c... 40 6.4
220gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can... 40 6.4
221gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, compl... 40 6.4
222ref|NM_138055.1| Drosophila melanogaster CG30419-RA (CG30419), mRNA 40 6.4
223gb|AC069540.6| Homo sapiens chromosome 10 clone RP11-344L13, com... 40 6.4
224gb|AC182474.3| Pan troglodytes BAC clone CH251-134M22 from chrom... 40 6.4
225gb|AC007538.5| Homo sapiens Xq28 PAC RPCI6-224C24 (Roswell Park ... 40 6.4
226gb|AC097654.2| Homo sapiens BAC clone RP11-280K20 from 4, comple... 40 6.4
227gb|DQ123841.1| Agrotis segetum nucleopolyhedrovirus, complete ge... 40 6.4
228ref|XM_939290.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 6.4
229ref|XM_928326.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 6.4
230ref|XM_685575.1| PREDICTED: Danio rerio similar to nudC domain c... 40 6.4
231gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 40 6.4
232gb|AC034242.6| Homo sapiens chromosome 5 clone CTD-2514M18, comp... 40 6.4
233ref|XM_626488.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 6.4
234gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.4
235gb|AC009460.4|AC009460 Drosophila melanogaster, chromosome 2R, r... 40 6.4
236gb|AC012167.5|AC012167 Drosophila melanogaster, chromosome 2R, r... 40 6.4
237emb|BX005394.8| Zebrafish DNA sequence from clone DKEY-3N15 in l... 40 6.4
238emb|BX822750.1|CNS0A7S4 Arabidopsis thaliana Full-length cDNA Co... 40 6.4
239gb|AC013722.8| Homo sapiens BAC clone RP11-299H21 from 2, comple... 40 6.4
240gb|AC013429.12|AC013429 Homo sapiens chromosome 7 clone RP11-199... 40 6.4
241gb|AC083863.2|AC083863 Homo sapiens chromosome 7 clone RP11-162O... 40 6.4
242gb|AC008265.15|AC008265 Homo sapiens chromosome 7 clone RP11-256... 40 6.4
243gb|AC019178.7| Homo sapiens BAC clone RP11-235L22 from 2, comple... 40 6.4
244gb|AY087504.1| Arabidopsis thaliana clone 36094 mRNA, complete s... 40 6.4
245gb|AY086901.1| Arabidopsis thaliana clone 2924 mRNA, complete se... 40 6.4
246gb|AC135628.8| Homo sapiens chromosome 15, clone RP11-883G10, co... 40 6.4
247gb|AC104777.7| Homo sapiens BAC clone RP11-22J23 from 2, complet... 40 6.4
248gb|AC074338.1|AC074338 Human Chromosome 7 clone RP11-81O10, comp... 40 6.4
249dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 40 6.4
250dbj|BS000052.1| Pan troglodytes chromosome 22 clone:RP43-049N07,... 40 6.4
251dbj|AB024028.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 6.4
252dbj|AP004565.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
253dbj|AK119306.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.4
254gb|AY924777.1| Arabidopsis thaliana hypothetical protein (At3g27... 40 6.4
255emb|AL354046.5|HS121M24 Homo sapiens chromosome 17 from PAC RPC... 40 6.4
256emb|AM261284.1| Escherichia coli hemolysin operon, serotype O83:... 40 6.4
257emb|AL139418.9| Human DNA sequence from clone RP4-608O15 on chro... 40 6.4
258emb|AL132778.6|CNS01DTJ Human chromosome 14 DNA sequence BAC C-2... 40 6.4
259gb|AC006251.3|AC006251 Homo sapiens chromosome 17, clone hRPK.69... 40 6.4
260gb|AE003463.2| Drosophila melanogaster chromosome 2R, section 70... 40 6.4
261dbj|AP001676.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.4
262dbj|AP001264.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.4
263dbj|AP001124.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.4
264dbj|AP000826.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.4
265gb|AC140844.3| Mus musculus BAC clone RP24-361P18 from 13, compl... 40 6.4
266emb|AL772242.7| Mouse DNA sequence from clone RP23-15E4 on chrom... 40 6.4
267gb|M10133.1|ECOHLY E.coli (J96) hlyC, hlyA, hlyB and hlyD genes ... 40 6.4
268dbj|AP000403.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 6.4
269dbj|AB038490.1| Homo sapiens gene for fukutin, complete cds 40 6.4
270emb|AL450486.1| Human DNA sequence from clone RP5-1056D13 on chr... 40 6.4

>emb|AJ539160.1|TAE539160 Triticum aestivum sdh2-rps14 gene
          Length = 3666

 Score =  321 bits (162), Expect = 1e-84
 Identities = 174/178 (97%)
 Strand = Plus / Minus

                                                                        
Query: 243  cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
            ||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||
Sbjct: 3278 cactcaggctccgagctgcagcttctttattgtgtcgatctgcttcgccgggttcagtcc 3219

                                                                        
Query: 303  cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3218 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 3159

                                                                      
Query: 363  gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctg 420
            |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3158 gttgatggagtcgaggcgctcctttgtgaactcatcacggctgtcttggatccacctg 3101



 Score =  107 bits (54), Expect = 3e-20
 Identities = 103/120 (85%), Gaps = 7/120 (5%)
 Strand = Plus / Minus

                                                                        
Query: 14   aagtttatgaattacttcatgcatgagcatcaaaatatgat-------gaaccaccaaac 66
            |||||||||||||| || |||||||  |||||||| |||||       ||||||||||||
Sbjct: 3509 aagtttatgaattaattgatgcatggacatcaaaagatgatcaacggagaaccaccaaac 3450

                                                                        
Query: 67   tagatacagcacggaaagaacaaaatctggtagcaattattcactccctacacggaatcg 126
            ||||||||||||| |||||| |||||||||||||||||||||||   |||||||||||||
Sbjct: 3449 tagatacagcacgaaaagaataaaatctggtagcaattattcacgaactacacggaatcg 3390



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 56/58 (96%)
 Strand = Plus / Minus

                                                                      
Query: 416  acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
            |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1155 acctgttggcatggagcagcgcggcggggccgagatactcctctgggttccaccagta 1098



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 57/62 (91%), Gaps = 1/62 (1%)
 Strand = Plus / Minus

                                                                        
Query: 162  accatggagcaaaaacaaaccaaatggcaggctgattacaactttccgacatctccacgg 221
            |||| ||||| ||||||||||||||| |||||||||||||| ||||| ||||||||||||
Sbjct: 3349 accacggagccaaaacaaaccaaatgccaggctgattacaattttcc-acatctccacgg 3291

              
Query: 222  gg 223
            ||
Sbjct: 3290 gg 3289



to top

>ref|XM_479819.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1154

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 916 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 857

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 797

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 796 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 737

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 686



to top

>ref|XM_507565.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1005_B05.29-1
           mRNA
          Length = 1218

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 915 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 856

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 855 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 796

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 795 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 736

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 735 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 685



to top

>ref|XM_507564.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1005_B05.29-1
           mRNA
          Length = 1219

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 916 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 857

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 797

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 796 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 737

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 686



to top

>ref|XM_507563.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1005_B05.29-1
           mRNA
          Length = 1208

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 916 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 857

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 797

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 796 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 737

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 686



to top

>dbj|D10414.1|RICK7 Oryza sativa mRNA for succinate dehydrogenase (K7 gene), partial
           sequence
          Length = 814

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 484 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 425

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 424 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 365

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 364 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 305

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 304 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 254



to top

>dbj|AK104421.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C04, full
           insert sequence
          Length = 1154

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 916 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 857

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 797

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 796 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 737

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 686



to top

>dbj|AK104304.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-D05, full
           insert sequence
          Length = 1208

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 916 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 857

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 797

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 796 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 737

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 686



to top

>dbj|AK104303.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-F04, full
           insert sequence
          Length = 1218

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 915 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 856

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 855 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 796

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 795 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 736

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 735 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 685



to top

>dbj|AB017428.1| Oryza sativa (japonica cultivar-group) mRNA for succinate
           dehydrogenase iron-protein subunit (SDHB), complete cds
          Length = 1113

 Score =  268 bits (135), Expect = 2e-68
 Identities = 207/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 904 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 845

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 844 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 785

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 784 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 725

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 724 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 674



to top

>ref|XM_507102.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1005_B05.29-1
           mRNA
          Length = 1163

 Score =  264 bits (133), Expect = 2e-67
 Identities = 205/229 (89%)
 Strand = Plus / Minus

                                                                       
Query: 245 ctcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagcccct 304
           |||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||||
Sbjct: 916 ctcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggccct 857

                                                                       
Query: 305 tggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtcgt 364
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 tggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtcgt 797

                                                                       
Query: 365 tgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgttgg 424
           ||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||||
Sbjct: 796 tgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgttgg 737

                                                            
Query: 425 catggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           | ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 cgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 688



to top

>dbj|AK059815.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-B11, full
           insert sequence
          Length = 1163

 Score =  264 bits (133), Expect = 2e-67
 Identities = 205/229 (89%)
 Strand = Plus / Minus

                                                                       
Query: 245 ctcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagcccct 304
           |||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||||
Sbjct: 916 ctcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggccct 857

                                                                       
Query: 305 tggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtcgt 364
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 856 tggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtcgt 797

                                                                       
Query: 365 tgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgttgg 424
           ||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||||
Sbjct: 796 tgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgttgg 737

                                                            
Query: 425 catggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           | ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 736 cgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 688



to top

>dbj|AK099077.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170D08, full
           insert sequence
          Length = 1218

 Score =  260 bits (131), Expect = 4e-66
 Identities = 206/231 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
           |||||||||  ||||||| |||||||| ||||||||||| |||||  | ||||| || ||
Sbjct: 915 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttccctgggttgaggcc 856

                                                                       
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 855 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 796

                                                                       
Query: 363 gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctgtt 422
           ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||||
Sbjct: 795 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctgtt 736

                                                              
Query: 423 ggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 735 ggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 685



to top

>gb|AF457978.1| Zea mays clone cen3n.pk0018.h7, mRNA sequence
          Length = 463

 Score =  222 bits (112), Expect = 8e-55
 Identities = 161/176 (91%), Gaps = 1/176 (0%)
 Strand = Plus / Minus

                                                                       
Query: 299 gccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaact 358
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 452 gccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaact 393

                                                                       
Query: 359 cgtcgttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacc 418
           |||||||||||| ||| ||||||||||| |||||||  ||||||||||| || |||||||
Sbjct: 392 cgtcgttgatggcgtccaggcgctccttggtgaactggtcacggctgtcctgtatccacc 333

                                                                   
Query: 419 tgttggcatgg-agcagcgctgcggggccgagatactcttctgggttccaccagta 473
           | ||||| ||| |||||||| || |||||||| ||||| || ||||||||||||||
Sbjct: 332 tattggcgtggaagcagcgcggctgggccgaggtactcctcggggttccaccagta 277



to top

>emb|AJ012374.1|ZMA012374 Zea mays nuclear sdh2-rps14 gene
          Length = 3480

 Score =  212 bits (107), Expect = 8e-52
 Identities = 146/159 (91%)
 Strand = Plus / Minus

                                                                        
Query: 262  agcttctttattgtgtcgatctgctttgcagggttcagccccttggggcaggcatgcgtg 321
            |||||||| || ||||||||||||||||| |||||||| || ||||||||||| ||||||
Sbjct: 3038 agcttcttgatcgtgtcgatctgctttgccgggttcaggcctttggggcaggcgtgcgtg 2979

                                                                        
Query: 322  cagttcttgatggtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgc 381
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||
Sbjct: 2978 cagttcttgatggtgtggcagcggtacagcttgaactcgtcgttgatggcgtccaggcgc 2919

                                                   
Query: 382  tcctttgtgaactcatcacggctgtcttggatccacctg 420
            ||||| |||||||  ||||||||||| || |||||||||
Sbjct: 2918 tccttggtgaactggtcacggctgtcctgtatccacctg 2880



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 416 acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           |||||||||| ||||||||||| || |||||||| ||||| || ||||||||||||||
Sbjct: 857 acctgttggcgtggagcagcgcggccgggccgaggtactcctccgggttccaccagta 800



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  210 bits (106), Expect = 3e-51
 Identities = 160/178 (89%)
 Strand = Plus / Plus

                                                                           
Query: 243     cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
               |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 1085170 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 1085229

                                                                           
Query: 303     cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
               |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1085230 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 1085289

                                                                         
Query: 363     gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctg 420
               ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||
Sbjct: 1085290 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctg 1085347



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                         
Query: 416     acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
               |||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 1087601 acctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 1087658



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 414     ccacctgttggcatggagca 433
               ||||||||||||||||||||
Sbjct: 6124628 ccacctgttggcatggagca 6124647



to top

>dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1005_B05
          Length = 144799

 Score =  210 bits (106), Expect = 3e-51
 Identities = 160/178 (89%)
 Strand = Plus / Plus

                                                                          
Query: 243    cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
              |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 113697 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 113756

                                                                          
Query: 303    cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
              |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113757 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 113816

                                                                        
Query: 363    gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctg 420
              ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||
Sbjct: 113817 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctg 113874



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                        
Query: 416    acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
              |||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 116128 acctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 116185



to top

>dbj|AB017429.1| Oryza sativa (japonica cultivar-group) rps14 and sdhB genes for
            mitochondrial ribosomal portein S14 and succinate
            dehydrogenase iron-protein subunit, complete cds
          Length = 3700

 Score =  210 bits (106), Expect = 3e-51
 Identities = 160/178 (89%)
 Strand = Plus / Minus

                                                                        
Query: 243  cactcaggctccgagctgcagcttctttattgtgtcgatctgctttgcagggttcagccc 302
            |||||||||  ||||||| |||||||| ||||||||||| ||||| || ||||| || ||
Sbjct: 3309 cactcaggcctcgagctggagcttcttgattgtgtcgatgtgcttcgctgggttgaggcc 3250

                                                                        
Query: 303  cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 362
            |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3249 cttggggcaggcgtgtgtgcagttcttgatggtgtggcagcggtacagcttgaactcgtc 3190

                                                                      
Query: 363  gttgatggagtcaaggcgctcctttgtgaactcatcacggctgtcttggatccacctg 420
            ||||||||| || ||||||||||| |||||||  ||||||||||| || |||||||||
Sbjct: 3189 gttgatggaatccaggcgctccttagtgaactggtcacggctgtcctgtatccacctg 3132



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 416 acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           |||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 878 acctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 821



to top

>ref|NM_001040483.1| Bos taurus succinate dehydrogenase complex, subunit B, iron sulfur
           (Ip) (SDHB), mRNA
          Length = 1039

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                     
Query: 290 cagggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           |||| |||||||||||||||||||  |||||||||||| |||||||||||||||||||
Sbjct: 798 caggattcagccccttggggcaggtctgcgtgcagttcatgatggtgtggcagcggta 741



to top

>gb|BC102067.1| Bos taurus succinate dehydrogenase complex, subunit B, iron sulfur
           (Ip), mRNA (cDNA clone MGC:127046 IMAGE:7942444),
           complete cds
          Length = 1039

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                     
Query: 290 cagggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           |||| |||||||||||||||||||  |||||||||||| |||||||||||||||||||
Sbjct: 798 caggattcagccccttggggcaggtctgcgtgcagttcatgatggtgtggcagcggta 741



to top

>gb|DQ213695.1| Taeniopygia guttata clone 0058P0019H12 succinate dehydrogenase Ip
           subunit-like mRNA, complete sequence
          Length = 1001

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           ||||||||||||||||||||||   | ||||||||| ||||||||||||||||||||||
Sbjct: 784 gggttcagccccttggggcaggtgcgggtgcagttcatgatggtgtggcagcggtacag 726



to top

>emb|CR942628.2| Xenopus tropicalis finished cDNA, clone TNeu087p20
          Length = 1080

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||||||||||||||| |   ||||||||||| ||||||||||||||||||||||
Sbjct: 801 gggttcagccccttggggcatgtgcgcgtgcagttcatgatggtgtggcagcggtacag 743



to top

>gb|U31902.1|PDU31902 Paracoccus denitrificans succinate dehydrogenase b-type cytochrome
            subunit (sdhC), succinate dehydrogenase hydrophobic
            membrane anchor (sdhD), succinate dehydrogenase
            flavoprotein subunit (sdhA), and succinate dehydrogenase
            iron-sulfur protein subunit (sdhB) genes, complete cds
          Length = 6380

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 292  gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
            ||||||||||||||||||||||  |  ||||||||| |||| ||||||||||| ||||||
Sbjct: 5940 gggttcagccccttggggcaggtgttggtgcagttcatgatcgtgtggcagcgatacagc 5881

                  
Query: 352  ttgaac 357
            ||||||
Sbjct: 5880 ttgaac 5875



to top

>gb|BC106300.1| Xenopus laevis succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone MGC:130803 IMAGE:7767032),
           complete cds
          Length = 1070

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||| |||||||||||||   | ||||||||| ||||||||||||||||||||||
Sbjct: 813 gggttcaggcccttggggcaggtgcgggtgcagttcatgatggtgtggcagcggtacag 755



to top

>gb|BC043859.1| Xenopus laevis succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone MGC:53699 IMAGE:4889400),
           complete cds
          Length = 1051

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||| |||||||||||||   | ||||||||| ||||||||||||||||||||||
Sbjct: 790 gggttcaggcccttggggcaggtgcgggtgcagttcatgatggtgtggcagcggtacag 732



to top

>gb|AE012320.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 228
           of 460 of the complete genome
          Length = 13110

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
           |||||||||||||| |||||||   | | ||||||| |||||||||||||||| ||||||
Sbjct: 132 gggttcagccccttagggcaggtgcgggcgcagttcatgatggtgtggcagcgatacagc 191

                 
Query: 352 ttgaac 357
           ||||||
Sbjct: 192 ttgaac 197



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                           
Query: 292     gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
               |||||||||||||| |||||||   | | ||||||| |||||||||||||||| ||||||
Sbjct: 2397495 gggttcagccccttagggcaggtgcgggcgcagttcatgatggtgtggcagcgatacagc 2397436

                     
Query: 352     ttgaac 357
               ||||||
Sbjct: 2397435 ttgaac 2397430



to top

>dbj|AP006723.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
           BAC clone:B1203H11
          Length = 156561

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 416 acctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           |||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 838 acctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 895



to top

>ref|XM_479820.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1257

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 417 cctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 741 cctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 685



to top

>ref|XM_507103.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1005_B05.29-2
           mRNA
          Length = 1328

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 417 cctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 737 cctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 681



to top

>gb|BC051934.1| Mus musculus succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone MGC:62176 IMAGE:5688898),
           complete cds
          Length = 1091

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 913 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 861



to top

>ref|NM_023374.3| Mus musculus succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip) (Sdhb), mRNA
          Length = 1091

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 913 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 861



to top

>dbj|AK153045.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830119O20 product:succinate
           dehydrogenase complex, subunit B, iron sulfur (Ip), full
           insert sequence
          Length = 946

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 790 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 738



to top

>dbj|AK169839.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430034O09
           product:succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), full insert sequence
          Length = 962

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 806 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 754



to top

>dbj|AK169252.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920099B22
           product:succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), full insert sequence
          Length = 963

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 804 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 752



to top

>dbj|AK009660.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310037H18 product:DJ37C10.2 (SUCCINATE
           DEHYDROGENASE COMPLEX, SUBUNIT B, IRON SULFUR (IP) (EC
           1.3.5.1, SDH1)) (UNKNOWN) (PROTEIN FOR MGC:14116)
           homolog [Homo sapiens], full insert sequence
          Length = 963

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 807 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 755



to top

>dbj|AK003052.1| Mus musculus adult male brain cDNA, RIKEN full-length enriched
           library, clone:0710008N11 product:DJ37C10.2 (SUCCINATE
           DEHYDROGENASE COMPLEX, SUBUNIT B, IRON SULFUR (IP) (EC
           1.3.5.1, SDH1)) (UNKNOWN) (PROTEIN FOR MGC:14116)
           homolog [Homo sapiens], full insert sequence
          Length = 972

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 807 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 755



to top

>dbj|AK190493.1| Mus musculus cDNA, clone:Y1G0102O16, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000010007, based on BLAT search
          Length = 389

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 385 ttcagacccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 333



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                    
Query: 292     gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcg 344
               |||||||| |||||||||||||  |||| ||||||| ||||||||||||||||
Sbjct: 3398022 gggttcaggcccttggggcaggtctgcgcgcagttcatgatggtgtggcagcg 3398074



to top

>dbj|AK102607.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033099B04, full
           insert sequence
          Length = 1257

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 417 cctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 741 cctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 685



to top

>dbj|AK059789.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-D12, full
           insert sequence
          Length = 1328

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 417 cctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 737 cctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 681



to top

>dbj|AB017427.1| Oryza sativa (japonica cultivar-group) mRNA for mitochondrial
           ribosomal protein S14, complete cds
          Length = 1233

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 417 cctgttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||||||| ||||| ||||| ||||||||||| ||||| || ||||||||||||||
Sbjct: 695 cctgttggcgtggaggagcgcggcggggccgaggtactcctcggggttccaccagta 639



to top

>ref|XM_845169.1| PREDICTED: Canis familiaris similar to Succinate dehydrogenase
           [ubiquinone] iron-sulfur protein, mitochondrial
           precursor (Ip) (Iron-sulfur subunit of complex II)
           (LOC608210), mRNA
          Length = 990

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||||||||||||||     ||||||||| ||||||||||||||||||||||
Sbjct: 781 ttcagccccttggggcaggtccttgtgcagttcatgatggtgtggcagcggtacag 726



to top

>ref|XM_535392.2| PREDICTED: Canis familiaris similar to Succinate dehydrogenase
           [ubiquinone] iron-sulfur protein, mitochondrial
           precursor (Ip) (Iron-sulfur subunit of complex II),
           transcript variant 1 (LOC478217), mRNA
          Length = 992

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||||||||||||||     ||||||||| ||||||||||||||||||||||
Sbjct: 783 ttcagccccttggggcaggtccttgtgcagttcatgatggtgtggcagcggtacag 728



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                           
Query: 292     gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
               |||||||| |||||||||||||  |  | ||||||| |||| |||||||||||||| |||
Sbjct: 2738954 gggttcagacccttggggcaggtcttggcgcagttcatgatcgtgtggcagcggtagagc 2738895

                     
Query: 352     ttgaac 357
               ||||||
Sbjct: 2738894 ttgaac 2738889



to top

>gb|AY550052.1| Sus scrofa succinate dehydrogenase iron-protein subunit mRNA,
           partial cds
          Length = 283

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 297 cagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||||||| ||||    |||||||||| ||||||||||||||||||||||
Sbjct: 60  cagccccttgggacaggtccccgtgcagttcatgatggtgtggcagcggtacag 7



to top

>emb|BX014230.1|CNS08J56 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtaca 349
           |||||||||||||| |||||||   ||||||||||| |||| |||||||| |||||||
Sbjct: 809 gggttcagccccttcgggcaggtgcgcgtgcagttcatgatcgtgtggcaccggtaca 866



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                     
Query: 319     gtgcagttcttgatggtgtggcagcggtacagcttgaa 356
               ||||||||| |||||||||||||||| |||||||||||
Sbjct: 4362643 gtgcagttcatgatggtgtggcagcgatacagcttgaa 4362606



to top

>ref|XM_308512.2| Anopheles gambiae str. PEST ENSANGP00000024398
           (ENSANGG00000013539), partial mRNA
          Length = 762

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 292 gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtaca 349
           |||||||||||||| |||||||   ||||||||||| |||| |||||||| |||||||
Sbjct: 674 gggttcagccccttcgggcaggtgcgcgtgcagttcatgatcgtgtggcaccggtaca 617



to top

>emb|AL645625.15| Mouse DNA sequence from clone RP23-183L1 on chromosome 4, complete
             sequence
          Length = 226754

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                           
Query: 302   ccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
             ||||||||||||  || ||||||||| |||||||||||||||||||
Sbjct: 60265 ccttggggcaggtctgtgtgcagttcatgatggtgtggcagcggta 60220



to top

>gb|BT017381.1| Zea mays clone EL01N0326E03.c mRNA sequence
          Length = 1367

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 421 ttggcatggagcagcgctgcggggccgagatactcttctgggttccaccagta 473
           ||||| ||||||||||| || |||||||| ||||| || ||||||||||||||
Sbjct: 723 ttggcgtggagcagcgcggctgggccgaggtactcctcggggttccaccagta 671



to top

>gb|AY682984.1| Xanthomonas citri succinate dehydrogenase subunit B (sdhB) gene,
           complete cds
          Length = 929

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 321 gcagttcttgatggtgtggcagcggtacagcttgaac 357
           ||||||| |||||||||||||||| ||||||||||||
Sbjct: 749 gcagttcatgatggtgtggcagcgatacagcttgaac 713



to top

>gb|BC013509.1| Mus musculus succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone MGC:19177 IMAGE:4225025),
           complete cds
          Length = 986

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| ||||| |||||||  || ||||||||| |||||||||||||||||||
Sbjct: 808 ttcagacccttagggcaggtctgtgtgcagttcatgatggtgtggcagcggta 756



to top

>ref|XM_914820.2| PREDICTED: Mus musculus similar to succinate dehydrogenase Ip
           subunit (LOC638710), mRNA
          Length = 995

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| ||||| |||||||  || ||||||||| |||||||||||||||||||
Sbjct: 831 ttcagacccttagggcaggtctgtgtgcagttcatgatggtgtggcagcggta 779



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                    
Query: 321     gcagttcttgatggtgtggcagcggtacagcttgaac 357
               ||||||| |||||||||||||||| ||||||||||||
Sbjct: 2577143 gcagttcatgatggtgtggcagcgatacagcttgaac 2577107



to top

>gb|BC018580.1| Mus musculus succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone IMAGE:3583751)
          Length = 946

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| ||||| |||||||  || ||||||||| |||||||||||||||||||
Sbjct: 772 ttcagacccttagggcaggtctgtgtgcagttcatgatggtgtggcagcggta 720



to top

>gb|AE011843.1| Xanthomonas axonopodis pv. citri str. 306,  section 221 of 469 of the
            complete genome
          Length = 12507

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 321  gcagttcttgatggtgtggcagcggtacagcttgaac 357
            ||||||| |||||||||||||||| ||||||||||||
Sbjct: 9537 gcagttcatgatggtgtggcagcgatacagcttgaac 9501



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                          
Query: 292    gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
              |||||||| || ||||||||||  | |||||| ||| |||| |||||||||||||| |||
Sbjct: 765808 gggttcaggcctttggggcaggtcttcgtgcaattcatgatcgtgtggcagcggtagagc 765867

                   
Query: 352    ttgaa 356
              |||||
Sbjct: 765868 ttgaa 765872



to top

>dbj|AK003533.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110007E13 product:SUCCINATE
           DEHYDROGENASE [UBIQUINONE] IRON-SULFUR PROTEIN,
           MITOCHONDRIAL PRECURSOR (EC 1.3.5.1) (IP) (IRON-SULFUR
           SUBUNIT OF COMPLEX II) homolog [Homo sapiens], full
           insert sequence
          Length = 955

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || ||||| ||| |||||||||||||||||||
Sbjct: 797 ttcagacccttggggcaggtctgtgtgcaattcatgatggtgtggcagcggta 745



to top

>ref|XM_216558.2| PREDICTED: Rattus norvegicus succinate dehydrogenase complex,
           subunit B, iron sulfur (Ip) (predicted)
           (Sdhb_predicted), mRNA
          Length = 890

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  || || |||||| |||||||||||||||||||
Sbjct: 805 ttcagacccttggggcaggtctgtgtacagttcatgatggtgtggcagcggta 753



to top

>dbj|AK181550.1| Mus musculus cDNA, clone:Y0G0118I23, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000010007, based on BLAT search
          Length = 299

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||| |||||||||||||  ||  |||||||| |||||||||||||||||||
Sbjct: 295 ttcagacccttggggcaggtctgtttgcagttcatgatggtgtggcagcggta 243



to top

>gb|AY661544.1| Xanthomonas oryzae pv. oryzae succinate dehydrogenase membrane anchor
            subunit (sdhC), succinate dehydrogenase membrane anchor
            subunit (sdhD), succinate dehydrogenase flavoprotein
            subunit (sdhA), and succinate dehydrogenase iron-sulfur
            subunit (sdhB) genes, complete cds
          Length = 3616

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 321  gcagttcttgatggtgtggcagcggtacagcttgaa 356
            ||||||| |||||||||||||||| |||||||||||
Sbjct: 3535 gcagttcatgatggtgtggcagcgatacagcttgaa 3500



to top

>ref|XM_859608.1| PREDICTED: Canis familiaris similar to Succinate dehydrogenase
           [ubiquinone] iron-sulfur protein, mitochondrial
           precursor (Ip) (Iron-sulfur subunit of complex II),
           transcript variant 2 (LOC478217), mRNA
          Length = 790

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 319 gtgcagttcttgatggtgtggcagcggtacag 350
           ||||||||| ||||||||||||||||||||||
Sbjct: 759 gtgcagttcatgatggtgtggcagcggtacag 728



to top

>ref|XM_845487.1| PREDICTED: Canis familiaris similar to Succinate dehydrogenase
           [ubiquinone] iron-sulfur protein, mitochondrial
           precursor (Ip) (Iron-sulfur subunit of complex II)
           (LOC608456), mRNA
          Length = 360

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 295 ttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacag 350
           |||||||||||||||||||     ||||||||| |||||||| |||||||||||||
Sbjct: 266 ttcagccccttggggcaggtccttgtgcagttcatgatggtgcggcagcggtacag 211



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                           
Query: 292     gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
               |||||||| |||||||||||| |||    ||||||| ||||||||||||||||| |||||
Sbjct: 3805844 gggttcaggcccttggggcagacatcgacgcagttcatgatggtgtggcagcggaacagc 3805785



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 321     gcagttcttgatggtgtggcagcggtacagcttgaa 356
               ||||||| |||||||||||||||| |||||||||||
Sbjct: 2423366 gcagttcatgatggtgtggcagcgatacagcttgaa 2423401



to top

>ref|XM_685549.1| PREDICTED: Danio rerio similar to Sdhb-prov protein (LOC562149),
           partial mRNA
          Length = 531

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 319 gtgcagttcttgatggtgtggcagcggtacag 350
           ||||||||| ||||||||||||||||||||||
Sbjct: 515 gtgcagttcatgatggtgtggcagcggtacag 484



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                       
Query: 301     cccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagcttgaa 356
               ||||| ||||||||||  ||||||||| ||||||||||||| ||| |||| |||||
Sbjct: 1643333 cccttcgggcaggcatcggtgcagttcatgatggtgtggcaccggaacagtttgaa 1643388



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 321     gcagttcttgatggtgtggcagcggtacagcttgaa 356
               ||||||| |||||||||||||||| |||||||||||
Sbjct: 2443438 gcagttcatgatggtgtggcagcgatacagcttgaa 2443473



to top

>gb|AY118923.1| Drosophila melanogaster LD23740 full insert cDNA
          Length = 1247

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 298 agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 923 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 874



to top

>ref|NM_057753.3| Drosophila melanogaster Succinate dehydrogenase B CG3283-RA (SdhB),
           mRNA
          Length = 1235

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 298 agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
           ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 941 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 892



to top

>gb|AC008340.5| Drosophila melanogaster, chromosome 2R, region 42D-42E, BAC clone
              BACR07J20, complete sequence
          Length = 181771

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 298    agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
              ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 102443 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 102394



to top

>gb|AC007549.5|AC007549 Drosophila melanogaster, chromosome 2R, region 42D-42E, BAC clone
             BACR04F03, complete sequence
          Length = 150587

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 298   agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
             ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 51532 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 51483



to top

>gb|AE003790.2| Drosophila melanogaster chromosome 2R, section 7 of 73 of the complete
              sequence
          Length = 348873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 298    agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
              ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 138654 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 138605



to top

>gb|L27705.1|DROSDHB Drosophila melanogaster succinate dehydrogenase iron-subunit (sdhB)
            gene, complete cds
          Length = 2741

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 298  agccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
            ||||||||||||||||   ||||||||||| |||| |||||||| |||||
Sbjct: 2142 agccccttggggcaggtgcgcgtgcagttcatgatcgtgtggcaccggta 2093



to top

>ref|XM_513112.1| PREDICTED: Pan troglodytes succinate dehydrogenase complex, subunit
           B, iron sulfur (Ip) (LOC456526), mRNA
          Length = 789

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 695 gtgcagttcatgatggtgtggcagcggta 667



to top

>gb|BC007840.2| Homo sapiens succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip), mRNA (cDNA clone MGC:14116 IMAGE:4124737),
           complete cds
          Length = 1130

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 900 gtgcagttcatgatggtgtggcagcggta 872



to top

>emb|CR733346.2|CNS0GSNQ Tetraodon nigroviridis full-length cDNA
          Length = 1040

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 840 gtgcagttcatgatggtgtggcagcggta 812



to top

>emb|CR705776.2|CNS0G7J0 Tetraodon nigroviridis full-length cDNA
          Length = 1014

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 814 gtgcagttcatgatggtgtggcagcggta 786



to top

>emb|CR704266.2|CNS0G6D2 Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 819 gtgcagttcatgatggtgtggcagcggta 791



to top

>emb|CR689174.2|CNS0FUPU Tetraodon nigroviridis full-length cDNA
          Length = 999

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 816 gtgcagttcatgatggtgtggcagcggta 788



to top

>emb|CR687900.2|CNS0FTQG Tetraodon nigroviridis full-length cDNA
          Length = 1012

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 814 gtgcagttcatgatggtgtggcagcggta 786



to top

>emb|CR661751.2|CNS0F9KT Tetraodon nigroviridis full-length cDNA
          Length = 1040

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 840 gtgcagttcatgatggtgtggcagcggta 812



to top

>emb|CR658529.1|CNS0F73B Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 834 gtgcagttcatgatggtgtggcagcggta 806



to top

>emb|CR650202.1|CNS0F0O0 Tetraodon nigroviridis full-length cDNA
          Length = 867

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 792 gtgcagttcatgatggtgtggcagcggta 764



to top

>emb|AL049569.13|HSDJ37C10 Human DNA sequence from clone RP1-37C10 on chromosome 1p35.2-35.21
              Contains the 3' end of the CROCC gene for ciliary rootlet
              coiled-coil rootletin (KIAA0445), the MFAP2 gene for
              microfibrillar-associated protein 2, a novel gene, the gene
              for a novel protein, the SDHB gene for succinate
              dehydrogenase complex subunit B iron sulfur (Ip), the PADI2
              gene for type II peptidyl arginine deiminase, complete
              sequence
          Length = 216497

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 319    gtgcagttcttgatggtgtggcagcggta 347
              ||||||||| |||||||||||||||||||
Sbjct: 134863 gtgcagttcatgatggtgtggcagcggta 134835



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 284  gctttgcagggttcagcccct 304
            |||||||||||||||||||||
Sbjct: 4673 gctttgcagggttcagcccct 4693



to top

>emb|AL163191.2|SPAC140 S.pombe chromosome I cosmid c140
          Length = 15326

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 437  ctgcggggccgagatactcttctgggttccaccagta 473
            |||| ||||| ||||||||||||| ||||||||||||
Sbjct: 1289 ctgctgggccaagatactcttctgagttccaccagta 1253



to top

>gb|AE006011.1| Caulobacter crescentus CB15 section 337 of 359 of the complete genome
          Length = 10158

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                        
Query: 292  gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtacagc 351
            ||||||||||||||||||||  | || | ||||||| |||| || |||||||| || |||
Sbjct: 4695 gggttcagccccttggggcaaacctgggcgcagttcatgatcgtatggcagcgatagagc 4754

                 
Query: 352  ttgaa 356
            |||||
Sbjct: 4755 ttgaa 4759



to top

>ref|NM_003000.1| Homo sapiens succinate dehydrogenase complex, subunit B, iron
           sulfur (Ip) (SDHB), mRNA
          Length = 1100

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 883 gtgcagttcatgatggtgtggcagcggta 855



to top

>emb|CR610874.1| full-length cDNA clone CS0DI041YC11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 961

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 750 gtgcagttcatgatggtgtggcagcggta 722



to top

>emb|CR606201.1| full-length cDNA clone CS0DI064YA14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 653

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 403 gtgcagttcatgatggtgtggcagcggta 375



to top

>emb|CR596760.1| full-length cDNA clone CS0DI052YP22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 839

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 583 gtgcagttcatgatggtgtggcagcggta 555



to top

>emb|CR596635.1| full-length cDNA clone CS0DK004YD20 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 793

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 537 gtgcagttcatgatggtgtggcagcggta 509



to top

>emb|CR595888.1| full-length cDNA clone CS0DI035YE01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 849

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 593 gtgcagttcatgatggtgtggcagcggta 565



to top

>emb|CR593493.1| full-length cDNA clone CS0DL011YN10 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1086

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 896 gtgcagttcatgatggtgtggcagcggta 868



to top

>ref|NM_001018964.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC140.01),
           partial mRNA
          Length = 759

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 437 ctgcggggccgagatactcttctgggttccaccagta 473
           |||| ||||| ||||||||||||| ||||||||||||
Sbjct: 568 ctgctgggccaagatactcttctgagttccaccagta 532



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 420    gttggcatggagcagcgctgcggggccgagata 452
              |||||| ||||||||||| ||||||||||||||
Sbjct: 552998 gttggcctggagcagcgcggcggggccgagata 552966



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                      
Query: 292    gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
              ||||| || ||||| |||||||| |  | ||||||| |||||||||||||||||||
Sbjct: 553126 gggttgaggcccttcgggcaggccttggcgcagttcatgatggtgtggcagcggta 553071



to top

>gb|AF007569.1|AF007569 Bradyrhizobium japonicum GstR (gstR) gene, partial cds, and succinate
            dehydrogenase membrane anchor subunit (sdhC), membrane
            anchor subunit (sdhD), flavoprotein subunit (sdhA) and
            iron-sulfur protein subunit (sdhB) genes, complete cds
          Length = 5284

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 420  gttggcatggagcagcgctgcggggccgagata 452
            |||||| ||||||||||| ||||||||||||||
Sbjct: 4790 gttggcctggagcagcgcggcggggccgagata 4758



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 292  gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcggta 347
            ||||| || ||||| |||||||| |  | ||||||| |||||||||||||||||||
Sbjct: 4918 gggttgaggcccttcgggcaggccttggcgcagttcatgatggtgtggcagcggta 4863



to top

>gb|U17248.1|HSU17248 Human succinate dehydrogenase iron-protein subunit (sdhB) gene,
           complete cds
          Length = 1100

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 883 gtgcagttcatgatggtgtggcagcggta 855



to top

>gb|U17885.1|HSSDHBS7 Human succinate dehydrogenase iron-protein subunit (sdhB) gene,
           exon 7
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 201 gtgcagttcatgatggtgtggcagcggta 173



to top

>gb|M32246.1|HUMCOMIIP Human succinate-ubiquinone oxidoreductase iron sulfur (Ip) subunit
           mRNA, 3' end
          Length = 911

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 695 gtgcagttcatgatggtgtggcagcggta 667



to top

>dbj|D10245.1|HUMSDHBMT Homo sapiens mRNA for mitochondrial succinate-ubiquinone
           oxidoreductase iron sulfur subunit
          Length = 911

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||||||||||||||||||
Sbjct: 695 gtgcagttcatgatggtgtggcagcggta 667



to top

>dbj|AB066516.1| Macaca fascicularis brain cDNA clone:QmoA-10618, full insert sequence
          Length = 2780

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 319  gtgcagttcttgatggtgtggcagcggt 346
            ||||||||| ||||||||||||||||||
Sbjct: 1631 gtgcagttcatgatggtgtggcagcggt 1658



to top

>gb|DQ145263.1| Drosophila miranda neo-Y SdhB gene, partial sequence
          Length = 1190

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 292  gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtg 338
            |||||||| |||||||| ||||   ||||||||||| ||||||||||
Sbjct: 1097 gggttcaggcccttgggacaggtgcgcgtgcagttcatgatggtgtg 1051



to top

>gb|DQ145262.1| Drosophila miranda neo-X SdhB gene, partial sequence
          Length = 1190

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 292  gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtg 338
            |||||||| |||||||| ||||   ||||||||||| ||||||||||
Sbjct: 1097 gggttcaggcccttgggacaggtgcgcgtgcagttcatgatggtgtg 1051



to top

>gb|DQ066192.1| Ixodes scapularis isolate ISUFL97 succinate dehydrogenase Ip
           subunit mRNA, complete cds
          Length = 849

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 303 cttggggcaggcatgcgtgcagttcttgatggtgtggcagcggtaca 349
           |||||||||||  |  ||||||||| ||||||||||||| |||||||
Sbjct: 756 cttggggcaggtcttggtgcagttcatgatggtgtggcaacggtaca 710



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 321     gcagttcttgatggtgtggcagcggtacagc 351
               ||||||| ||||||||||||||||| |||||
Sbjct: 1114996 gcagttcatgatggtgtggcagcggaacagc 1114966



to top

>gb|AC108013.5| Homo sapiens BAC clone RP13-538M20 from 4, complete sequence
          Length = 118662

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 284    gctttgcagggttcagcccctt 305
              ||||||||||||||||||||||
Sbjct: 100330 gctttgcagggttcagcccctt 100351



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 321     gcagttcttgatggtgtggcagcggtacag 350
               ||||||| ||||||||||||||||| ||||
Sbjct: 2170166 gcagttcatgatggtgtggcagcggaacag 2170195



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                                
Query: 296     tcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcg 344
               |||||||||| ||||| ||||  | ||||||| |||| |||||||||||
Sbjct: 2347272 tcagccccttcgggcacgcattggcgcagttcatgatcgtgtggcagcg 2347320



to top

>ref|XM_654844.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2332.2), mRNA
          Length = 822

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 289 gcagggttcagccccttggggcagg 313
           ||||||||||| |||||||||||||
Sbjct: 779 gcagggttcagacccttggggcagg 755



to top

>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12
          Length = 333800

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                   
Query: 292    gggttcagccccttggggcaggcatgcgtgcagttcttgatggtgtggcagcg 344
              ||||||| |||||| || ||||| || | ||||||| |||| |||||||||||
Sbjct: 284282 gggttcaaccccttcggacaggcctgggcgcagttcatgattgtgtggcagcg 284334



to top

>gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome 6, complete sequence
          Length = 188132

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 55     gaaccaccaaactagatacag 75
              |||||||||||||||||||||
Sbjct: 161463 gaaccaccaaactagatacag 161483



to top

>emb|CR701692.1|CNS0G4DK Tetraodon nigroviridis full-length cDNA
          Length = 1268

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 754 gtgcagttcatgatagtgtggcagcggta 726



to top

>emb|CR699236.1|CNS0G2HC Tetraodon nigroviridis full-length cDNA
          Length = 1248

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 745 gtgcagttcatgatagtgtggcagcggta 717



to top

>emb|CR695417.2|CNS0FZJ9 Tetraodon nigroviridis full-length cDNA
          Length = 1234

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 759 gtgcagttcatgatagtgtggcagcggta 731



to top

>emb|CR688415.2|CNS0FU4R Tetraodon nigroviridis full-length cDNA
          Length = 1275

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 758 gtgcagttcatgatagtgtggcagcggta 730



to top

>emb|CR681198.2|CNS0FOKA Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 760 gtgcagttcatgatagtgtggcagcggta 732



to top

>emb|CR676594.2|CNS0FL0U Tetraodon nigroviridis full-length cDNA
          Length = 1288

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 765 gtgcagttcatgatagtgtggcagcggta 737



to top

>emb|CR665870.1|CNS0FCR8 Tetraodon nigroviridis full-length cDNA
          Length = 1281

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 767 gtgcagttcatgatagtgtggcagcggta 739



to top

>emb|CR659456.2|CNS0F7T2 Tetraodon nigroviridis full-length cDNA
          Length = 1047

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| |||| ||||||||||||||
Sbjct: 306 gtgcagttcatgatagtgtggcagcggta 278



to top

>emb|BX664727.7| Human DNA sequence from clone RP11-146D12 on chromosome 9 Contains the
             3' end of a novel gene similar to ankyrin repeat domain
             20A (ANKRD20A), a novel zinc finger pseudogene, a
             pseudogene similar to part of sorting nexin associated
             golgi protein 1 (SNAG1), a melanoma antigen (LOC51152)
             pseudogene and three novel genes, complete sequence
          Length = 105929

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 74382 gctttgcagggttcagcccct 74362



to top

>emb|AL928636.8| Human DNA sequence from clone RP13-417F5 on chromosome X, complete
              sequence
          Length = 171922

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 142572 gctttgcagggttcagcccct 142552



to top

>emb|AL589765.19| Human DNA sequence from clone RP11-98D18 on chromosome 1 Contains the
             3' end of the SNX27 gene for sorting nexin family member
             27, the TNRC4 gene for trinucleotide repeat containing 4,
             five novel genes, a ribosomal protein S11 (RPS11)
             pseudogene, the MRPL9 gene for mitochondrial ribosomal
             protein L9, the OAZ3 gene for ornithine decarboxylase
             antizyme 3, a novel gene (FLJ36032)  the TDRKH gene for
             tudor and KH domain containing, the RORC gene for
             RAR-related orphan receptor C and four CpG islands,
             complete sequence
          Length = 163389

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 60304 gctttgcagggttcagcccct 60284



to top

>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a
             pseudogene similar to part of sorting nexin associated
             golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin
             repeat domain 20A, five novel genes, a pseudogene similar
             to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A)
             and a CpG island, complete sequence
          Length = 180498

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 16166 gctttgcagggttcagcccct 16186



to top

>emb|AL513187.6| Human DNA sequence from clone RP11-436H6 on chromosome 1 Contains part
             of the NTNG1 gene for netrin G1, complete sequence
          Length = 122032

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 61478 gctttgcagggttcagcccct 61498



to top

>emb|AL359878.13| Human DNA sequence from clone RP11-363N22 on chromosome 10 Contains the
              5' end of gene KIAA0217, a novel gene, the 5' end of the
              gene for G protein-binding protein CRFG (NGB FLJ10686
              FLJ10690 FLJ39774) and four CpG islands, complete sequence
          Length = 184289

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 284    gctttgcagggttcagccccttggg 308
              |||||||||||||||||||| ||||
Sbjct: 161269 gctttgcagggttcagccccctggg 161293



to top

>emb|AL358174.12| Human DNA sequence from clone RP11-387H19 on chromosome Xq27.1-28,
             complete sequence
          Length = 96743

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 73574 gctttgcagggttcagcccct 73554



to top

>gb|AC079271.4| Homo sapiens chromosome 10 clone RP11-455I1, complete sequence
          Length = 200476

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 86753 gctttgcagggttcagcccct 86733



to top

>emb|AL162723.12| Human DNA sequence from clone RP13-428K23 on chromosome X, complete
              sequence
          Length = 192780

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 173271 gctttgcagggttcagcccct 173291



to top

>emb|AL158824.11| Human DNA sequence from clone RP11-165N19 on chromosome 9 Contains a
              ribosomal protein L29 (RPL29) pseudogene, the 3' end of the
              gene for regulator of differentiation 1 (ROD1), a novel
              gene containing DKFZP761E1824, a heat shock 10 KDa protein
              1 (HSPE1) pseudogene and a CpG island, complete sequence
          Length = 147345

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 117752 gctttgcagggttcagcccct 117732



to top

>emb|AL133321.11| Human DNA sequence from clone RP13-17E1 on chromosome X Contains part
             of the PCDH11X gene for protocadherin 11 X-linked,
             complete sequence
          Length = 170805

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 72410 gctttgcagggttcagcccct 72430



to top

>emb|AL078623.28|HSJ1069C8 Human DNA sequence from clone RP5-1069C8 on chromosome 20 Contains the 3'
              end of a novel gene, a novel gene and a CpG island,
              complete sequence
          Length = 177102

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 162100 gctttgcagggttcagcccct 162080



to top

>emb|AL023655.1|HS242N11 Human DNA sequence from clone RP1-242N11 on chromosome 6p22.3-23,
              complete sequence
          Length = 167514

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 101553 gctttgcagggttcagcccct 101573



to top

>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 322   cagttcttgatggtgtggcagcggtacag 350
             |||||| ||||||||||||||||| ||||
Sbjct: 66971 cagttcatgatggtgtggcagcggaacag 66999



to top

>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14
          Length = 349305

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 322  cagttcttgatggtgtggcagcggtacag 350
            |||||| ||||||||||||||||| ||||
Sbjct: 3478 cagttcatgatggtgtggcagcggaacag 3506



to top

>emb|BX640418.1| Bordetella pertussis strain Tohama I, complete genome; segment 8/12
          Length = 349346

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 322   cagttcttgatggtgtggcagcggtacag 350
             |||||| ||||||||||||||||| ||||
Sbjct: 67135 cagttcatgatggtgtggcagcggaacag 67163



to top

>gb|AC159305.3| Mus musculus BAC clone RP23-205D10 from chromosome 6, complete sequence
          Length = 209064

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 3     taataattaataagtttatga 23
             |||||||||||||||||||||
Sbjct: 13345 taataattaataagtttatga 13365



to top

>emb|CR937102.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YO05BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 715

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gtgcagttcttgatggtgtggcagcggta 347
           ||||||||| ||||||||||||| |||||
Sbjct: 375 gtgcagttcatgatggtgtggcaccggta 403



to top

>emb|AL832798.1|HSM804109 Homo sapiens genomic DNA; cDNA DKFZp667K1123 (from clone
            DKFZp667K1123)
          Length = 3070

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 284  gctttgcagggttcagcccct 304
            |||||||||||||||||||||
Sbjct: 1419 gctttgcagggttcagcccct 1439



to top

>gb|AC022536.13| Homo sapiens chromosome 10 clone RP11-38M7, complete sequence
          Length = 160678

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 284    gctttgcagggttcagccccttggg 308
              |||||||||||||||||||| ||||
Sbjct: 143458 gctttgcagggttcagccccctggg 143434



to top

>gb|AC090605.7| Homo sapiens chromosome 15, clone RP11-261P5, complete sequence
          Length = 166870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 53224 gctttgcagggttcagcccct 53204



to top

>gb|AC008492.3| Homo sapiens chromosome 5 clone CTC-427F23, complete sequence
          Length = 138127

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 44606 gctttgcagggttcagcccct 44586



to top

>gb|AC104445.2| Homo sapiens chromosome 3 clone RP11-444P10, complete sequence
          Length = 201218

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 183622 gctttgcagggttcagcccct 183602



to top

>gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, complete sequence
          Length = 203831

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 94476 gctttgcagggttcagcccct 94496



to top

>gb|AC100800.2| Homo sapiens chromosome 8, clone RP11-161I2, complete sequence
          Length = 196849

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 59480 gctttgcagggttcagcccct 59460



to top

>gb|AF320597.1|AF320597 Mus musculus C lectin-related protein E pseudogene, partial sequence
          Length = 19272

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     taataattaataagtttatga 23
             |||||||||||||||||||||
Sbjct: 11209 taataattaataagtttatga 11189



to top

>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome
          Length = 859006

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    aaaccaaatggcaggctgatt 198
              |||||||||||||||||||||
Sbjct: 327554 aaaccaaatggcaggctgatt 327534



to top

>gb|AC008621.8| Homo sapiens chromosome 5 clone CTB-147K10, complete sequence
          Length = 67086

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 18114 gctttgcagggttcagcccct 18094



to top

>emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase gene locus (PADI12346 genes)
          Length = 355060

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 98868 gctttgcagggttcagcccct 98848



to top

>gb|AC124915.5| Homo sapiens chromosome 3 clone RP11-717N7, complete sequence
          Length = 183748

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 89495 gctttgcagggttcagcccct 89475



to top

>gb|AC008486.6|AC008486 Homo sapiens chromosome 5 clone CTC-421B9, complete sequence
          Length = 124124

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 26566 gctttgcagggttcagcccct 26586



to top

>gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, complete sequence
          Length = 198821

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 21873 gctttgcagggttcagcccct 21893



to top

>gb|AC068660.3|AC068660 Homo sapiens chromosome 5 clone CTC-349J2, complete sequence
          Length = 172188

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 146516 gctttgcagggttcagcccct 146496



to top

>gb|AC096734.3| Homo sapiens BAC clone RP11-109E24 from 4, complete sequence
          Length = 179753

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 168378 gctttgcagggttcagcccct 168398



to top

>gb|AC108037.3| Homo sapiens BAC clone RP11-168E17 from 4, complete sequence
          Length = 73477

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 18137 gctttgcagggttcagcccct 18117



to top

>gb|AC068276.7| Homo sapiens BAC clone RP11-127H13 from 2, complete sequence
          Length = 163719

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 149192 gctttgcagggttcagcccct 149172



to top

>gb|AC012077.4|AC012077 Homo sapiens BAC clone RP11-524G14 from Y, complete sequence
          Length = 209287

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 78471 gctttgcagggttcagcccct 78491



to top

>gb|AC074213.7| Homo sapiens BAC clone RP11-34K3 from 2, complete sequence
          Length = 176539

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 127768 gctttgcagggttcagcccct 127748



to top

>gb|AC062016.5| Homo sapiens BAC clone RP11-59P4 from 2, complete sequence
          Length = 187799

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 33962 gctttgcagggttcagcccct 33982



to top

>gb|AC079465.5| Homo sapiens chromosome 5 clone CTD-2124P24, complete sequence
          Length = 184585

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 30332 gctttgcagggttcagcccct 30312



to top

>gb|AC133134.2| Homo sapiens chromosome 5 clone RP11-120B7, complete sequence
          Length = 148711

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 26703 gctttgcagggttcagcccct 26723



to top

>emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 map Xq28, complete
             sequence
          Length = 220032

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   gctttgcagggttcagcccct 304
             |||||||||||||||||||||
Sbjct: 72586 gctttgcagggttcagcccct 72566



to top

>emb|AL160314.7|CNS01RH3 Human chromosome 14 DNA sequence BAC C-2555K7 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 208953

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 135327 gctttgcagggttcagcccct 135347



to top

>gb|AC174446.2| Mus musculus BAC clone RP23-356N23 from chromosome 6, complete sequence
          Length = 193034

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     taataattaataagtttatga 23
             |||||||||||||||||||||
Sbjct: 74780 taataattaataagtttatga 74760



to top

>gb|AC153486.6| Mus musculus 6 BAC RP23-27E5 (Roswell Park Cancer Institute (C57BL/6J
            Female) Mouse BAC Library) complete sequence
          Length = 213560

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 55   gaaccaccaaactagatacag 75
            |||||||||||||||||||||
Sbjct: 1380 gaaccaccaaactagatacag 1400



to top

>gb|AC004072.1|AC004072 Human Chromosome X clone bWXD342, complete sequence
          Length = 170658

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    gctttgcagggttcagcccct 304
              |||||||||||||||||||||
Sbjct: 135581 gctttgcagggttcagcccct 135561



to top

>ref|NM_113653.2| Arabidopsis thaliana SDH2-1 AT3G27380 (SDH2-1) mRNA, complete cds
          Length = 1176

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 842 tggcaacggtaaagcttgaactcgtcgt 815



to top

>ref|NM_123430.1| Arabidopsis thaliana SDH2-2 AT5G40650 (SDH2-2) mRNA, complete cds
          Length = 1132

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 gtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgctcctttgtgaac 393
           |||||||| || ||||| |||||||| ||||  ||||  ||||| |  ||||| ||| ||
Sbjct: 813 gtgtggcatcgatacagtttgaactcatcgtcaatggcttcaagtctttccttagtgtac 754

                                                   
Query: 394 tcatcacggctgtcttggatccacctgttggcatggagca 433
           ||||| ||||| ||    ||||||||||||||||| ||||
Sbjct: 753 tcatctcggctatcacttatccacctgttggcatgaagca 714



to top

>ref|XM_480600.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3143

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 414  ccacctgttggcatggagca 433
            ||||||||||||||||||||
Sbjct: 2723 ccacctgttggcatggagca 2742



to top

>ref|NM_213191.1| Danio rerio zgc:77067 (zgc:77067), mRNA
          Length = 1418

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 206 tccgacatctccacgggggaagac 229
           |||| |||||||||||||||||||
Sbjct: 119 tccgtcatctccacgggggaagac 96



to top

>gb|AY735609.1| Arabidopsis thaliana chromosome 3 hypothetical protein AT3G27370
           mRNA, complete cds, alternatively spliced
          Length = 2486

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 803 tggcaacggtaaagcttgaactcgtcgt 776



to top

>gb|AY735608.1| Arabidopsis thaliana chromosome 3 hypothetical protein AT3G27370
           mRNA, complete cds, alternatively spliced
          Length = 2382

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 801 tggcaacggtaaagcttgaactcgtcgt 774



to top

>gb|AC115301.7| Mus musculus BAC clone RP24-83E2 from chromosome 7, complete
          sequence
          Length = 175603

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 8  attaataagtttatgaatta 27
          ||||||||||||||||||||
Sbjct: 90 attaataagtttatgaatta 71



to top

>gb|AC147092.3| Pan troglodytes BAC clone RP43-55E11 from 7, complete sequence
          Length = 153171

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 25414 gctttgcagggttcagcccc 25395



to top

>gb|AC112143.5| Mus musculus BAC clone RP23-29E2 from chromosome 2, complete sequence
          Length = 205920

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   gaaaccatggagcaaaaaca 178
             ||||||||||||||||||||
Sbjct: 14976 gaaaccatggagcaaaaaca 14995



to top

>ref|XM_752668.1| Ustilago maydis 521 hypothetical protein (UM01614.1) partial mRNA
          Length = 2748

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 348  cagcttgaactcgtcgttga 367
            ||||||||||||||||||||
Sbjct: 2397 cagcttgaactcgtcgttga 2378



to top

>gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome 13, complete sequence
          Length = 193255

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 92    tctggtagcaattattcact 111
             ||||||||||||||||||||
Sbjct: 58490 tctggtagcaattattcact 58509



to top

>gb|AC092989.6| Homo sapiens 3 BAC RP11-237P21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168492

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 323    agttcttgatggtgtggcagcggtacag 350
              ||||| |||||||||||||| |||||||
Sbjct: 150708 agttcatgatggtgtggcagtggtacag 150681



to top

>gb|AC006000.3| Homo sapiens PAC clone RP4-741M6 from 7, complete sequence
          Length = 124170

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 25195 gctttgcagggttcagcccc 25214



to top

>ref|XM_662081.1| Cryptosporidium hominis TU502 WD repeat protein (Chro.20305) partial
            mRNA
          Length = 3018

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 166  tggagcaaaaacaaaccaaa 185
            ||||||||||||||||||||
Sbjct: 1929 tggagcaaaaacaaaccaaa 1948



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 255     gagctgcagcttctttattg 274
               ||||||||||||||||||||
Sbjct: 3421882 gagctgcagcttctttattg 3421901



to top

>emb|CR383667.11| Zebrafish DNA sequence from clone CH211-229P19 in linkage group 10,
            complete sequence
          Length = 121560

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 206  tccgacatctccacgggggaagac 229
            |||| |||||||||||||||||||
Sbjct: 8414 tccgtcatctccacgggggaagac 8391



to top

>gb|AC138015.24| Medicago truncatula clone mth2-34m6, complete sequence
          Length = 126845

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    gaaccaccaaactagataca 74
             ||||||||||||||||||||
Sbjct: 36796 gaaccaccaaactagataca 36815



to top

>gb|AC090618.11| Homo sapiens chromosome 17, clone RP11-763E3, complete sequence
          Length = 195031

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 55609 gctttgcagggttcagcccc 55628



to top

>emb|AL929302.16| Human DNA sequence from clone RP11-716A19 on chromosome X Contains the 3'
              end of the CXorf15 gene for chromosome X open reading frame
              15, the RBBP7 gene for retinoblastoma binding protein 7,
              the 5' end of the REPS2 gene for RALBP1 associated Eps
              domain containing 2, a novel pseudogene and four CpG
              islands, complete sequence
          Length = 172614

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 128817 gctttgcagggttcagcccc 128836



to top

>emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chromosome 1 Contains the
             3' end of the NEGR1 gene for neuronal growth regulator 1
             and a novel gene, complete sequence
          Length = 93633

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 10834 gctttgcagggttcagcccc 10815



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 321    gcagttcttgatggtgtggcagcg 344
              ||||||| ||||||||||||||||
Sbjct: 552269 gcagttcatgatggtgtggcagcg 552292



to top

>gb|BT010276.1| Drosophila melanogaster RE08772 full insert cDNA
          Length = 3821

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 346  tacagcttgaactcgtcgtt 365
            ||||||||||||||||||||
Sbjct: 1071 tacagcttgaactcgtcgtt 1052



to top

>emb|AL356603.11| Human DNA sequence from clone RP11-500B2 on chromosome 10 Contains part
             of the INPP5A gene for inositol
             polyphosphate-5-phosphatase 40kDa and two CpG islands,
             complete sequence
          Length = 112648

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 54516 gctttgcagggttcagcccc 54535



to top

>emb|AL353790.15| Human DNA sequence from clone RP11-337N19 on chromosome 10 Contains an
             S-adenosylmethionine decarboxylase proenzyme (AdoMetDC)
             (SamDC) pseudogene, complete sequence
          Length = 119555

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 31484 gctttgcagggttcagcccc 31503



to top

>emb|AL353707.14| Human DNA sequence from clone RP11-553J6 on chromosome 9 Contains a
             ribosomal protein S19 (RPS19) pseudogene, complete
             sequence
          Length = 125373

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 24852 gctttgcagggttcagcccc 24833



to top

>emb|AL158194.16| Human DNA sequence from clone RP11-429E17 on chromosome 13q13.1-14.2
             Contains part of the LHFP gene for lipoma HMGIC fusion
             partner, complete sequence
          Length = 177019

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 84576 gctttgcagggttcagcccc 84557



to top

>emb|AL158070.11| Human DNA sequence from clone RP11-235C23 on chromosome 9q31.1-31.3
             Contains part of a pseudogene similar to KIAA1272,
             KIAA0884, Drosophila CG5521 and rat Tulip 1 and 2
             proteins, the 3' end of the CSDUFD1 gene for cystatin and
             DUF19 domain containing 1, a novel gene, the FCMD gene for
             Fukuyama type congenital muscular dystrophy protein, the
             TAL2 gene for T-cell acute lymphocytic leukemia 2 protein
             and two CpG islands, complete sequence
          Length = 167005

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 71022 gctttgcagggttcagcccc 71041



to top

>gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, complete sequence
          Length = 63480

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 20753 gctttgcagggttcagcccc 20772



to top

>emb|AL139233.8| Human DNA sequence from clone RP1-44A19 on chromosome 6q15-16.2,
             complete sequence
          Length = 105596

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 38823 gctttgcagggttcagcccc 38842



to top

>emb|AL121968.10|HSJ196B13 Human DNA sequence from clone RP1-196B13 on chromosome 6q22.2-22.33
             Contains part of the TCBA1 gene for T-cell lymphoma
             breakpoint associated target 1, complete sequence
          Length = 124219

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     ttaataagtttatgaattac 28
             ||||||||||||||||||||
Sbjct: 13864 ttaataagtttatgaattac 13845



to top

>emb|AL121942.9|HSDJ249N8 Human DNA sequence from clone RP1-249N8 on chromosome 6q14.3-16.1,
             complete sequence
          Length = 83909

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 70912 gctttgcagggttcagcccc 70931



to top

>emb|AL050403.16|HSDJ697P8 Human DNA sequence from clone RP4-697P8 on chromosome 20 Contains two
              novel genes and the FAT1P1 gene for FAT tumour suppressor
              homolog 1 (Drosophila) pseudogene 1, complete sequence
          Length = 144924

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    catggagcaaaaacaaacca 183
              ||||||||||||||||||||
Sbjct: 111374 catggagcaaaaacaaacca 111355



to top

>gb|AY123036.1| Arabidopsis thaliana putative succinate dehydrogenase iron-protein
           subunit (At5g40650) mRNA, complete cds
          Length = 874

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 gtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgctcctttgtgaac 393
           |||||||| || ||||| |||||||| ||||  ||||  ||||| |  ||||| ||| ||
Sbjct: 755 gtgtggcatcgatacagtttgaactcatcgtcaatggcttcaagtctttccttagtgtac 696

                                                   
Query: 394 tcatcacggctgtcttggatccacctgttggcatggagca 433
           ||||| ||||| ||    ||||||||||||||||| ||||
Sbjct: 695 tcatctcggctatcacttatccacctgttggcatgaagca 656



to top

>gb|AY074299.1| Arabidopsis thaliana putative succinate dehydrogenase iron-protein
           subunit (At5g40650) mRNA, complete cds
          Length = 1043

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 gtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgctcctttgtgaac 393
           |||||||| || ||||| |||||||| ||||  ||||  ||||| |  ||||| ||| ||
Sbjct: 761 gtgtggcatcgatacagtttgaactcatcgtcaatggcttcaagtctttccttagtgtac 702

                                                   
Query: 394 tcatcacggctgtcttggatccacctgttggcatggagca 433
           ||||| ||||| ||    ||||||||||||||||| ||||
Sbjct: 701 tcatctcggctatcacttatccacctgttggcatgaagca 662



to top

>gb|AY063053.1| Arabidopsis thaliana putative succinate dehydrogenase iron-protein
           subunit (At3g27380) mRNA, complete cds
          Length = 871

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 755 tggcaacggtaaagcttgaactcgtcgt 728



to top

>gb|AY035013.1| Arabidopsis thaliana putative succinate dehydrogenase iron-protein
           subunit (At3g27380) mRNA, complete cds
          Length = 1125

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 775 tggcaacggtaaagcttgaactcgtcgt 748



to top

>emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genome; segment 1/16
          Length = 349315

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 321    gcagttcttgatggtgtggcagcg 344
              ||||||| ||||||||||||||||
Sbjct: 241243 gcagttcatgatggtgtggcagcg 241266



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 41     catcaaaatatgatgaaccaccaaacta 68
              |||||||||||| |||| ||||||||||
Sbjct: 317332 catcaaaatatgttgaatcaccaaacta 317359



to top

>gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosome 7, complete sequence
          Length = 213870

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     attaataagtttatgaatta 27
             ||||||||||||||||||||
Sbjct: 42564 attaataagtttatgaatta 42583



to top

>emb|AJ278911.1|ATH278911 Arabidopsis thaliana mRNA for mitochondrial succinate dehydrogenase
           iron-sulphur subunit (sdh2-2 gene)
          Length = 1031

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 gtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgctcctttgtgaac 393
           |||||||| || ||||| |||||||| ||||  ||||  ||||| |  ||||| ||| ||
Sbjct: 765 gtgtggcatcgatacagtttgaactcatcgtcaatggcttcaagtctttccttagtgtac 706

                                                   
Query: 394 tcatcacggctgtcttggatccacctgttggcatggagca 433
           ||||| ||||| ||    ||||||||||||||||| ||||
Sbjct: 705 tcatctcggctatcacttatccacctgttggcatgaagca 666



to top

>emb|AJ278910.1|ATH278910 Arabidopsis thaliana mRNA for mitochondrial succinate dehydrogenase
           iron-sulphur subunit (sdh2-1 gene)
          Length = 1085

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 767 tggcaacggtaaagcttgaactcgtcgt 740



to top

>gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 212172

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    gggaagaccctgctctgctc 241
              ||||||||||||||||||||
Sbjct: 114223 gggaagaccctgctctgctc 114242



to top

>gb|BC065992.1| Danio rerio zgc:77067, mRNA (cDNA clone MGC:77067 IMAGE:6960102),
           complete cds
          Length = 1418

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 206 tccgacatctccacgggggaagac 229
           |||| |||||||||||||||||||
Sbjct: 119 tccgtcatctccacgggggaagac 96



to top

>gb|AC021311.8| Homo sapiens chromosome 8, clone RP11-697L23, complete sequence
          Length = 151778

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 51723 gctttgcagggttcagcccc 51704



to top

>gb|AC007110.3| Homo sapiens chromosome 6, clone hRPK.472_J_18, complete sequence
          Length = 148336

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 17136 gctttgcagggttcagcccc 17155



to top

>gb|AC055782.9| Homo sapiens chromosome 15, clone RP11-528P19, complete sequence
          Length = 172697

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 139134 gctttgcagggttcagcccc 139115



to top

>gb|AC103592.2| Homo sapiens chromosome 1 clone RP11-335E14, complete sequence
          Length = 197372

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 98528 gctttgcagggttcagcccc 98547



to top

>gb|AC024375.13| Homo sapiens chromosome 15, clone RP11-572A8, complete sequence
          Length = 163775

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 13902 gctttgcagggttcagcccc 13883



to top

>gb|AC100812.2| Homo sapiens chromosome 8, clone CTD-2532N20, complete sequence
          Length = 209123

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 141847 gctttgcagggttcagcccc 141828



to top

>gb|AC022420.6| Homo sapiens chromosome 5 clone CTD-2040G12, complete sequence
          Length = 91924

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  gctttgcagggttcagcccc 303
            ||||||||||||||||||||
Sbjct: 7461 gctttgcagggttcagcccc 7442



to top

>gb|AC143337.27| Medicago truncatula clone mth2-35d19, complete sequence
          Length = 118139

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    gaaccaccaaactagataca 74
             ||||||||||||||||||||
Sbjct: 98127 gaaccaccaaactagataca 98108



to top

>gb|AC015922.17| Homo sapiens chromosome 17, clone CTD-3157E16, complete sequence
          Length = 166584

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    tctgctttgcagggttcagc 300
              ||||||||||||||||||||
Sbjct: 150239 tctgctttgcagggttcagc 150258



to top

>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 183896

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 150319 gctttgcagggttcagcccc 150300



to top

>gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, complete sequence
          Length = 84991

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   ctttgcagggttcagcccct 304
             ||||||||||||||||||||
Sbjct: 38831 ctttgcagggttcagcccct 38850



to top

>ref|NM_138055.1| Drosophila melanogaster CG30419-RA (CG30419), mRNA
          Length = 1232

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 346  tacagcttgaactcgtcgtt 365
            ||||||||||||||||||||
Sbjct: 1072 tacagcttgaactcgtcgtt 1053



to top

>gb|AC069540.6| Homo sapiens chromosome 10 clone RP11-344L13, complete sequence
          Length = 201182

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 101326 gctttgcagggttcagcccc 101345



to top

>gb|AC182474.3| Pan troglodytes BAC clone CH251-134M22 from chromosome 1, complete
              sequence
          Length = 152000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 141420 gctttgcagggttcagcccc 141401



to top

>gb|AC007538.5| Homo sapiens Xq28 PAC RPCI6-224C24 (Roswell Park Cancer Institute Human
              PAC Library) complete sequence
          Length = 178544

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 142583 gctttgcagggttcagcccc 142602



to top

>gb|AC097654.2| Homo sapiens BAC clone RP11-280K20 from 4, complete sequence
          Length = 163088

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 71737 gctttgcagggttcagcccc 71756



to top

>gb|DQ123841.1| Agrotis segetum nucleopolyhedrovirus, complete genome
          Length = 147544

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gataataattaataagttta 20
            ||||||||||||||||||||
Sbjct: 9476 gataataattaataagttta 9457



to top

>ref|XM_939290.1| PREDICTED: Homo sapiens hypothetical protein LOC650204 (LOC650204),
           mRNA
          Length = 306

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 gctttgcagggttcagcccc 303
           ||||||||||||||||||||
Sbjct: 176 gctttgcagggttcagcccc 157



to top

>ref|XM_928326.1| PREDICTED: Homo sapiens hypothetical protein LOC645283 (LOC645283),
           mRNA
          Length = 306

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 gctttgcagggttcagcccc 303
           ||||||||||||||||||||
Sbjct: 176 gctttgcagggttcagcccc 157



to top

>ref|XM_685575.1| PREDICTED: Danio rerio similar to nudC domain containing 3
           (LOC573178), mRNA
          Length = 829

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 206 tccgacatctccacgggggaagac 229
           |||| |||||||||||||||||||
Sbjct: 159 tccgtcatctccacgggggaagac 136



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 321     gcagttcttgatggtgtggcagcg 344
               ||||||| ||||||||||||||||
Sbjct: 2467105 gcagttcatgatggtgtggcagcg 2467082



to top

>gb|AC034242.6| Homo sapiens chromosome 5 clone CTD-2514M18, complete sequence
          Length = 221452

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 145193 gctttgcagggttcagcccc 145212



to top

>ref|XM_626488.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_2910),
            partial mRNA
          Length = 3012

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 166  tggagcaaaaacaaaccaaa 185
            ||||||||||||||||||||
Sbjct: 1929 tggagcaaaaacaaaccaaa 1948



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 321    gcagttcttgatggtgtggcagcg 344
              ||||||| ||||||||||||||||
Sbjct: 368858 gcagttcatgatggtgtggcagcg 368881



to top

>gb|AC009460.4|AC009460 Drosophila melanogaster, chromosome 2R, region 60B-60C, BAC clone
             BACR04P18, complete sequence
          Length = 159455

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 346   tacagcttgaactcgtcgtt 365
             ||||||||||||||||||||
Sbjct: 38087 tacagcttgaactcgtcgtt 38106



to top

>gb|AC012167.5|AC012167 Drosophila melanogaster, chromosome 2R, region 60B-60C, BAC clone
              BACR27M17, complete sequence
          Length = 164443

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    tacagcttgaactcgtcgtt 365
              ||||||||||||||||||||
Sbjct: 158692 tacagcttgaactcgtcgtt 158711



to top

>emb|BX005394.8| Zebrafish DNA sequence from clone DKEY-3N15 in linkage group 3,
             complete sequence
          Length = 190575

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    aagtttatgaattacttcat 33
             ||||||||||||||||||||
Sbjct: 39925 aagtttatgaattacttcat 39944



to top

>emb|BX822750.1|CNS0A7S4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 841

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 526 tggcaacggtaaagcttgaactcgtcgt 499



to top

>gb|AC013722.8| Homo sapiens BAC clone RP11-299H21 from 2, complete sequence
          Length = 207576

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 79525 gctttgcagggttcagcccc 79506



to top

>gb|AC013429.12|AC013429 Homo sapiens chromosome 7 clone RP11-199L18, complete sequence
          Length = 179623

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 144423 gctttgcagggttcagcccc 144404



to top

>gb|AC083863.2|AC083863 Homo sapiens chromosome 7 clone RP11-162O1, complete sequence
          Length = 179488

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 285    ctttgcagggttcagcccct 304
              ||||||||||||||||||||
Sbjct: 128517 ctttgcagggttcagcccct 128498



to top

>gb|AC008265.15|AC008265 Homo sapiens chromosome 7 clone RP11-256C24, complete sequence
          Length = 170537

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 102185 gctttgcagggttcagcccc 102204



to top

>gb|AC019178.7| Homo sapiens BAC clone RP11-235L22 from 2, complete sequence
          Length = 107330

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 47879 gctttgcagggttcagcccc 47860



to top

>gb|AY087504.1| Arabidopsis thaliana clone 36094 mRNA, complete sequence
          Length = 1133

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                       
Query: 334 gtgtggcagcggtacagcttgaactcgtcgttgatggagtcaaggcgctcctttgtgaac 393
           |||||||| || ||||| |||||||| ||||  ||||  ||||| |  ||||| ||| ||
Sbjct: 813 gtgtggcatcgatacagtttgaactcatcgtcaatggcttcaagtctttccttagtgtac 754

                                                   
Query: 394 tcatcacggctgtcttggatccacctgttggcatggagca 433
           ||||| ||||| ||    ||||||||||||||||| ||||
Sbjct: 753 tcatctcggctatcacttatccacctgttggcatgaagca 714



to top

>gb|AY086901.1| Arabidopsis thaliana clone 2924 mRNA, complete sequence
          Length = 1110

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 337 tggcagcggtacagcttgaactcgtcgt 364
           ||||| ||||| ||||||||||||||||
Sbjct: 841 tggcaacggtaaagcttgaactcgtcgt 814



to top

>gb|AC135628.8| Homo sapiens chromosome 15, clone RP11-883G10, complete sequence
          Length = 137088

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 27456 gctttgcagggttcagcccc 27437



to top

>gb|AC104777.7| Homo sapiens BAC clone RP11-22J23 from 2, complete sequence
          Length = 110895

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   gctttgcagggttcagcccc 303
             ||||||||||||||||||||
Sbjct: 17523 gctttgcagggttcagcccc 17542



to top

>gb|AC074338.1|AC074338 Human Chromosome 7 clone RP11-81O10, complete sequence
          Length = 164192

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 285   ctttgcagggttcagcccct 304
             ||||||||||||||||||||
Sbjct: 36303 ctttgcagggttcagcccct 36284



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 41     catcaaaatatgatgaaccaccaaacta 68
              |||||||||||| |||| ||||||||||
Sbjct: 318687 catcaaaatatgttgaatcaccaaacta 318714



to top

>dbj|BS000052.1| Pan troglodytes chromosome 22 clone:RP43-049N07, map 22, complete
              sequences
          Length = 180152

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    gctttgcagggttcagcccc 303
              ||||||||||||||||||||
Sbjct: 160511 gctttgcagggttcagcccc 160492


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,515,787
Number of Sequences: 3902068
Number of extensions: 4515787
Number of successful extensions: 117892
Number of sequences better than 10.0: 270
Number of HSP's better than 10.0 without gapping: 266
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 117011
Number of HSP's gapped (non-prelim): 876
length of query: 473
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 451
effective length of database: 17,147,199,772
effective search space: 7733387097172
effective search space used: 7733387097172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top