>emb|BX255910.3| Mouse DNA sequence from clone RP23-398G11 on chromosome 11 Contains a
              novel gene and the 3' end of the gene for a novel protein
              (E030025D05Rik), complete sequence
          Length = 179386

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 43     gattattgctgaaaatggccttacac 68
              ||||||||||||| ||||||||||||
Sbjct: 158088 gattattgctgaagatggccttacac 158113

>gb|AF043703.2| Caenorhabditis elegans cosmid W10C8, complete sequence
          Length = 36748

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 33    gaaatttacggattattgctgaaaat 58
             |||||| |||||||||||||||||||
Sbjct: 13217 gaaattgacggattattgctgaaaat 13192

>gb|AC084375.11| Homo sapiens 12 BAC RP11-664D1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 125742

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 66    cacacagatcaagggaagaagtgct 90
             |||||||||||| ||||||||||||
Sbjct: 46361 cacacagatcaaaggaagaagtgct 46385

>gb|AC012599.9| Homo sapiens 12 PAC RP5-1185J21 (Roswell Park Cancer INstitute Human
             PAC Library) complete sequence
          Length = 98027

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 66    cacacagatcaagggaagaagtgct 90
             |||||||||||| ||||||||||||
Sbjct: 18630 cacacagatcaaaggaagaagtgct 18654

>emb|CR387927.9| Zebrafish DNA sequence from clone CH211-260P11 in linkage group 14,
             complete sequence
          Length = 149672

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    agaagtgcttttagttcaat 101
             ||||||||||||||||||||
Sbjct: 34813 agaagtgcttttagttcaat 34794

>dbj|AP003124.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-447G14, complete
             sequence
          Length = 177483

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   gagaggggggaaaaagactt 129
             ||||||||||||||||||||
Sbjct: 85471 gagaggggggaaaaagactt 85452


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,531,479
Number of Sequences: 3902068
Number of extensions: 1531479
Number of successful extensions: 99321
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99310
Number of HSP's gapped (non-prelim): 11
length of query: 209
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 187
effective length of database: 17,147,199,772
effective search space: 3206526357364
effective search space used: 3206526357364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)