ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart28h11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds 355 8e-95
2gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, com... 353 3e-94
3gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds 321 1e-84
4emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansi... 220 3e-54
5gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, com... 202 7e-49
6gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds 202 7e-49
7gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds 194 2e-46
8gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, co... 180 3e-42
9ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-exp... 172 6e-40
10gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete... 172 6e-40
11gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno... 172 6e-40
12dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 172 6e-40
13dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
14dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
15dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
16dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
17dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 6e-40
18gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 172 6e-40
19gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence 159 1e-35
20gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, co... 159 1e-35
21gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence 151 2e-33
22emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansi... 151 2e-33
23gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, pa... 147 4e-32
24ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-exp... 143 6e-31
25gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete... 143 6e-31
26gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen... 143 6e-31
27gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, pa... 143 6e-31
28dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
29dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
30dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
31dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
32ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-exp... 141 2e-30
33gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete... 141 2e-30
34dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
35dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
36gb|AY111405.1| Zea mays CL5426_1 mRNA sequence 127 3e-26
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 123 5e-25
38gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 123 5e-25
39gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 123 5e-25
40dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
41gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 123 5e-25
42dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
43gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete... 119 8e-24
44dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
45dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 5e-19
46gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds 96 1e-16
47gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, pa... 94 5e-16
48gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, co... 92 2e-15
49gb|AY104151.1| Zea mays PCO112411 mRNA sequence 92 2e-15
50gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds 92 2e-15
51gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, com... 76 1e-10
52gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, com... 72 2e-09
53emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 prote... 70 7e-09
54gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence 66 1e-07
55gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 ge... 66 1e-07
56gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 ge... 66 1e-07
57gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 ge... 66 1e-07
58gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 ge... 66 1e-07
59gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 ge... 66 1e-07
60gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 ge... 66 1e-07
61gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 ge... 66 1e-07
62gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 ge... 66 1e-07
63gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 ge... 66 1e-07
64gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 ge... 66 1e-07
65gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 ge... 66 1e-07
66gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 ge... 66 1e-07
67gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 ge... 66 1e-07
68gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 ge... 66 1e-07
69gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 ge... 66 1e-07
70gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 ge... 66 1e-07
71gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 geno... 66 1e-07
72gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, parti... 66 1e-07
73gb|AY112069.1| Zea mays CL35761_1 mRNA sequence 66 1e-07
74ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-exp... 58 3e-05
75gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, com... 58 3e-05
76dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
77dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
78dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
79gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds 58 3e-05
80gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, co... 54 4e-04
81gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog m... 54 4e-04
82gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds 52 0.002
83ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-exp... 52 0.002
84gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete... 52 0.002
85gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, c... 52 0.002
86gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, c... 52 0.002
87gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 geno... 52 0.002
88dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
89dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
90gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, c... 50 0.006
91gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, c... 50 0.006
92gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, p... 50 0.006
93gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB... 50 0.006
94gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, co... 50 0.006
95gb|AY103636.1| Zea mays PCO124530 mRNA sequence 50 0.006
96emb|BX294387.11| Zebrafish DNA sequence from clone DKEY-267L16 i... 44 0.39
97dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, parti... 44 0.39
98gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 42 1.6
99gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 42 1.6
100emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansi... 42 1.6
101gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXP... 42 1.6
102emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome... 42 1.6
103emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 42 1.6
104gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet... 42 1.6
105gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds 42 1.6
106gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds 42 1.6
107gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.2
108gb|AY172516.1| Rhizobium etli transcription repair coupling fact... 40 6.2
109gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 6.2
110gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.2
111gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 40 6.2
112gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.2
113emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in ... 40 6.2
114gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 40 6.2
115gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 ... 40 6.2
116gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-... 40 6.2
117gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-... 40 6.2
118gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.2
119gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type... 40 6.2 
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds
          Length = 810

 Score =  355 bits (179), Expect = 8e-95
 Identities = 182/183 (99%)
 Strand = Plus / Minus

                                                                       
Query: 275 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 334
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 810 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 751

                                                                       
Query: 335 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 394
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 691

                                                                       
Query: 395 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 454
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 690 gcctggaggcggtggccggagtccagccgccagatggatccccacgactcgcgcatcggc 631

              
Query: 455 gtc 457
           |||
Sbjct: 630 gtc 628
to top
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds
          Length = 897

 Score =  353 bits (178), Expect = 3e-94
 Identities = 227/243 (93%), Gaps = 9/243 (3%)
 Strand = Plus / Minus

                                                                       
Query: 222 gataccaaatccagccaatgtatgcatatgattccaaatgatga-------tgagttcag 274
           ||||||||||| |||||||| ||||||  |||||||||||||||       | |||||||
Sbjct: 895 gataccaaatcaagccaatgcatgcat--gattccaaatgatgagttcggttcagttcag 838

                                                                       
Query: 275 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 334
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 837 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 778

                                                                       
Query: 335 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 394
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 777 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 718

                                                                       
Query: 395 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 454
           ||||||||||||||||||||||| ||||||||||| || ||||| |||||||||||||||
Sbjct: 717 gcctggaggcggtggccggagtcgagccgccagatggagccccatgactcgcgcatcggc 658

              
Query: 455 gtc 457
           |||
Sbjct: 657 gtc 655
to top
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds
          Length = 834

 Score =  321 bits (162), Expect = 1e-84
 Identities = 183/190 (96%)
 Strand = Plus / Minus

                                                                       
Query: 268 agttcagcagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagtt 327
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 823 agttcagcagcttcagctgtactggacgatggaacggtagaaggtgctgggcgcccagtt 764

                                                                       
Query: 328 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 387
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 763 ggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgatgcgcatgga 704

                                                                       
Query: 388 gaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcg 447
           |||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||||||
Sbjct: 703 gaagggcgcctggaggcggtggccagagtcgagccgccagatggagccccatgactcgcg 644

                     
Query: 448 catcggcgtc 457
           ||||||||||
Sbjct: 643 catcggcgtc 634
to top
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene)
          Length = 1219

 Score =  220 bits (111), Expect = 3e-54
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                       
Query: 275 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 334
           |||| ||||||| |||||||||||||||||||| ||| |||||| ||||| |||||||||
Sbjct: 911 cagcctcagctgaactggacgatggagcggtaggaggcgctgggggcccaattggccggg 852

                                                                       
Query: 335 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 394
           |||| ||||||||| || |||  |||||||||||||||||||||||||||||||||||||
Sbjct: 851 atgatcttgtcggcgacgagctgcttgccggactcgttggtgatgcgcatggagaagggc 792

                                                                       
Query: 395 gcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggc 454
           |||||||||||||||  ||||||||  |||||||| |||||||||||||| | |||||||
Sbjct: 791 gcctggaggcggtggttggagtccatgcgccagatggatccccacgactccctcatcggc 732

              
Query: 455 gtc 457
           |||
Sbjct: 731 gtc 729



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 43/48 (89%), Gaps = 4/48 (8%)
 Strand = Plus / Minus

                                                            
Query: 115  tattcaagacacacatgca----cgacgacgcctacatgacacccgac 158
            |||| ||||||||||||||    |||||||||||||||||||||||||
Sbjct: 1072 tattgaagacacacatgcaggatcgacgacgcctacatgacacccgac 1025



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 11   acacacaaacagtaataacttatgat 36
            |||||||||| |||||||||||||||
Sbjct: 1186 acacacaaactgtaataacttatgat 1161
to top
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds
          Length = 1013

 Score =  202 bits (102), Expect = 7e-49
 Identities = 159/178 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 339
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 859 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 800

                                                                       
Query: 340 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 399
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 799 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 740

                                                                     
Query: 400 gaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||||  |||||||| ||||||||| || ||||| ||||||||||||||||||
Sbjct: 739 gaggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtc 682
to top
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds
          Length = 1056

 Score =  202 bits (102), Expect = 7e-49
 Identities = 159/178 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgac 339
           ||||||| ||||||||| ||||||||||  |||| |||||  ||||||||||||||||||
Sbjct: 891 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 832

                                                                       
Query: 340 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 399
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 831 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 772

                                                                     
Query: 400 gaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||||  |||||||| ||||||||| || ||||| ||||||||||||||||||
Sbjct: 771 gaggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtc 714
to top
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds
          Length = 948

 Score =  194 bits (98), Expect = 2e-46
 Identities = 149/166 (89%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||
Sbjct: 882 ttcagctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatga 823

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||| ||| || |||||||||||||||||||||  |||||| ||||||||||||||||
Sbjct: 822 ccttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcgcct 763

                                                         
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactc 444
           |||||||||||  |||||| || |||||||  || |||||||||||
Sbjct: 762 ggaggcggtggttggagtcgaggcgccagacggagccccacgactc 717
to top
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds
          Length = 1173

 Score =  180 bits (91), Expect = 3e-42
 Identities = 151/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 287 tactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcg 346
           ||||||||||| || |||||| ||||| ||||| |||||||||| |||||||| | ||| 
Sbjct: 867 tactggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtca 808

                                                                       
Query: 347 gccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcgg 406
           |||||||||||||||||||||||||| || ||||||| |||||| |||||   |||||||
Sbjct: 807 gccaccagcgtcttgccggactcgttcgtaatgcgcagggagaatggcgcggtgaggcgg 748

                                                              
Query: 407 tggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||||| |||| |||||| |||||||| ||||||||||||||||||
Sbjct: 747 tggccggagtcgagcctccagatggatccccaggactcgcgcatcggcgtc 697
to top
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4
           (OSJNBa0010C11.2), mRNA
          Length = 1340

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 969 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 910

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 909 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 850

                                                                      
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 849 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 791
to top
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds
          Length = 1249

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 925 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 866

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 865 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 806

                                                                      
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 805 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 747
to top
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                         
Query: 279   ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
             |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 16771 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 16712

                                                                         
Query: 339   ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
             | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 16711 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 16652

                                                                        
Query: 399   ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
             |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 16651 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 16593



 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Plus

                                                                        
Query: 283  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 4068 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 4127

                                                                        
Query: 343  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 4128 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 4187

                                                                   
Query: 403  gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 4188 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 4242
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                            
Query: 279      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21341758 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21341699

                                                                            
Query: 339      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21341698 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21341639

                                                                           
Query: 399      ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 21341638 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 21341580



 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Plus

                                                                            
Query: 282      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21311303 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21311362

                                                                            
Query: 342      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21311363 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21311422

                                                                        
Query: 402      ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 21311423 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 21311478



 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Plus

                                                                            
Query: 283      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21329054 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21329113

                                                                            
Query: 343      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21329114 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21329173

                                                                       
Query: 403      gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 21329174 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 21329228



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                            
Query: 322      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21317205 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21317264

                                                                         
Query: 382      catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
                 | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 21317265 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 21317321



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 357      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20947292 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20947251
to top
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full
           insert sequence
          Length = 1290

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 982 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 923

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 922 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 863

                                                                      
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 862 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 804
to top
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full
           insert sequence
          Length = 1266

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 975 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 916

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 915 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 856

                                                                      
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 855 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 797
to top
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full
            insert sequence
          Length = 1883

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                        
Query: 279  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1559 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1500

                                                                        
Query: 339  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1499 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1440

                                                                       
Query: 399  ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 1439 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 1381
to top
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full
            insert sequence
          Length = 1475

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                        
Query: 279  ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
            |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 1163 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1104

                                                                        
Query: 339  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1103 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1044

                                                                       
Query: 399  ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 1043 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 985
to top
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full
           insert sequence
          Length = 1293

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
           |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 981 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 922

                                                                       
Query: 339 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 921 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 862

                                                                      
Query: 399 ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 861 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 803
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  172 bits (87), Expect = 6e-40
 Identities = 156/179 (87%)
 Strand = Plus / Minus

                                                                            
Query: 279      ttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatga 338
                |||||||||||||||||| |||||||||||| ||| |||||  |||||||||||||||||
Sbjct: 21353021 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21352962

                                                                            
Query: 339      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21352961 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21352902

                                                                           
Query: 399      ggaggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                |||| | ||||  || |||||||| |||||| || ||||||||||| | ||||||||||
Sbjct: 21352901 ggagcctgtggttggtgtccagcctccagatggagccccacgactccctcatcggcgtc 21352843



 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Plus

                                                                            
Query: 282      agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
                ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 21322567 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21322626

                                                                            
Query: 342      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21322627 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21322686

                                                                        
Query: 402      ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 21322687 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 21322742



 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Plus

                                                                            
Query: 283      gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
                ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 21340318 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21340377

                                                                            
Query: 343      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21340378 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21340437

                                                                       
Query: 403      gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
                |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 21340438 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 21340492



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                            
Query: 322      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21328469 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21328528

                                                                         
Query: 382      catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
                 | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 21328529 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 21328585



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 357      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20958556 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20958515
to top
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence
          Length = 832

 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 303 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 244

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 243 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 184

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||||||  || |||||  |||||||  || ||||| ||||||||||||||||||
Sbjct: 183 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtc 128
to top
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds
          Length = 1479

 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 939 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 880

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 879 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 820

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||||||  || |||||  |||||||  || ||||| ||||||||||||||||||
Sbjct: 819 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtc 764
to top
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence
          Length = 1044

 Score =  151 bits (76), Expect = 2e-33
 Identities = 151/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||||||||||||| |||||||||||||||| ||||   |||||||||||||||||| |
Sbjct: 564 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 505

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || ||||||||| |||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 504 tgttggcgacgagcgtcttggcggactcgttgcggatgcggatggagaagggcggctgca 445

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||||||  || |||||  |||||||  || ||||| ||||||||||||||||||
Sbjct: 444 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcgtc 389
to top
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene)
          Length = 1194

 Score =  151 bits (76), Expect = 2e-33
 Identities = 145/168 (86%)
 Strand = Plus / Minus

                                                                       
Query: 288 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
           ||||||||| ||||||||||  |||| |||||  |||||||||||||||||  |||| ||
Sbjct: 884 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgatgttgttgg 825

                                                                       
Query: 348 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
           | || |||  ||||||||| ||| ||||||||||||||||||| ||||||||||| ||||
Sbjct: 824 cgacgagctgcttgccggagtcgctggtgatgcgcatggagaatggcgcctggagacggt 765

                                                           
Query: 408 ggccggagtccagccgccagattgatccccacgactcgcgcatcggcg 455
           ||  |||||||| || |||||| ||||||||||||||| |||||||||
Sbjct: 764 ggttggagtccatcctccagatggatccccacgactcgtgcatcggcg 717
to top
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds
          Length = 907

 Score =  147 bits (74), Expect = 4e-32
 Identities = 149/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||||||||||||| |||||||||||||||| |||||  |||||||||||||||||| |
Sbjct: 526 agctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgt 467

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           |   ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 466 tcctggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 407

                                                                 
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcg 455
            |||||||  || |||||  |||||||  || ||||| ||||||||||||||||
Sbjct: 406 tgcggtggttggtgtccatgcgccagacggagccccaggactcgcgcatcggcg 353
to top
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6
           (OSJNBb0014I11.3), mRNA
          Length = 1240

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 922 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 863

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 862 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 803

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 802 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 747
to top
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds
          Length = 1250

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 915 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 856

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 855 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 796

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 795 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 740
to top
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete
             sequence
          Length = 135510

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                         
Query: 282   agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
             ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 23056 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 22997

                                                                         
Query: 342   tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
             ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 22996 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 22937

                                                                     
Query: 402   ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
             ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 22936 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 22881



 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                        
Query: 283  gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
            ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 5305 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 5246

                                                                        
Query: 343  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 5245 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 5186

                                                                   
Query: 403  gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 5185 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 5131



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                         
Query: 322   ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
             |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 17154 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 17095

                                                                      
Query: 382   catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
              | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 17094 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 17038
to top
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds
          Length = 650

 Score =  143 bits (72), Expect = 6e-31
 Identities = 147/172 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
           |||||| | ||||||||||||| ||||| |||||||||||||||| |||||||||     
Sbjct: 529 gtactgaatgatggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagt 470

                                                                       
Query: 346 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
           |||||||||| || |||||||||||||||||| |||||  |||||||||||||| || | 
Sbjct: 469 ggccaccagcttcctgccggactcgttggtgacgcgcagcgagaagggcgcctgtagcct 410

                                                               
Query: 406 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||  || |||||||| |||||| || ||||| ||||||||||||||||||
Sbjct: 409 gtggttggcgtccagcctccagatggacccccaggactcgcgcatcggcgtc 358
to top
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full
           insert sequence
          Length = 1257

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 760
to top
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full
           insert sequence
          Length = 1257

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 760
to top
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full
           insert sequence
          Length = 1263

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 941 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 882

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 881 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 822

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 821 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 766
to top
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full
           insert sequence
          Length = 1259

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 agctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacct 341
           ||||| ||||||||||||||||||||  || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 342 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 401
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                                                                   
Query: 402 ggcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||  |||||| || |||||||| || ||||||||||| | ||||||||||
Sbjct: 815 ggcggtggttggagtcgaggcgccagatggagccccacgactccctcatcggcgtc 760
to top
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3
           (OSJNBb0014I11.1), mRNA
          Length = 904

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 898 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 839

                                                                       
Query: 343 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 838 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 779

                                                                  
Query: 403 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 778 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 724
to top
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds
          Length = 1319

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 897 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 838

                                                                       
Query: 343 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 837 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 778

                                                                  
Query: 403 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 777 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 723
to top
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full
           insert sequence
          Length = 1031

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 653 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 594

                                                                       
Query: 343 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 593 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 534

                                                                  
Query: 403 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 533 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 479
to top
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full
           insert sequence
          Length = 1313

 Score =  141 bits (71), Expect = 2e-30
 Identities = 149/175 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgacctt 342
           ||||||||||||||  || ||||||| ||   |||| |||||||||||||||||||||| 
Sbjct: 909 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 850

                                                                       
Query: 343 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 402
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 849 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 790

                                                                  
Query: 403 gcggtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           |||||||  |||||| |||| |||||| || ||||||||||||||||||||||||
Sbjct: 789 gcggtggttggagtcgagcctccagatggagccccacgactcgcgcatcggcgtc 735
to top
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence
          Length = 528

 Score =  127 bits (64), Expect = 3e-26
 Identities = 88/96 (91%)
 Strand = Plus / Plus

                                                                       
Query: 286 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
           |||||||| |||||| |||||| ||||| ||||  ||||||||||||||||||||| || 
Sbjct: 263 gtactggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggtt 322

                                               
Query: 346 ggccaccagcgtcttgccggactcgttggtgatgcg 381
           ||||||||||||||||||||||||||||||||||||
Sbjct: 323 ggccaccagcgtcttgccggactcgttggtgatgcg 358



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 415 gtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||||||||||||| ||     ||||||||||||||||||||
Sbjct: 392 gtccagccgccagatggannnnnacgactcgcgcatcggcgtc 434
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                          
Query: 288    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                          
Query: 348    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 169303

                                                                
Query: 408    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 169302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 169253



 Score =  103 bits (52), Expect = 5e-19
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                          
Query: 286    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 346    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                                                                  
Query: 406    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 157786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 157837
to top
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 288  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
            ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 6489 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 6430

                                                                        
Query: 348  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
            | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 6429 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 6370

                                                              
Query: 408  ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 6369 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 6320
to top
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                          
Query: 288    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 103422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 103363

                                                                          
Query: 348    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 103362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 103303

                                                                
Query: 408    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 103302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 103253



 Score =  103 bits (52), Expect = 5e-19
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                         
Query: 286   gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
             ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 91666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 91725

                                                                         
Query: 346   ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
              ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 91726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 91785

                                                                 
Query: 406   gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
             ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 91786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 91837
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                          
Query: 288    actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
              ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                          
Query: 348    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
              | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 169303

                                                                
Query: 408    ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 169302 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 169253



 Score =  103 bits (52), Expect = 5e-19
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                          
Query: 286    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 346    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                                                                  
Query: 406    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 157786 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 157837
to top
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                         
Query: 288   actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
             ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 93244 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 93303

                                                                         
Query: 348   ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
             | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 93304 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 93363

                                                               
Query: 408   ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
             ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 93364 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 93413



 Score =  103 bits (52), Expect = 5e-19
 Identities = 142/172 (82%)
 Strand = Plus / Minus

                                                                          
Query: 286    gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
              ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 105000 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 104941

                                                                          
Query: 346    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 104940 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 104881

                                                                  
Query: 406    gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
              ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 104880 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 104829
to top
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full
           insert sequence
          Length = 1027

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 288 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
           ||||||||||||||| ||||| |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 834 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 775

                                                                       
Query: 348 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
           | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 774 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 715

                                                             
Query: 408 ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 714 ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 665
to top
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds
          Length = 1210

 Score =  119 bits (60), Expect = 8e-24
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                        
Query: 288  actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 1026 actggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatcgg 967

                                                                        
Query: 348  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 407
            | |  || |||||||||||||||||||||||||| | |||||||||| |||| ||  |||
Sbjct: 966  cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgggt 907

                                                              
Query: 408  ggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
            ||  || |||||||| ||| || |||||||||||||| | ||||||||||
Sbjct: 906  ggttggtgtccagcctccatatcgatccccacgactccctcatcggcgtc 857
to top
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full
           insert sequence
          Length = 1794

 Score =  119 bits (60), Expect = 8e-24
 Identities = 117/136 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           ||||| |||||||||||| |||| ||| || |||||||||||||||||||||  ||||||
Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 879

                                                                       
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 441
            ||||||||||| |||||||| | ||||  || |||||||| |||||| || ||||||||
Sbjct: 878 gatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagccccacga 819

                           
Query: 442 ctcgcgcatcggcgtc 457
           ||| | ||||||||||
Sbjct: 818 ctccctcatcggcgtc 803
to top
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full
           insert sequence
          Length = 1019

 Score =  103 bits (52), Expect = 5e-19
 Identities = 142/172 (82%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
           ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 889 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 830

                                                                       
Query: 346 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 829 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 770

                                                               
Query: 406 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 769 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 718
to top
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds
          Length = 933

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 141/172 (81%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtactggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtc 345
           ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 807 gtactggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcggg 748

                                                                       
Query: 346 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 405
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 747 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 688

                                                               
Query: 406 gtggccggagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||  ||||||||||| ||| |  || ||||||||||| ||||||||||||
Sbjct: 687 gtggttggagtccagcctccacaccgacccccacgactcccgcatcggcgtc 636
to top
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds
          Length = 788

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 288 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 347
           ||||||||||||||| ||||| | ||  ||||  |||||  ||||| ||||||| ||| |
Sbjct: 644 actggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtccg 585

                                                          
Query: 348 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 394
           |||||||||||||||||||||||||||||| |||||  |||||||||
Sbjct: 584 ccaccagcgtcttgccggactcgttggtgacgcgcagcgagaagggc 538
to top
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds
          Length = 1142

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 324 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 383
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 814

                     
Query: 384 tggagaaggg 393
           ||||||||||
Sbjct: 813 tggagaaggg 804
to top
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence
          Length = 1171

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 324 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 383
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 823

                     
Query: 384 tggagaaggg 393
           ||||||||||
Sbjct: 822 tggagaaggg 813
to top
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds
          Length = 1078

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 329 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 388
           ||||||||||| |||| |||||| |||||||| ||||| ||| ||||||| |||||||||
Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggag 735

                                                             
Query: 389 aagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
           |||||| |||| ||  || ||| || ||||| ||||||||| ||||||||
Sbjct: 734 aagggcccctgcagcgggcggctggtgtccatccgccagatggatcccca 685
to top
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds
          Length = 1034

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 387
           |||||||||||||| |||||| || |||| | |||||||||||| ||||| |||||  ||
Sbjct: 904 ggccgggatgacctggtcggcgacgagcgacctgccggactcgtcggtgacgcgcagcga 845

                                                                       
Query: 388 gaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacgactcgcg 447
           ||||||| |||| ||  || ||     |||||| |||||||| |||||||||||||| | 
Sbjct: 844 gaagggcccctgcagcgggcggagcctgtccaggcgccagatggatccccacgactccct 785

                     
Query: 448 catcggcgtc 457
           ||||||||||
Sbjct: 784 catcggcgtc 775
to top
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds
          Length = 898

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 111/136 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||| |  | ||||||||||||||||||||| ||| ||  ||||||
Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 751

                                                                       
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 441
            |  ||||||||  |||| || ||| | | |||||||| ||||||||| |  ||||||||
Sbjct: 750 gagagagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 691

                           
Query: 442 ctcgcgcatcggcgtc 457
            | |||||||| ||||
Sbjct: 690 gtggcgcatcgccgtc 675
to top
>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor
           (expb11 gene), cultivar Wyuna, from endosperm tissue
          Length = 1032

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 332 gggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaag 391
           ||||||||||  ||||| || || ||||||||||||||||||||||||||||  ||||| 
Sbjct: 773 gggatgacctgttcggcgacaagtgtcttgccggactcgttggtgatgcgcaacgagaat 714

                  
Query: 392 ggcgcct 398
           |||||||
Sbjct: 713 ggcgcct 707
to top
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence
          Length = 477

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 366
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 434 ccccacgactcgcgcatcggcgtc 457
           ||||||||| ||||||||||||||
Sbjct: 162 ccccacgacacgcgcatcggcgtc 139
to top
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds
          Length = 671

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 321 cccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgc 380
           |||||| ||| ||||||||||  |||||  | ||||||||||||||||||||||| ||||
Sbjct: 327 cccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttggtkatgc 268

                        
Query: 381 gcatggagaaggg 393
            ||  ||||||||
Sbjct: 267 scagcgagaaggg 255
to top
>gb|AY112069.1| Zea mays CL35761_1 mRNA sequence
          Length = 631

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                       
Query: 353 agcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggtggccg 412
           |||||||||||||| ||| ||  | |||| ||||||||||| | ||| |||||||||  |
Sbjct: 167 agcgtcttgccggagtcggtgcgggtgcggatggagaagggtggctgcaggcggtggttg 226

                                                        
Query: 413 gagtccagccgccagattgatccccacgactcgcgcatcggcgtc 457
           ||||| || |||||||| |||||||| |||| || ||| ||||||
Sbjct: 227 gagtcgaggcgccagatggatccccatgactggctcatgggcgtc 271
to top
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2
           (OSJNBb0014I11.2), mRNA
          Length = 1262

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                                                    
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
            | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 753 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 697
to top
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds
          Length = 939

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 329 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 388
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 752

                                                                
Query: 389 aagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 441
           || ||| |||| ||  || ||  || ||||| ||||||||| || ||||||||
Sbjct: 751 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 699
to top
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full
           insert sequence
          Length = 1043

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 812 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 753

                                                                    
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
            | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 752 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 696
to top
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full
           insert sequence
          Length = 1259

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 810 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 751

                                                                    
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
            | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 750 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 694
to top
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full
           insert sequence
          Length = 1026

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 803 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 744

                                                                    
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
            | |||||||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 743 gagggagaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 687
to top
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds
          Length = 1132

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 329 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 388
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 727

                                                                
Query: 389 aagggcgcctggaggcggtggccggagtccagccgccagattgatccccacga 441
           || ||| |||| ||  || ||  || ||||| ||||||||| || ||||||||
Sbjct: 726 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 674
to top
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds
          Length = 999

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 381
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                                                    
Query: 382 catggagaagggcgcctggaggcggtggccggagtccagccgccagattgatcccca 438
            | ||| |||||  ||||||||||||||  || ||| || |||||||| ||||||||
Sbjct: 753 gagggakaaggggccctggaggcggtggttggcgtcgaggcgccagatggatcccca 697
to top
>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds
          Length = 1232

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 329 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 388
           ||||||||| | |||| ||| ||||||||||| ||||  ||| |||||||||| ||||||
Sbjct: 816 gccgggatggcattgttggcgaccagcgtctttccggtatcgctggtgatgcggatggag 757

                      
Query: 389 aagggcgcctg 399
           || ||| ||||
Sbjct: 756 aatggcccctg 746
to top
>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds
          Length = 1106

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 769 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 728
to top
>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin
           (OSJNBa0082M15.4), mRNA
          Length = 1148

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743
to top
>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds
          Length = 1117

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743
to top
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds
          Length = 1216

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 982 tcttgccggactcgctggtgacgcggatggagaagggggcct 941
to top
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds
          Length = 1068

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 747 tcttgccggactcgctggtgacgcggatggagaagggggcct 706
to top
>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete
              sequence
          Length = 158550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 357    tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
              |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 117099 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 117140
to top
>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full
           insert sequence
          Length = 1071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759
to top
>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full
           insert sequence
          Length = 1121

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 398
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759
to top
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 357  tcttgccggactcgttggtgatgcgcatggagaaggg 393
            |||||||||||||| |||||| ||| |||||||||||
Sbjct: 1061 tcttgccggactcgctggtgacgcggatggagaaggg 1025
to top
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds
          Length = 1111

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 777 tcttgccggactcgctggtgacgcggatggagaaggg 741
to top
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds
          Length = 496

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 237 tcttgccggactcgctggtgacgcggatggagaaggg 201
to top
>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete
           cds
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728
to top
>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds
          Length = 1080

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728
to top
>gb|AY103636.1| Zea mays PCO124530 mRNA sequence
          Length = 1085

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 776 tcttgccggactcgctggtgaggcggatggagaaggg 740
to top
>emb|BX294387.11| Zebrafish DNA sequence from clone DKEY-267L16 in linkage group 9,
              complete sequence
          Length = 167582

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 414    agtccagccgccagattgatcc 435
              ||||||||||||||||||||||
Sbjct: 159224 agtccagccgccagattgatcc 159203
to top
>dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, partial cds
          Length = 3511

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 246 catatgattccaaatgatgatg 267
           ||||||||||||||||||||||
Sbjct: 108 catatgattccaaatgatgatg 129
to top
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 345     cggccaccagcgtcttgccgg 365
               |||||||||||||||||||||
Sbjct: 1260020 cggccaccagcgtcttgccgg 1260040
to top
>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 259    atgatgatgagttcagcagcttcag 283
              ||||||||||||| |||||||||||
Sbjct: 345505 atgatgatgagttaagcagcttcag 345481
to top
>emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansin B1 (expB1 gene)
          Length = 1224

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 357 tcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggtggccggagt 416
           |||||||||| ||| |||||||||||| ||| || ||| ||| |||  ||| ||||||||
Sbjct: 780 tcttgccggaatcgctggtgatgcgcaaggacaatggccccttgagcgggttgccggagt 721

            
Query: 417 c 417
           |
Sbjct: 720 c 720
to top
>gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXPB9) mRNA, complete
           cds
          Length = 1088

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 738 tcttgccggactcgctggtgaggcggatagagaaggg 702
to top
>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13
          Length = 349306

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 345    cggccaccagcgtcttgccgg 365
              |||||||||||||||||||||
Sbjct: 226686 cggccaccagcgtcttgccgg 226706
to top
>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14
          Length = 327650

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 345    cggccaccagcgtcttgccgg 365
              |||||||||||||||||||||
Sbjct: 274844 cggccaccagcgtcttgccgg 274864
to top
>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 250    tgattccaaatgatgatgagt 270
              |||||||||||||||||||||
Sbjct: 177950 tgattccaaatgatgatgagt 177930
to top
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds
          Length = 960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           ||||||||| |||| |||||| ||| |||||||||||
Sbjct: 730 tcttgccgggctcgctggtgacgcggatggagaaggg 694
to top
>gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds
          Length = 827

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 tcttgccggactcgttggtgatgcgcatggagaaggg 393
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 499 tcttgccggactcgctggtgaggcggatagagaaggg 463
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 346     ggccaccagcgtcttgccgg 365
               ||||||||||||||||||||
Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464
to top
>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene,
            partial cds; recombination and repair protein (recG)
            gene, complete cds; and unknown gene
          Length = 6176

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 347  gccaccagcgtcttgccgga 366
            ||||||||||||||||||||
Sbjct: 4669 gccaccagcgtcttgccgga 4650
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 347     gccaccagcgtcttgccgga 366
               ||||||||||||||||||||
Sbjct: 2190610 gccaccagcgtcttgccgga 2190629
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 308     aaggtgctgggcgcccagttggcc 331
               |||||||||| |||||||||||||
Sbjct: 2061004 aaggtgctggtcgcccagttggcc 2060981
to top
>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      gcacacacaaacagtaataa 28
              ||||||||||||||||||||
Sbjct: 120092 gcacacacaaacagtaataa 120073
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 343     gtcggccaccagcgtcttgc 362
               ||||||||||||||||||||
Sbjct: 4141074 gtcggccaccagcgtcttgc 4141055
to top
>emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in linkage group 4, complete
              sequence
          Length = 172167

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 246    catatgattccaaatgatgatgagttca 273
              |||||||||| ||||| |||||||||||
Sbjct: 166340 catatgattctaaatggtgatgagttca 166367
to top
>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    gcacacacaaacagtaataa 28
            ||||||||||||||||||||
Sbjct: 7061 gcacacacaaacagtaataa 7080
to top
>gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 ggccgggatgaccttgtcgg 347
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 ggccgggatgaccttgtcgg 347
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 ggccgggatgaccttgtcgg 347
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 313    gctgggcgcccagttggccgggat 336
              ||||||||||||||| ||||||||
Sbjct: 594398 gctgggcgcccagtttgccgggat 594375
to top
>gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type 1 subunit gene,
           complete cds
          Length = 1850

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 ggccgggatgaccttgtcgg 347
           ||||||||||||||||||||
Sbjct: 588 ggccgggatgaccttgtcgg 569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,665,702
Number of Sequences: 3902068
Number of extensions: 3665702
Number of successful extensions: 70861
Number of sequences better than 10.0: 119
Number of HSP's better than 10.0 without gapping: 119
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70180
Number of HSP's gapped (non-prelim): 646
length of query: 457
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 435
effective length of database: 17,147,199,772
effective search space: 7459031900820
effective search space used: 7459031900820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top