ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart28h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (... 293 1e-76
2emb|AJ295156.1|PCO295156 Phragmites communis mRNA for d-TDP-gluc... 56 4e-05
3gb|AY104952.1| Zea mays PCO092342 mRNA sequence 48 0.010
4gb|BT019083.1| Zea mays clone Contig672.F mRNA sequence 42 0.62
5gb|DP000062.1| Sus scrofa target 117 genomic scaffold 40 2.4
6emb|CT009662.23| Mouse DNA sequence from clone CH29-511O15 on ch... 40 2.4
7ref|NM_179895.1| Arabidopsis thaliana unknown protein AT2G34310 ... 38 9.6
8ref|NM_128982.2| Arabidopsis thaliana unknown protein AT2G34310 ... 38 9.6
9ref|NM_179896.1| Arabidopsis thaliana unknown protein AT2G34310 ... 38 9.6
10gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 38 9.6
11ref|XM_711147.1| Candida albicans SC5314 hypothetical protein (C... 38 9.6
12ref|XM_711064.1| Candida albicans SC5314 hypothetical protein (C... 38 9.6
13gb|AC147233.3| Mus musculus BAC clone RP23-350J18 from chromosom... 38 9.6
14gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome... 38 9.6
15gb|AC127418.3| Mus musculus BAC clone RP24-66J10 from chromosome... 38 9.6
16emb|AL357041.11| Human DNA sequence from clone RP11-221L2 on chr... 38 9.6
17emb|AL355001.20| Human DNA sequence from clone RP11-61K9 on chro... 38 9.6
18gb|AY136371.1| Arabidopsis thaliana expressed protein (At2g34310... 38 9.6
19gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosom... 38 9.6
20gb|AC027708.12| Homo sapiens chromosome 15, clone RP11-82I10, co... 38 9.6
21gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 38 9.6
22gb|AC006500.4|AC006500 Homo sapiens, clone hRPK.31_A_1, complete... 38 9.6
23emb|AL844515.6| Mouse DNA sequence from clone RP23-133G5 on chro... 38 9.6

>gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (UXS1) mRNA, complete
            cds
          Length = 1433

 Score =  293 bits (148), Expect = 1e-76
 Identities = 180/193 (93%)
 Strand = Plus / Minus

                                                                        
Query: 2    gtaatacaaacagccaggccttggatataaaggttctaataatacaatctttcaagtgaa 61
            ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 1317 gtaatacaaacagccaggccttgtatataaagtttctaataatacaatctttcaagtgaa 1258

                                                                        
Query: 62   cgacaaagggggaattgggttattggaactcaaattccgtaacgaaacacagcaacgaat 121
            ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1257 cgacaaaggtgtaattggtttattggaactcaaattccgtaacgaaacacagcaacgaat 1198

                                                                        
Query: 122  attgacgaannnnnnnaactatgagtatgctctggcaaattggggatgtacgccaaacgc 181
            |||||||||       ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1197 attgacgaacccacccaactatgagtatgctctggcaaattggtgatgtacgccaaacgc 1138

                         
Query: 182  agggaagtggcct 194
            |||||||||||||
Sbjct: 1137 agggaagtggcct 1125



to top

>emb|AJ295156.1|PCO295156 Phragmites communis mRNA for d-TDP-glucose dehydratase (tgp gene)
          Length = 1562

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 41   taatacaatctttcaagtgaacgacaaagggggaattgggttattggaactcaaattccg 100
            |||||||||||||||| |||||||||| |  | | |  | ||||||||||||||||||||
Sbjct: 1419 taatacaatctttcaattgaacgacaacgatgtattcagtttattggaactcaaattccg 1360

                    
Query: 101  taacgaaa 108
            ||| ||||
Sbjct: 1359 taatgaaa 1352



to top

>gb|AY104952.1| Zea mays PCO092342 mRNA sequence
          Length = 1825

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 81   ttattggaactcaaattccgtaacgaaa 108
            ||||||||||||||||||||||| ||||
Sbjct: 1637 ttattggaactcaaattccgtaatgaaa 1610



to top

>gb|BT019083.1| Zea mays clone Contig672.F mRNA sequence
          Length = 958

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 84  ttggaactcaaattccgtaacgaaa 108
           |||||||||||||||||||| ||||
Sbjct: 921 ttggaactcaaattccgtaatgaaa 897



to top

>gb|DP000062.1| Sus scrofa target 117 genomic scaffold
          Length = 605739

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    atgctctggcaaattgggga 167
              ||||||||||||||||||||
Sbjct: 333749 atgctctggcaaattgggga 333768



to top

>emb|CT009662.23| Mouse DNA sequence from clone CH29-511O15 on chromosome 17, complete
              sequence
          Length = 231197

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 141    tatgagtatgctctggcaaa 160
              ||||||||||||||||||||
Sbjct: 208325 tatgagtatgctctggcaaa 208306



to top

>ref|NM_179895.1| Arabidopsis thaliana unknown protein AT2G34310 transcript variant
          AT2G34310.2 mRNA, complete cds
          Length = 1149

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 47 aatctttcaagtgaacgac 65
          |||||||||||||||||||
Sbjct: 58 aatctttcaagtgaacgac 76



to top

>ref|NM_128982.2| Arabidopsis thaliana unknown protein AT2G34310 transcript variant
          AT2G34310.1 mRNA, complete cds
          Length = 1254

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 47 aatctttcaagtgaacgac 65
          |||||||||||||||||||
Sbjct: 58 aatctttcaagtgaacgac 76



to top

>ref|NM_179896.1| Arabidopsis thaliana unknown protein AT2G34310 transcript variant
          AT2G34310.3 mRNA, complete cds
          Length = 1130

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 47 aatctttcaagtgaacgac 65
          |||||||||||||||||||
Sbjct: 58 aatctttcaagtgaacgac 76



to top

>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence
          Length = 199262

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 9      aaacagccaggccttggat 27
              |||||||||||||||||||
Sbjct: 198963 aaacagccaggccttggat 198981



to top

>ref|XM_711147.1| Candida albicans SC5314 hypothetical protein (CaO19_6400), mRNA
          Length = 666

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  cgacaaagggggaattggg 80
           |||||||||||||||||||
Sbjct: 145 cgacaaagggggaattggg 127



to top

>ref|XM_711064.1| Candida albicans SC5314 hypothetical protein (CaO19_13758), mRNA
          Length = 666

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  cgacaaagggggaattggg 80
           |||||||||||||||||||
Sbjct: 145 cgacaaagggggaattggg 127



to top

>gb|AC147233.3| Mus musculus BAC clone RP23-350J18 from chromosome 8, complete sequence
          Length = 185319

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 27    tataaaggttctaataata 45
             |||||||||||||||||||
Sbjct: 68220 tataaaggttctaataata 68238



to top

>gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome 12, complete sequence
          Length = 134858

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     aaacagccaggccttggat 27
             |||||||||||||||||||
Sbjct: 55451 aaacagccaggccttggat 55469



to top

>gb|AC127418.3| Mus musculus BAC clone RP24-66J10 from chromosome 8, complete sequence
          Length = 186725

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 27     tataaaggttctaataata 45
              |||||||||||||||||||
Sbjct: 174559 tataaaggttctaataata 174577



to top

>emb|AL357041.11| Human DNA sequence from clone RP11-221L2 on chromosome 1 Contains
            ESTs, STSs and GSSs, complete sequence
          Length = 130794

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 26   atataaaggttctaataat 44
            |||||||||||||||||||
Sbjct: 4590 atataaaggttctaataat 4608



to top

>emb|AL355001.20| Human DNA sequence from clone RP11-61K9 on chromosome 13 Contains the
             ZNF237 gene for zinc finger protein 237, a novel gene and
             2 CpG islands, complete sequence
          Length = 82374

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 149   tgctctggcaaattgggga 167
             |||||||||||||||||||
Sbjct: 48891 tgctctggcaaattgggga 48909



to top

>gb|AY136371.1| Arabidopsis thaliana expressed protein (At2g34310) mRNA, complete
          cds
          Length = 1111

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 47 aatctttcaagtgaacgac 65
          |||||||||||||||||||
Sbjct: 20 aatctttcaagtgaacgac 38



to top

>gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosome 12, complete
             sequence
          Length = 216485

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     aaacagccaggccttggat 27
             |||||||||||||||||||
Sbjct: 96031 aaacagccaggccttggat 96013



to top

>gb|AC027708.12| Homo sapiens chromosome 15, clone RP11-82I10, complete sequence
          Length = 176613

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 34     gttctaataatacaatctttcaa 56
              ||||||||||||||||| |||||
Sbjct: 129129 gttctaataatacaatcattcaa 129151



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    aatctttcaagtgaacgac 65
             |||||||||||||||||||
Sbjct: 50392 aatctttcaagtgaacgac 50374



to top

>gb|AC006500.4|AC006500 Homo sapiens, clone hRPK.31_A_1, complete sequence
          Length = 147699

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     atataaaggttctaataat 44
              |||||||||||||||||||
Sbjct: 101556 atataaaggttctaataat 101538



to top

>emb|AL844515.6| Mouse DNA sequence from clone RP23-133G5 on chromosome 2, complete
             sequence
          Length = 216464

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    tacaatctttcaagtgaac 62
             |||||||||||||||||||
Sbjct: 79108 tacaatctttcaagtgaac 79126


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,293,423
Number of Sequences: 3902068
Number of extensions: 1293423
Number of successful extensions: 79280
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79240
Number of HSP's gapped (non-prelim): 39
length of query: 194
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 172
effective length of database: 17,147,199,772
effective search space: 2949318360784
effective search space used: 2949318360784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top