| Clone Name | rbart28g10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC136956.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0038B22, complete sequence Length = 177557 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 156 taatcataaactcatagcataa 177 |||||||||||||||||||||| Sbjct: 94385 taatcataaactcatagcataa 94406
>gb|AC129182.4| Mus musculus BAC clone RP23-340P24 from chromosome 19, complete sequence Length = 187601 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 133 aaatcagggaagagagtaaaacataatcat 162 ||||||| ||||||| |||||||||||||| Sbjct: 101272 aaatcagagaagagattaaaacataatcat 101243
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 156 taatcataaactcatagcataa 177 |||||||||||||||||||||| Sbjct: 19917318 taatcataaactcatagcataa 19917339
>gb|AC079924.6| Homo sapiens BAC clone RP11-469L8 from 2, complete sequence Length = 55282 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 228 aaaatcaaattcagatcttcaa 249 |||||||||||||||||||||| Sbjct: 21665 aaaatcaaattcagatcttcaa 21644
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 156 taatcataaactcatagcataa 177 |||||||||||||||||||||| Sbjct: 20202297 taatcataaactcatagcataa 20202318
>gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's Hospital Oakland Research Institute) complete sequence Length = 227955 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 287 gtttgttttgctatgtagtcc 307 ||||||||||||||||||||| Sbjct: 210761 gtttgttttgctatgtagtcc 210741
>gb|AC122485.3| Mus musculus BAC clone RP24-377J10 from chromosome 3, complete sequence Length = 157739 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 154 cataatcataaactcatagca 174 ||||||||||||||||||||| Sbjct: 153215 cataatcataaactcatagca 153235
>gb|AC161513.5| Mus musculus chromosome 3, clone RP23-238A12, complete sequence Length = 160438 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 154 cataatcataaactcatagca 174 ||||||||||||||||||||| Sbjct: 36277 cataatcataaactcatagca 36297
>gb|AC165259.2| Mus musculus BAC clone RP23-146P7 from chromosome 17, complete sequence Length = 252045 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 287 gtttgttttgctatgtagtcc 307 ||||||||||||||||||||| Sbjct: 75918 gtttgttttgctatgtagtcc 75898
>gb|AC073856.17| Homo sapiens 3 BAC RP11-938G16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177363 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 221 tcacttgaaaatcaaattcag 241 ||||||||||||||||||||| Sbjct: 55673 tcacttgaaaatcaaattcag 55653
>gb|AC158611.7| Mus musculus 10 BAC RP23-29D19 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 214923 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 285 aggtttgttttgctatgtagt 305 ||||||||||||||||||||| Sbjct: 50901 aggtttgttttgctatgtagt 50881
>emb|CR847939.13| Zebrafish DNA sequence from clone CH211-262I1 in linkage group 11, complete sequence Length = 181988 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 256 aatggtttgtttgcctgttgcaaaa 280 |||| |||||||||||||||||||| Sbjct: 112038 aatgctttgtttgcctgttgcaaaa 112062
>gb|AC164630.6| Mus musculus 10 BAC RP23-153M4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 187031 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 285 aggtttgttttgctatgtagt 305 ||||||||||||||||||||| Sbjct: 37625 aggtttgttttgctatgtagt 37645
>ref|XM_628913.1| Dictyostelium discoideum hypothetical protein (DDB0192166), partial mRNA Length = 1527 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 aaatatcttcacttgaaaat 232 |||||||||||||||||||| Sbjct: 349 aaatatcttcacttgaaaat 330
>gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's Hospital Oakland Research Institute) complete sequence Length = 133054 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 3 acaacatggatacattttat 22 |||||||||||||||||||| Sbjct: 4286 acaacatggatacattttat 4267
>gb|AC010212.10| Drosophila melanogaster clone BACR32D05, complete sequence Length = 161579 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 ggcaaacacaaacttcttat 119 |||||||||||||||||||| Sbjct: 97029 ggcaaacacaaacttcttat 97010
>ref|XM_600599.2| PREDICTED: Bos taurus similar to B0507.2 (LOC522319), partial mRNA Length = 1122 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 aaatatcttcacttgaaaat 232 |||||||||||||||||||| Sbjct: 413 aaatatcttcacttgaaaat 432
>ref|XM_536151.2| PREDICTED: Canis familiaris similar to B0507.2 (LOC478996), mRNA Length = 1386 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 aaatatcttcacttgaaaat 232 |||||||||||||||||||| Sbjct: 868 aaatatcttcacttgaaaat 887
>gb|AC113114.9| Mus musculus chromosome 17, clone RP23-338H10, complete sequence Length = 183828 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 446 tgcataaggcttttgaagaa 465 |||||||||||||||||||| Sbjct: 111870 tgcataaggcttttgaagaa 111889
>gb|AC105071.7| Mus musculus, clone RP23-277C24, complete sequence Length = 199946 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 tgaaaatcaaattcagatct 245 |||||||||||||||||||| Sbjct: 165693 tgaaaatcaaattcagatct 165674
>gb|AC098697.4| Rattus norvegicus strain Brown Norway clone RP31-387A21, complete sequence Length = 123000 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 ggatacattttattatttaa 29 |||||||||||||||||||| Sbjct: 76876 ggatacattttattatttaa 76857
>emb|AL109654.22|HSG278N14 Human DNA sequence from clone GS1-278N14 on chromosome Xq27.3-28, complete sequence Length = 182150 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 aatcagggaagagagtaaaa 153 |||||||||||||||||||| Sbjct: 25750 aatcagggaagagagtaaaa 25769
>gb|AC154715.2| Mus musculus BAC clone RP24-361A22 from chromosome 16, complete sequence Length = 172362 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 139 gggaagagagtaaaacataa 158 |||||||||||||||||||| Sbjct: 84349 gggaagagagtaaaacataa 84368
>emb|AL627279.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18, complete chromosome; segment 15/20 Length = 264050 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 323 atgtatcgtggtggccgcttatca 346 |||||||||||||||| ||||||| Sbjct: 16935 atgtatcgtggtggcctcttatca 16912
>emb|CR860996.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0518 (from clone DKFZp459J0518) Length = 2032 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 374 tccatctccatgtccaatga 393 |||||||||||||||||||| Sbjct: 520 tccatctccatgtccaatga 501
>gb|AF401197.1| Acer tegmentosum chloroplast tRNA-Leu gene, partial sequence; and trnL-trnF intergenic spacer region, complete sequence Length = 937 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 411 cttttgaagaaccgattgctcaga 434
>gb|BC112792.1| Bos taurus cDNA clone IMAGE:8167640, partial cds Length = 1265 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 aaatatcttcacttgaaaat 232 |||||||||||||||||||| Sbjct: 1085 aaatatcttcacttgaaaat 1104
>ref|NM_141401.1| Drosophila melanogaster CG2330-RA (CG2330), mRNA Length = 2606 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 ggcaaacacaaacttcttat 119 |||||||||||||||||||| Sbjct: 1407 ggcaaacacaaacttcttat 1388
>gb|AC024600.5| Homo sapiens chromosome 10 clone RP11-179K3, complete sequence Length = 147878 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 484 cattacatctcctatgttca 503 |||||||||||||||||||| Sbjct: 105042 cattacatctcctatgttca 105023
>gb|AC090257.5| Homo sapiens chromosome 15, clone RP11-301A18, complete sequence Length = 159299 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atcttcacttgaaaatcaaa 236 |||||||||||||||||||| Sbjct: 77158 atcttcacttgaaaatcaaa 77177
>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome Length = 859006 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 297 ctatgtagtccttgttcttt 316 |||||||||||||||||||| Sbjct: 197757 ctatgtagtccttgttcttt 197776
>gb|AC154360.3| Mus musculus BAC clone RP23-167I5 from chromosome 14, complete sequence Length = 198179 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 tgaaaatcaaattcagatct 245 |||||||||||||||||||| Sbjct: 134544 tgaaaatcaaattcagatct 134563
>gb|AY043214.1| Capsicum annuum RSH-like protein mRNA, complete cds Length = 2710 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gttttgctatgtagtccttg 310 |||||||||||||||||||| Sbjct: 1893 gttttgctatgtagtccttg 1874
>gb|AC018787.5|AC018787 Homo sapiens, clone RP11-22O12, complete sequence Length = 90722 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atcttcacttgaaaatcaaa 236 |||||||||||||||||||| Sbjct: 83177 atcttcacttgaaaatcaaa 83196
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete sequence Length = 4332241 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 acttgaaaatcaaattcaga 242 |||||||||||||||||||| Sbjct: 77165 acttgaaaatcaaattcaga 77146
>gb|AC114778.5| Homo sapiens BAC clone RP11-516O5 from 2, complete sequence Length = 187842 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 cacacacataaattggggaa 96 |||||||||||||||||||| Sbjct: 123324 cacacacataaattggggaa 123343
>emb|BX248331.8| Zebrafish DNA sequence from clone CH211-236D3 in linkage group 11, complete sequence Length = 174071 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 9 tggatacattttattattta 28 |||||||||||||||||||| Sbjct: 60932 tggatacattttattattta 60951
>gb|AC026108.29| Homo sapiens 12 BAC RP11-438H24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 77790 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 5 aacatggatacattttattattta 28 ||||||||||| |||||||||||| Sbjct: 361 aacatggatactttttattattta 384
>gb|AC079903.26| Homo sapiens 12 BAC RP11-449D7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 11273 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 5 aacatggatacattttattattta 28 ||||||||||| |||||||||||| Sbjct: 9630 aacatggatactttttattattta 9653
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 Length = 4585229 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 323 atgtatcgtggtggccgcttatca 346 |||||||||||||||| ||||||| Sbjct: 3918251 atgtatcgtggtggcctcttatca 3918274
>dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03, map 22, complete sequences Length = 185342 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 atgcaataaacttcacaatt 203 |||||||||||||||||||| Sbjct: 31338 atgcaataaacttcacaatt 31319
>dbj|BS000056.1| Pan troglodytes chromosome 22 clone:RP43-138K13, map 22, complete sequences Length = 150136 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 atgcaataaacttcacaatt 203 |||||||||||||||||||| Sbjct: 88386 atgcaataaacttcacaatt 88367
>gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, complete sequence Length = 140465 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 ccaaatatcttcacttgaaa 230 |||||||||||||||||||| Sbjct: 84091 ccaaatatcttcacttgaaa 84110
>ref|NM_208465.1| Eremothecium gossypii ABR164Wp (ABR164W), mRNA Length = 1506 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ttgtttgcctgttgcaaaaa 281 |||||||||||||||||||| Sbjct: 893 ttgtttgcctgttgcaaaaa 874
>emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in linkage group 20, complete sequence Length = 176463 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 agctacataacactttacat 67 |||||||||||||||||||| Sbjct: 38961 agctacataacactttacat 38980
>emb|BX296516.3| Zebrafish DNA sequence from clone DKEY-219E20 in linkage group 20, complete sequence Length = 160555 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 agctacataacactttacat 67 |||||||||||||||||||| Sbjct: 59143 agctacataacactttacat 59124
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome Length = 4791961 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 323 atgtatcgtggtggccgcttatca 346 |||||||||||||||| ||||||| Sbjct: 3466593 atgtatcgtggtggcctcttatca 3466570
>gb|AE003675.4| Drosophila melanogaster chromosome 3R, section 9 of 118 of the complete sequence Length = 145958 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 ggcaaacacaaacttcttat 119 |||||||||||||||||||| Sbjct: 135498 ggcaaacacaaacttcttat 135479
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete genome Length = 4755700 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 323 atgtatcgtggtggccgcttatca 346 |||||||||||||||| ||||||| Sbjct: 4075833 atgtatcgtggtggcctcttatca 4075856
>dbj|AP000873.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-727A23, complete sequence Length = 174905 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 aaggacttcacacacataaa 88 |||||||||||||||||||| Sbjct: 142547 aaggacttcacacacataaa 142528
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome I, complete sequence Length = 4277185 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 acttgaaaatcaaattcaga 242 |||||||||||||||||||| Sbjct: 77368 acttgaaaatcaaattcaga 77349
>emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on chromosome 13, complete sequence Length = 219226 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 ccaaatatcttcacttgaaa 230 |||||||||||||||||||| Sbjct: 206313 ccaaatatcttcacttgaaa 206294
>emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chromosome 4, complete sequence Length = 145881 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 195 ttcacaattgtgtttaccaa 214 |||||||||||||||||||| Sbjct: 17472 ttcacaattgtgtttaccaa 17491
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ttgtttgcctgttgcaaaaa 281 |||||||||||||||||||| Sbjct: 710931 ttgtttgcctgttgcaaaaa 710912
>emb|AJ342715.1|HSA342715 Homo sapiens genomic sequence surrounding NotI site, clone NL1-FA6R Length = 761 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 gggaaaagggcaaacacaaa 111 |||||||||||||||||||| Sbjct: 539 gggaaaagggcaaacacaaa 558
>emb|AJ413101.1|AMO413101 Acer tschonoskii chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 933 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 369 cttttgaagaaccgattgctcaga 392
>emb|AJ413100.1|AMO413100 Acer tschonoskii chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, subsp. koreanum Length = 935 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 371 cttttgaagaaccgattgctcaga 394
>emb|AJ413099.1|AMO413099 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2 Length = 983 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 420 cttttgaagaaccgattgctcaga 443
>emb|AJ413098.1|AMO413098 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 3 Length = 939 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 393 cttttgaagaaccgattgctcaga 416
>emb|AJ413097.1|AMO413097 Acer capillipes chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 983 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 438 cttttgaagaaccgattgctcaga 461
>emb|AJ413096.1|AMO413096 Acer tegmentosum chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2 Length = 943 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 403 cttttgaagaaccgattgctcaga 426
>emb|AJ413095.1|AMO413095 Acer tegmentosum chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 943 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 403 cttttgaagaaccgattgctcaga 426
>emb|AJ413094.1|AMO413094 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 996 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 444 cttttgaagaaccgattgctcaga 467
>emb|AJ413093.1|AMO413093 Acer crataegifolium chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 1005 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 460 cttttgaagaaccgattgctcaga 483
>emb|AJ413092.1|AMO413092 Acer caudatifolium chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1 Length = 970 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 434 cttttgaagaaccgattgctcaga 457
>emb|AJ413091.1|AMO413091 Acer crataegifolium chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2 Length = 952 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 417 cttttgaagaaccgattgctcaga 440
>emb|AJ413090.1|AMO413090 Acer capillipes chloroplast tRNA-Leu gene (partial) for transfer RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2 Length = 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 455 cttttgaagaacccattgctcaga 478 ||||||||||||| |||||||||| Sbjct: 420 cttttgaagaaccgattgctcaga 443 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,463,689 Number of Sequences: 3902068 Number of extensions: 6463689 Number of successful extensions: 130209 Number of sequences better than 10.0: 67 Number of HSP's better than 10.0 without gapping: 67 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 129891 Number of HSP's gapped (non-prelim): 318 length of query: 520 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 497 effective length of database: 17,143,297,704 effective search space: 8520218958888 effective search space used: 8520218958888 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)