>ref|NM_205667.1| Danio rerio zgc:77315 (zgc:77315), mRNA
          Length = 1010

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 cttcatcggcacattcaaagc 257
           |||||||||||||||||||||
Sbjct: 177 cttcatcggcacattcaaagc 197

>gb|BC054570.1| Danio rerio cDNA clone IMAGE:6790622, containing frame-shift errors
          Length = 1036

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 cttcatcggcacattcaaagc 257
           |||||||||||||||||||||
Sbjct: 171 cttcatcggcacattcaaagc 191

>emb|AL646097.25| Mouse DNA sequence from clone RP23-338M9 on chromosome 11 Contains
            the 3' end of the Gas7 gene for growth arrest specific 7,
            the Rcvrn gene for recoverin, the Glp2r gene for
            glucagon-like peptide 2 receptor, a novel gene and the
            gene for a novel protein (1110001P11Rik), complete
            sequence
          Length = 212636

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 192  gtgacaaaaccatgtgacaaa 212
            |||||||||||||||||||||
Sbjct: 5267 gtgacaaaaccatgtgacaaa 5287

>gb|BC065601.1| Danio rerio zgc:77315, mRNA (cDNA clone MGC:77315 IMAGE:6966598),
           complete cds
          Length = 1010

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 cttcatcggcacattcaaagc 257
           |||||||||||||||||||||
Sbjct: 177 cttcatcggcacattcaaagc 197

>gb|AF259079.1| Danio rerio snRNP-associated protein mRNA, complete cds
          Length = 949

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 cttcatcggcacattcaaagc 257
           |||||||||||||||||||||
Sbjct: 147 cttcatcggcacattcaaagc 167

>gb|AC095066.4| Homo sapiens BAC clone RP11-651B17 from 4, complete sequence
          Length = 97734

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 197   aaaaccatgtgacaaaatgca 217
             |||||||||||||||||||||
Sbjct: 79914 aaaaccatgtgacaaaatgca 79934

>gb|AC102154.9| Mus musculus chromosome 1, clone RP23-333I7, complete sequence
          Length = 195954

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 375    tctgctccagaggatccaat 394
              ||||||||||||||||||||
Sbjct: 130927 tctgctccagaggatccaat 130908

>emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chromosome 13 Contains the
              KATNAL1 gene for katanin p60 subunit A-like 1, a
              peroxiredoxin 2 (PRDX2) pseudogene, two novel genes and two
              CpG islands, complete sequence
          Length = 182303

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 282    tgggccatgtgacataaccg 301
              ||||||||||||||||||||
Sbjct: 173299 tgggccatgtgacataaccg 173318

>gb|AF538681.1| Mycoplasma collis 16S ribosomal RNA gene, partial sequence; 16S-23S
           rRNA intergenic spacer, complete sequence; and 23S
           ribosomal RNA gene, partial sequence
          Length = 1833

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 138 actactggaaacagttgcta 157

>gb|AF412976.1|AF412976 Mycoplasma cricetuli 16S ribosomal RNA gene, partial sequence
          Length = 1479

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 110 actactggaaacagttgcta 129

>gb|AF412974.1|AF412974 Mycoplasma collis 16S ribosomal RNA gene, partial sequence
          Length = 1479

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 110 actactggaaacagttgcta 129

>gb|AC174931.2| Mus musculus chromosome 1, clone RP24-259F5, complete sequence
          Length = 184558

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 375  tctgctccagaggatccaat 394
            ||||||||||||||||||||
Sbjct: 8629 tctgctccagaggatccaat 8610

>gb|AF545624.1| Chilomonas paramecium small subunit ribosomal RNA gene, partial
           sequence; chloroplast gene for chloroplast product
          Length = 1368

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 104 actactggaaacagttgcta 123

>emb|X64727.1|MC16SRRNP M.collis gene for 16S rRNA
          Length = 372

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 7   actactggaaacagttgcta 26

>gb|AC154669.2| Mus musculus BAC clone RP24-289P23 from 14, complete sequence
          Length = 149684

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 392   aatcttggatgcatttctga 411
             ||||||||||||||||||||
Sbjct: 18720 aatcttggatgcatttctga 18739

>gb|AC154690.3| Mus musculus BAC clone RP24-331B7 from chromosome 14, complete sequence
          Length = 181879

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 392   aatcttggatgcatttctga 411
             ||||||||||||||||||||
Sbjct: 26511 aatcttggatgcatttctga 26492

>gb|M23944.1|MYCRRNAN M.neurolyticum 16S ribosomal RNA small subunit
          Length = 1484

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 326 actactggaaacagttgcta 345
           ||||||||||||||||||||
Sbjct: 143 actactggaaacagttgcta 162


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,476,203
Number of Sequences: 3902068
Number of extensions: 3476203
Number of successful extensions: 60451
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60429
Number of HSP's gapped (non-prelim): 22
length of query: 450
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 428
effective length of database: 17,147,199,772
effective search space: 7339001502416
effective search space used: 7339001502416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)