>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 15      cttcatcttgaataaacatta 35
               |||||||||||||||||||||
Sbjct: 3805514 cttcatcttgaataaacatta 3805534

>emb|AL928924.12| Mouse DNA sequence from clone RP23-307E15 on chromosome 2, complete
             sequence
          Length = 195936

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 238   gaaaaaatgtaaggtatgctt 258
             |||||||||||||||||||||
Sbjct: 16902 gaaaaaatgtaaggtatgctt 16922

>gb|AC036222.23| Homo sapiens chromosome 17, clone RP11-433M22, complete sequence
          Length = 174965

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 213   gtttttatccttcttccccattat 236
             |||||||||||||||| |||||||
Sbjct: 89967 gtttttatccttcttctccattat 89990

>emb|AL442125.13| Human DNA sequence from clone RP11-230F18 on chromosome 13 Contains the
              5' end of the gene for FLJ10704 (FLJ20092), a  novel gene,
              a novel gene (FLJ20623), the TFDP1 gene for transcription
              factor Dp-1 (DP-1, DRTF1) and 5 CpG islands, complete
              sequence
          Length = 184889

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 257    tttggactatgtaaggtctgtccc 280
              ||||||||||||||||||| ||||
Sbjct: 111338 tttggactatgtaaggtctttccc 111361

>gb|AY176748.1| Gymnoascoideus petalosporus strain ATCC 34351 28S ribosomal RNA
           gene, partial sequence
          Length = 948

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 288 aggggacttacgccgcggcc 307
           ||||||||||||||||||||
Sbjct: 133 aggggacttacgccgcggcc 114

>emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete genome; segment 1/16
          Length = 347356

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    gcaccggctcgcgaaaacgc 140
              ||||||||||||||||||||
Sbjct: 282211 gcaccggctcgcgaaaacgc 282230

>ref|NM_001016517.2| Xenopus tropicalis zinc finger protein 160 (zfp160), mRNA
          Length = 2204

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 214 tttttatccttcttccccat 233
           ||||||||||||||||||||
Sbjct: 80  tttttatccttcttccccat 61

>emb|AL591426.17| Mouse DNA sequence from clone RP23-345E8 on chromosome 11 Contains a
             novel gene, the Arht1 gene for ras homolog gene family
             member T1, the 5' end of the Rhbdl4 gene for rhomboid
             veinlet-like 4 (Drosophila), complete sequence
          Length = 153420

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 193   acatatctatggagacaaga 212
             ||||||||||||||||||||
Sbjct: 54217 acatatctatggagacaaga 54198

>emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 in linkage group 19,
              complete sequence
          Length = 195006

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 5      ggccatcactcttcatcttgaata 28
              ||||||||||||||||||| ||||
Sbjct: 151629 ggccatcactcttcatctttaata 151606

>emb|BX914217.19| Zebrafish DNA sequence from clone DKEY-175H14 in linkage group 18,
             complete sequence
          Length = 133981

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    tcttcatcttgaataaacat 33
             ||||||||||||||||||||
Sbjct: 50191 tcttcatcttgaataaacat 50172

>gb|AC012668.13| Homo sapiens BAC clone RP11-458D8 from 2, complete sequence
          Length = 192396

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 15     cttcatcttgaataaacattacat 38
              |||| |||||||||||||||||||
Sbjct: 151003 cttcctcttgaataaacattacat 150980

>emb|AJ504410.1|TRU504410 Takifugu rubripes egln1 gene (partial), trax gene and disc1 gene
          Length = 44904

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 273  tctgtcccacgggggagggg 292
            ||||||||||||||||||||
Sbjct: 5460 tctgtcccacgggggagggg 5479

>dbj|AB075340.1| Gymnoascus punctatus gene for 28S ribosomal RNA, partial sequence
          Length = 611

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 288 aggggacttacgccgcggcc 307
           ||||||||||||||||||||
Sbjct: 153 aggggacttacgccgcggcc 134

>dbj|AB075339.1| Gymnoascus marginosporus gene for 28S ribosomal RNA, partial
           sequence
          Length = 605

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 288 aggggacttacgccgcggcc 307
           ||||||||||||||||||||
Sbjct: 146 aggggacttacgccgcggcc 127

>emb|CR926215.2| Xenopus tropicalis finished cDNA, clone TNeu074i11
          Length = 2204

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 214 tttttatccttcttccccat 233
           ||||||||||||||||||||
Sbjct: 80  tttttatccttcttccccat 61

>emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in linkage group 18,
             complete sequence
          Length = 105612

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 5     ggccatcactcttcatcttgaata 28
             ||||||||||||||||||| ||||
Sbjct: 29033 ggccatcactcttcatctttaata 29010

>dbj|AB040687.1| Rollandina hyalinospora gene for 28S rRNA, partial sequence,
           strain:CBS 548.72
          Length = 562

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 288 aggggacttacgccgcggcc 307
           ||||||||||||||||||||
Sbjct: 134 aggggacttacgccgcggcc 115

>dbj|AB040685.1| Gymnoascoideus petalosporus gene for 28S rRNA, partial sequence,
           strain:CBS 252.72
          Length = 563

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 288 aggggacttacgccgcggcc 307
           ||||||||||||||||||||
Sbjct: 136 aggggacttacgccgcggcc 117


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,041,635
Number of Sequences: 3902068
Number of extensions: 3041635
Number of successful extensions: 53963
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53922
Number of HSP's gapped (non-prelim): 41
length of query: 327
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 305
effective length of database: 17,147,199,772
effective search space: 5229895930460
effective search space used: 5229895930460
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)