ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart28b01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 480 bits (242), Expect = e-132 Identities = 369/412 (89%), Gaps = 17/412 (4%) Strand = Plus / Minus Query: 133 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 185 ||||||||||||||||||||||| || ||||||||||||||||| |||||| || Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873 Query: 186 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 245 |||||||| ||||||||||| |||||||||||||||| ||||| ||||||| Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823 Query: 246 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 305 || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| ||||| Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763 Query: 306 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||| ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703 Query: 366 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 425 | ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643 Query: 426 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 485 |||||| |||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583 Query: 486 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 531 Score = 139 bits (70), Expect = 1e-29 Identities = 96/104 (92%), Gaps = 3/104 (2%) Strand = Plus / Minus Query: 10 tgttcttattgaatcgcataaggaaactcaactgaagaattctcaaaccccaacaacttc 69 |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| Sbjct: 1039 tgttcttattgaatcgcataaggaaactcaactgaaaaattctcaaaccccaccaacttc 980 Query: 70 acaacatcacattatattacagatagagaagcatgcatcatcca 113 ||||||||||||| ||||||||| || | ||||||||||||| Sbjct: 979 acaacatcacatt---ttacagataaaggaacatgcatcatcca 939
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 464 bits (234), Expect = e-127 Identities = 264/274 (96%) Strand = Plus / Minus Query: 264 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 323 |||||||||||||| |||||||| | |||||| |||||||||||||| |||||||||||| Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742 Query: 324 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 383 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682 Query: 384 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 443 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622 Query: 444 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 503 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562 Query: 504 gccgagggatcccttcttggggtcggcggcggtg 537 ||||||||| |||||||||||||||||||||||| Sbjct: 561 gccgagggaacccttcttggggtcggcggcggtg 528
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 460 bits (232), Expect = e-126 Identities = 265/276 (96%) Strand = Plus / Minus Query: 262 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 321 |||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741 Query: 322 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 381 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681 Query: 382 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 441 ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621 Query: 442 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||| Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561 Query: 502 gtgccgagggatcccttcttggggtcggcggcggtg 537 ||||||||||| |||||||||||||||||||||||| Sbjct: 560 gtgccgagggaccccttcttggggtcggcggcggtg 525
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 456 bits (230), Expect = e-125 Identities = 266/278 (95%) Strand = Plus / Minus Query: 260 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 319 |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| |||| Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747 Query: 320 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 379 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687 Query: 380 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 439 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627 Query: 440 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 499 ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567 Query: 500 tggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||||||||||| Sbjct: 566 tggtgccgagggatcccttcttggggtcggcggcggtg 529
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 13250885 ccttcttggggtcggcggcggtg 13250863
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 12695 ccttcttggggtcggcggcggtg 12673
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 168073 ccttcttggggtcggcggcggtg 168051
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 585 ccttcttggggtcggcggcggtg 563
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtg 565
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtg 566
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtg 564
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtg 566
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 347 bits (175), Expect = 2e-92 Identities = 241/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtg 564
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 339 bits (171), Expect = 6e-90 Identities = 240/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtg 565
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 339 bits (171), Expect = 6e-90 Identities = 240/263 (91%) Strand = Plus / Minus Query: 275 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 334 ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| |||||||| Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646 Query: 335 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 394 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586 Query: 395 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 454 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526 Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466 Query: 515 ccttcttggggtcggcggcggtg 537 ||||||||||||||||||||||| Sbjct: 465 ccttcttggggtcggcggcggtg 443
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 216 bits (109), Expect = 6e-53 Identities = 195/221 (88%), Gaps = 2/221 (0%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| || Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704 Query: 378 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 436 || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| |||| Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645 Query: 437 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 496 || |||||| || || ||||||||||||| |||||||||||||||||||||||||| | Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585 Query: 497 cgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||| |||||||||||||||||||||||| Sbjct: 584 cgatggtgccgagggagcccttcttggggtcggcggcggtg 544
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 206 bits (104), Expect = 5e-50 Identities = 191/220 (86%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861 Query: 378 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 437 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801 Query: 438 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 497 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741 Query: 498 gatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||| || |||||||||||||||||||||||| Sbjct: 740 gatggtgccgagcgagcccttcttggggtcggcggcggtg 701
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 206 bits (104), Expect = 5e-50 Identities = 191/220 (86%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860 Query: 378 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 437 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800 Query: 438 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 497 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740 Query: 498 gatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||| || |||||||||||||||||||||||| Sbjct: 739 gatggtgccgagcgagcccttcttggggtcggcggcggtg 700
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 503 agcgatcccttcttcgggtc 484
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Plus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 26627363 agcgatcccttcttcgggtc 26627382
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Plus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 169744 agcgatcccttcttcgggtc 169763
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Plus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 61524 agcgatcccttcttcgggtc 61543
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 576 agcgatcccttcttcgggtc 557
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 378 agcgatcccttcttcgggtc 359
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 182 bits (92), Expect = 8e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 387 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592 Query: 388 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 447 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532 Query: 448 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 507 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472 Query: 508 agggatcccttcttggggtc 527 || ||||||||||| ||||| Sbjct: 250471 agcgatcccttcttcgggtc 250452 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Plus Query: 426 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 485 |||||| |||||| ||| |||||||| ||||||||||||| ||||||||||||||||| Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154 Query: 486 ggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||| |||||||||||||| ||||||||||| ||||| Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtc 332196
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 167 bits (84), Expect = 5e-38 Identities = 174/204 (85%) Strand = Plus / Minus Query: 334 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 393 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698 Query: 394 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 453 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638 Query: 454 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 513 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578 Query: 514 cccttcttggggtcggcggcggtg 537 |||||||| |||||||| |||||| Sbjct: 577 cccttcttcgggtcggccgcggtg 554
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 167 bits (84), Expect = 5e-38 Identities = 174/204 (85%) Strand = Plus / Minus Query: 334 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 393 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680 Query: 394 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 453 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620 Query: 454 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 513 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560 Query: 514 cccttcttggggtcggcggcggtg 537 |||||||| |||||||| |||||| Sbjct: 559 cccttcttcgggtcggccgcggtg 536
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 159 bits (80), Expect = 1e-35 Identities = 173/204 (84%) Strand = Plus / Minus Query: 334 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 393 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621 Query: 394 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 453 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561 Query: 454 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 513 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501 Query: 514 cccttcttggggtcggcggcggtg 537 |||||||| |||||||| |||||| Sbjct: 500 cccttcttcgggtcggccgcggtg 477
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 159 bits (80), Expect = 1e-35 Identities = 173/204 (84%) Strand = Plus / Minus Query: 334 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 393 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689 Query: 394 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 453 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629 Query: 454 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 513 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569 Query: 514 cccttcttggggtcggcggcggtg 537 |||||||| |||||||| |||||| Sbjct: 568 cccttcttcgggtcggccgcggtg 545
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 141 bits (71), Expect = 3e-30 Identities = 122/139 (87%) Strand = Plus / Minus Query: 399 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 458 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | ||||| Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622 Query: 459 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 518 ||||||||| |||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562 Query: 519 cttggggtcggcggcggtg 537 |||||||||| |||||||| Sbjct: 561 cttggggtcgacggcggtg 543 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 139 bits (70), Expect = 1e-29 Identities = 184/222 (82%) Strand = Plus / Minus Query: 316 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 375 ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| || Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716 Query: 376 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 435 | ||||||||| ||||| |||| || ||| |||| ||||| || ||||||||||| ||| Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656 Query: 436 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 495 || ||||||||||| || | | ||||||||| || ||||||||||| || || ||||| Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596 Query: 496 gcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 ||||||||||| ||| |||||||| |||||||| |||||| Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcggctgcggtg 554
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 139 bits (70), Expect = 1e-29 Identities = 118/134 (88%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 ||||| || ||||| ||||| || ||||||||||| |||||| |||||| ||||| || Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 516 ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| ||| Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724 Query: 517 ttcttggggtcggc 530 |||||||||||||| Sbjct: 44723 ttcttggggtcggc 44710 Score = 40.1 bits (20), Expect = 7.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 380 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 431 |||||||||||||| |||| || || ||||| || || || ||||||||||| Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 137 bits (69), Expect = 4e-29 Identities = 177/213 (83%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637 Query: 378 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 437 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577 Query: 438 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 497 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517 Query: 498 gatggtgccgagggatcccttcttggggtcggc 530 || |||||||||||| |||||||| |||||||| Sbjct: 516 gacggtgccgagggaacccttcttcgggtcggc 484
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 137 bits (69), Expect = 4e-29 Identities = 177/213 (83%) Strand = Plus / Plus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542 Query: 378 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 437 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602 Query: 438 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 497 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662 Query: 498 gatggtgccgagggatcccttcttggggtcggc 530 || |||||||||||| |||||||| |||||||| Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcggc 92695
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 137 bits (69), Expect = 4e-29 Identities = 177/213 (83%) Strand = Plus / Plus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 377 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566 Query: 378 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 437 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626 Query: 438 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 497 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686 Query: 498 gatggtgccgagggatcccttcttggggtcggc 530 || |||||||||||| |||||||| |||||||| Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcggc 27568719 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 480 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Plus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 2545002 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||||| |||| | |||||||||||||| || ||||||||| Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||| ||| ||||||||||||||| | |||||| Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgaccgcggtg 559
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 125092 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Plus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 2545112 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 558 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Plus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 411
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 567 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 569 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 93 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 113 bits (57), Expect = 6e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtg 565 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 113 bits (57), Expect = 6e-22 Identities = 111/129 (86%) Strand = Plus / Minus Query: 399 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 458 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | || || Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653 Query: 459 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 518 ||||||||| || ||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593 Query: 519 cttggggtc 527 ||||||||| Sbjct: 592 cttggggtc 584 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||||||||||||||||||||| ||| |||||||| ||||| Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 462 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412 Query: 463 ttggccccgacgatgaagccga 484 ||||| ||||||| || ||||| Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 456 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574 Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 501 ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 93.7 bits (47), Expect = 6e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||||| |||| | || ||||||||||| || ||||||||| Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||||||||||||||||||||| ||| |||||||| ||||| Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 587 Score = 48.1 bits (24), Expect = 0.030 Identities = 42/48 (87%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 93.7 bits (47), Expect = 6e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||| ||||||||||||||||| ||| |||||||| ||||| Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 586 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 93.7 bits (47), Expect = 6e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630 Query: 481 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||| ||||||||||||||||| ||| |||||||| ||||| Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 583 Score = 48.1 bits (24), Expect = 0.030 Identities = 42/48 (87%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 365 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 91.7 bits (46), Expect = 2e-15 Identities = 91/106 (85%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638 Query: 419 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 464 | |||||||| || || |||||||| ||||||||| | |||||||| Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 85.7 bits (43), Expect = 1e-13 Identities = 64/71 (90%) Strand = Plus / Minus Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 516 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518 Query: 517 ttcttggggtc 527 ||||||||||| Sbjct: 517 ttcttggggtc 507
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 85.7 bits (43), Expect = 1e-13 Identities = 64/71 (90%) Strand = Plus / Plus Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 516 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493 Query: 517 ttcttggggtc 527 ||||||||||| Sbjct: 494 ttcttggggtc 504
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 83.8 bits (42), Expect = 5e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596 Query: 419 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 464 | |||||||| || || |||||||| ||||| ||| | |||||||| Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 83.8 bits (42), Expect = 5e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 ||||||||||||| ||| | |||||||||| || || || || || ||||| ||||| | Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633 Query: 419 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 478 | ||||||||||| || || ||||| || || || | | ||||||||| || || |||| Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573 Query: 479 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggt 536 |||||||||| ||||| || ||||| ||||| ||||||||||| ||||| || ||||| Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtcagctgcggt 515
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 590 Query: 535 gtg 537 ||| Sbjct: 589 gtg 587
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Plus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 1285 Query: 535 gtg 537 ||| Sbjct: 1286 gtg 1288
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 480 Query: 535 gtg 537 ||| Sbjct: 479 gtg 477
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 551 Query: 535 gtg 537 ||| Sbjct: 550 gtg 548
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 528 Query: 535 gtg 537 ||| Sbjct: 527 gtg 525
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 533 Query: 535 gtg 537 ||| Sbjct: 532 gtg 530
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 530 Query: 535 gtg 537 ||| Sbjct: 529 gtg 527
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 552 Query: 535 gtg 537 ||| Sbjct: 551 gtg 549
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 19379 Query: 535 gtg 537 ||| Sbjct: 19378 gtg 19376
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 497 Query: 535 gtg 537 ||| Sbjct: 496 gtg 494
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 77.8 bits (39), Expect = 3e-11 Identities = 102/123 (82%) Strand = Plus / Minus Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 474 ||||| ||||||||||| || || ||||| || ||||| | ||||||||||| |||||| Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581 Query: 475 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 534 |||| || ||||||| ||| |||||||| ||||| || ||||| ||||| || |||||| Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttgggatcagcggcg 521 Query: 535 gtg 537 ||| Sbjct: 520 gtg 518
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 459 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 518 ||||||||| || || |||||||||||||| ||||| || ||||| ||||| |||||||| Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230 Query: 519 cttggggtcggcggcggt 536 ||| ||||| || ||||| Sbjct: 229 ctttgggtcagctgcggt 212
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 457 aggatgttggccccgacgatgaagccgatggcgatgggggcgat 500 |||||||||||||| |||||||||||||| |||||||| ||||| Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 63.9 bits (32), Expect = 5e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 459 ||||| ||||||||||| || ||||||||||| || || ||||| |||||||| | | | Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637 Query: 460 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 519 |||||||| || || ||||| || || || |||||||| |||||||| | || ||| || Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577 Query: 520 ttggggtc 527 |||||||| Sbjct: 576 ttggggtc 569
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538 Query: 515 ccttctt 521 | ||||| Sbjct: 537 ctttctt 531
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500 Query: 515 ccttctt 521 | ||||| Sbjct: 499 ctttctt 493
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528 Query: 515 ccttctt 521 | ||||| Sbjct: 527 ctttctt 521
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 61.9 bits (31), Expect = 2e-06 Identities = 112/139 (80%) Strand = Plus / Minus Query: 340 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 399 ||||||| ||||||||| |||||||| |||| ||| || |||| ||| |||| | | Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766 Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 459 || |||||||| |||||||| ||||||||||| |||||| |||| |||| | ||||| Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706 Query: 460 atgttggccccgacgatga 478 ||||||| |||||||||| Sbjct: 705 ctgttggcgccgacgatga 687
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706 Query: 515 ccttctt 521 | ||||| Sbjct: 8707 ctttctt 8713
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 462 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549 Query: 463 ttggccccgacgatgaagccga 484 ||||| ||||||| || ||||| Sbjct: 548 ttggcgccgacgacgaggccga 527
>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds Length = 1072 Score = 60.0 bits (30), Expect = 8e-06 Identities = 81/98 (82%) Strand = Plus / Minus Query: 355 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 414 ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660 Query: 415 cgtgcagggttcatggaaccgccggagaaggggccggc 452 || || || ||||| || || |||||||| |||||||| Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 462 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842 Query: 463 ttggccccgacgatgaagccga 484 ||||| ||||||| || ||||| Sbjct: 98841 ttggcgccgacgacgaggccga 98820
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 462 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552 Query: 463 ttggccccgacgatgaagccga 484 ||||| ||||||| || ||||| Sbjct: 551 ttggcgccgacgacgaggccga 530
>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial cds Length = 2235 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 436 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 495 |||||||| || ||||| ||||||||||||| || ||||| | || ||||||| || Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169 Query: 496 gcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||| ||||| || ||||||||||| || ||||||||| Sbjct: 2168 gcgatggttccgagagaacccttcttgggatcagcggcggtg 2127
>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds Length = 1049 Score = 60.0 bits (30), Expect = 8e-06 Identities = 141/178 (79%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| ||| | |||||| ||||| | || || || ||||| ||||| | Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677 Query: 419 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 478 | |||| |||||| || || ||||| ||||| ||| | | |||||||| || || |||| Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617 Query: 479 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggt 536 | || ||||| ||||| || |||||||| || ||||| ||||||||||| || ||||| Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtcagctgcggt 559
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 459 ||||||||||| ||||| || ||||||||||| ||||||||||||| ||| | |||| Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649 Query: 460 atgttggccccgacga 475 | |||||| ||||||| Sbjct: 648 acgttggcgccgacga 633
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 ||||| |||||||| ||||||||||||||||||||| Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 459 gatgttggccccgacgatgaagccgatggcgatggg 494 ||||||||| |||||||||||||||||||| ||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 54.0 bits (27), Expect = 5e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| |||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684 Query: 515 ccttctt 521 | ||||| Sbjct: 123683 ctttctt 123677
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 469 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||||||||||||||||||||| || || ||||| |||| || |||||||||||||| Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 480 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||| Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtg 559 Score = 40.1 bits (20), Expect = 7.3 Identities = 47/56 (83%) Strand = Plus / Minus Query: 317 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||||||||||| | | | |||| || |||||| |||||||||||||| Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 480 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||| Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtg 247
>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1, complete cds Length = 1001 Score = 50.1 bits (25), Expect = 0.008 Identities = 133/169 (78%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| |||||||||||| ||| | |||| ||||||||||| || | Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648 Query: 419 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 478 | |||||||| |||||||| || ||||||||| | | ||||||||| || || |||| Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588 Query: 479 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 527 |||| || || ||||| || || |||| | |||||||| |||||||| Sbjct: 587 agcctattgcaatgggtgcaataatgcccaatgatccctttttggggtc 539
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Minus Query: 459 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 518 ||||||||| |||||||| |||||||||||||| || || || ||||| | | ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262 Query: 519 cttggggtc 527 ||||||||| Sbjct: 261 cttggggtc 253
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.008 Identities = 55/65 (84%) Strand = Plus / Minus Query: 463 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 522 ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258 Query: 523 gggtc 527 ||||| Sbjct: 257 gggtc 253
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 48.1 bits (24), Expect = 0.030 Identities = 39/44 (88%) Strand = Plus / Minus Query: 460 atgttggccccgacgatgaagccgatggcgatgggggcgatggt 503 |||||||| ||||||||||| ||||| || ||||| |||||||| Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggt 537
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 48.1 bits (24), Expect = 0.030 Identities = 33/36 (91%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 ||||| ||||| || ||||||||||||||||||||| Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 48.1 bits (24), Expect = 0.030 Identities = 45/52 (86%) Strand = Plus / Minus Query: 380 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 431 |||||| ||||||| | ||||| |||||||| ||||| || ||||||||||| Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.030 Identities = 33/36 (91%) Strand = Plus / Minus Query: 464 tggccccgacgatgaagccgatggcgatgggggcga 499 |||| ||||||||||||||| || |||||||||||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981
>ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1812 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 877 agatgttggtgaagtcgccgctg 855
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11, complete sequence Length = 169728 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 59831 agatgttggtgaagtcgccgctg 59853
>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05, complete sequence Length = 158601 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 106408 agatgttggtgaagtcgccgctg 106430
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 327 gccggcgaggccaccgccgatga 349 ||||||||||||||||||||||| Sbjct: 505313 gccggcgaggccaccgccgatga 505291 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 gccggcgaggccaccgccga 346 |||||||||||||||||||| Sbjct: 1274146 gccggcgaggccaccgccga 1274165
>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full insert sequence Length = 1679 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 371 agatgttggtgaagtcgccgctg 393 ||||||||||||||||||||||| Sbjct: 794 agatgttggtgaagtcgccgctg 816
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 318 gtagacgatgccggcgaggccaccgccgatg 348 ||||| || |||||||||||||||||||||| Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592
>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds Length = 992 Score = 46.1 bits (23), Expect = 0.12 Identities = 104/131 (79%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 462 ||||||||||| || || |||||||| || || ||| ||| ||||| ||| | | ||| Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580 Query: 463 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 522 ||||| || |||||||| || ||||| ||||| || |||||||| || || ||||| ||| Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520 Query: 523 gggtcggcggc 533 || || ||||| Sbjct: 519 ggatccgcggc 509
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 44.1 bits (22), Expect = 0.47 Identities = 40/46 (86%) Strand = Plus / Minus Query: 399 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 444 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 44.1 bits (22), Expect = 0.47 Identities = 40/46 (86%) Strand = Plus / Minus Query: 399 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 444 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528
>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip gene) Length = 1101 Score = 44.1 bits (22), Expect = 0.47 Identities = 43/50 (86%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 452 ||||||||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664
>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 44.1 bits (22), Expect = 0.47 Identities = 37/42 (88%) Strand = Plus / Minus Query: 496 gcgatggtgccgagggatcccttcttggggtcggcggcggtg 537 |||||||| ||||| || ||||||||||| || ||||||||| Sbjct: 573 gcgatggttccgagagaacccttcttgggatcagcggcggtg 532
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 459 gatgttggccccgacgatgaagccgatggc 488 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 459 gatgttggccccgacgatgaagccgatggc 488 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340 (DELTA-TIP2/TIP2;2) mRNA, complete cds Length = 977 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599 Query: 481 ccgat 485 ||||| Sbjct: 598 ccgat 594
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 328 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 372 ||||||| |||||||||| ||| || ||||||||||||| |||| Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661
>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaac 433 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaac 433 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551), mRNA Length = 1556 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 444 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750
>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7, complete sequence Length = 168673 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 67 ttcacaacatcacattatatt 87 ||||||||||||||||||||| Sbjct: 78807 ttcacaacatcacattatatt 78827
>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein mRNA, partial cds Length = 770 Score = 42.1 bits (21), Expect = 1.8 Identities = 69/85 (81%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425 Query: 419 cagggttcatggaaccgccggagaa 443 |||||||||| || ||||| ||||| Sbjct: 424 cagggttcattgagccgccagagaa 400
>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA, partial cds Length = 684 Score = 42.1 bits (21), Expect = 1.8 Identities = 69/85 (81%) Strand = Plus / Minus Query: 359 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 418 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338 Query: 419 cagggttcatggaaccgccggagaa 443 |||||||||| || ||||| ||||| Sbjct: 337 cagggttcattgagccgccagagaa 313
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802 Query: 481 ccgat 485 ||||| Sbjct: 64801 ccgat 64797
>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein Length = 991 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 gggccggcccagtagatccag 372 ||||||||||||||||||||| Sbjct: 655 gggccggcccagtagatccag 635
>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7 Length = 349213 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 515 ccttcttggggtcggcggcgg 535 ||||||||||||||||||||| Sbjct: 320884 ccttcttggggtcggcggcgg 320864
>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46 Length = 198788 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167 Query: 481 ccgat 485 ||||| Sbjct: 54166 ccgat 54162
>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 753 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534 Query: 481 ccgat 485 ||||| Sbjct: 533 ccgat 529
>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 972 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596 Query: 481 ccgat 485 ||||| Sbjct: 595 ccgat 591
>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230090D02 product:aquaporin 6, full insert sequence Length = 2066 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaac 433 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 42.1 bits (21), Expect = 1.8 Identities = 60/73 (82%) Strand = Plus / Minus Query: 455 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 514 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | | Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389 Query: 515 ccttcttggggtc 527 | ||||||||||| Sbjct: 388 cgttcttggggtc 376
>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 954 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582 Query: 481 ccgat 485 ||||| Sbjct: 581 ccgat 577
>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 936 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557 Query: 481 ccgat 485 ||||| Sbjct: 556 ccgat 552
>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence Length = 969 Score = 42.1 bits (21), Expect = 1.8 Identities = 54/65 (83%) Strand = Plus / Minus Query: 421 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 480 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600 Query: 481 ccgat 485 ||||| Sbjct: 599 ccgat 595
>ref|XM_236362.3| PREDICTED: Rattus norvegicus hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 (predicted) (Herc1_predicted), mRNA Length = 15132 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 10 tgttcttattgaatcgcataaggaaactc 38 |||||||||||| ||||||||||||||| Sbjct: 10797 tgttcttattgatgcgcataaggaaactc 10825
>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene) Length = 535 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 444 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490
>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence Length = 2291 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Plus Query: 400 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 444 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271
>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence Length = 182415 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Plus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaac 433 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581
>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA Length = 2066 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 397 acggcggggccgaatgagcgtgcagggttcatggaac 433 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AC165149.5| Mus musculus BAC clone RP24-114C10 from chromosome 13, complete sequence Length = 191162 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ggaaactcaactgaagaatt 50 |||||||||||||||||||| Sbjct: 13923 ggaaactcaactgaagaatt 13942
>ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform (PPP2R2C), transcript variant 1, mRNA Length = 4117 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 3856 aaaccccaacaacttcacaa 3837
>ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform (PPP2R2C), transcript variant 2, mRNA Length = 4087 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 3826 aaaccccaacaacttcacaa 3807
>gb|AC121551.11| Mus musculus chromosome 1, clone RP24-144H23, complete sequence Length = 168683 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 ggaaactcaactgaagaatt 50 |||||||||||||||||||| Sbjct: 136133 ggaaactcaactgaagaatt 136114
>gb|AC147922.2| Xenopus tropicalis clone CH216-98P3, complete sequence Length = 171597 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 ttcttattgaatcgcataag 31 |||||||||||||||||||| Sbjct: 92152 ttcttattgaatcgcataag 92171
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 ggcatcatggaaaccaaaca 238 |||||||||||||||||||| Sbjct: 113843 ggcatcatggaaaccaaaca 113824
>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507837.100) partial mRNA Length = 4953 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 480 gccgatggcgatgggggcgatggt 503 ||||||| |||||||||||||||| Sbjct: 4372 gccgatgacgatgggggcgatggt 4395
>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence Length = 138303 Score = 40.1 bits (20), Expect = 7.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 403 gggccgaatgagcgtgcagggttcatggaacc 434 |||||||||||||| || |||||||| ||||| Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913
>gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosome 6, complete sequence Length = 212735 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 57462 aaaccccaacaacttcacaa 57481
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete cds Length = 787 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma, aquaporin (At2g36830) mRNA, complete cds Length = 1030 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706
>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene Length = 993 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690
>gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:4816112) Length = 1172 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 918 aaaccccaacaacttcacaa 899
>gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:5300526) Length = 2161 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 1900 aaaccccaacaacttcacaa 1881
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 gccggcgaggccaccgccga 346 |||||||||||||||||||| Sbjct: 4535021 gccggcgaggccaccgccga 4535040
>dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788 Length = 1737 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 1499 aaaccccaacaacttcacaa 1480
>gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, complete sequence Length = 191656 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 50 tctcaaaccccaacaacttcacaa 73 ||||||||||||||| |||||||| Sbjct: 107696 tctcaaaccccaacaccttcacaa 107719
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence Length = 134151 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete sequence Length = 222430 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tctgaaccaaacaacatgac 159 |||||||||||||||||||| Sbjct: 111593 tctgaaccaaacaacatgac 111574
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 329 cggcgaggccaccgccgatg 348 |||||||||||||||||||| Sbjct: 1656225 cggcgaggccaccgccgatg 1656206
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 516 cttcttggggtcggcggcgg 535 |||||||||||||||||||| Sbjct: 10869674 cttcttggggtcggcggcgg 10869655
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1009 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZD11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 975 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB5ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB18ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS84ZH08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683
>gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-367K14, complete sequence Length = 108667 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 32732 aaaccccaacaacttcacaa 32713
>gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, complete sequence Length = 160943 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 aaaccccaacaacttcacaa 73 |||||||||||||||||||| Sbjct: 82311 aaaccccaacaacttcacaa 82330
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence Length = 1042 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete sequence Length = 90348 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 340 ccgccgatgagcgggccggc 359 |||||||||||||||||||| Sbjct: 7090 ccgccgatgagcgggccggc 7109
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 516 cttcttggggtcggcggcgg 535 |||||||||||||||||||| Sbjct: 93397 cttcttggggtcggcggcgg 93378
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 7.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 472 acgatgaagccgatggcgatgggggcga 499 |||||||||||||| |||| |||||||| Sbjct: 4744058 acgatgaagccgatcgcgacgggggcga 4744085
>dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0698G06 Length = 138282 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 516 cttcttggggtcggcggcgg 535 |||||||||||||||||||| Sbjct: 9379 cttcttggggtcggcggcgg 9360
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 ||||||||||| | || |||||||||||||||||| Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748
>dbj|AK101995.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033079I19, full insert sequence Length = 1652 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 516 cttcttggggtcggcggcgg 535 |||||||||||||||||||| Sbjct: 101 cttcttggggtcggcggcgg 82
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 caccgccgatgagcgggccg 357 |||||||||||||||||||| Sbjct: 557849 caccgccgatgagcgggccg 557868
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 40.1 bits (20), Expect = 7.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 471 gacgatgaagccgatggcgatggg 494 ||||||| |||||||||||||||| Sbjct: 1047164 gacgatgtagccgatggcgatggg 1047141
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tctgaaccaaacaacatgac 159 |||||||||||||||||||| Sbjct: 1893522 tctgaaccaaacaacatgac 1893503
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene, complete cds Length = 1398 Score = 40.1 bits (20), Expect = 7.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 337 ccaccgccgatgagcgggccggcccagtagatccag 372 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,090,626 Number of Sequences: 3902068 Number of extensions: 4090626 Number of successful extensions: 77815 Number of sequences better than 10.0: 183 Number of HSP's better than 10.0 without gapping: 177 Number of HSP's successfully gapped in prelim test: 9 Number of HSP's that attempted gapping in prelim test: 76598 Number of HSP's gapped (non-prelim): 1200 length of query: 537 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 514 effective length of database: 17,143,297,704 effective search space: 8811655019856 effective search space used: 8811655019856 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
