ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart28a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479492.1| Oryza sativa (japonica cultivar-group), mRNA 174 1e-40
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
3dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
4dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
5dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
6gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence 155 1e-34
7gb|AY106208.1| Zea mays PCO085865 mRNA sequence 155 1e-34
8gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal ... 137 3e-29
9gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence 131 2e-27
10gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 131 2e-27
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
12gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome... 131 2e-27
13dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
14gb|AY104839.1| Zea mays PCO137857 mRNA sequence 131 2e-27
15gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome... 115 1e-22
16dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
17dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
18dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
19dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
20ref|NM_185271.1| Oryza sativa (japonica cultivar-group), predic... 113 4e-22
21gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, com... 98 2e-17
22ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L... 84 3e-13
23gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC... 84 3e-13
24gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com... 84 3e-13
25emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Co... 84 3e-13
26emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Co... 84 3e-13
27gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal ... 84 3e-13
28gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com... 82 1e-12
29emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA 78 2e-11
30emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA 78 2e-11
31emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA 78 2e-11
32emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA 78 2e-11
33emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA 78 2e-11
34emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA 78 2e-11
35emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA 78 2e-11
36emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA 78 2e-11
37emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA 78 2e-11
38emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA 78 2e-11
39emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA 78 2e-11
40emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA 78 2e-11
41emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA 78 2e-11
42emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA 78 2e-11
43emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA 78 2e-11
44emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA 78 2e-11
45emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA 78 2e-11
46emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA 78 2e-11
47emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA 78 2e-11
48emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA 78 2e-11
49emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA 78 2e-11
50emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA 78 2e-11
51emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA 78 2e-11
52emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA 78 2e-11
53emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA 78 2e-11
54emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA 78 2e-11
55emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA 78 2e-11
56emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA 78 2e-11
57emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA 78 2e-11
58emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA 78 2e-11
59emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA 78 2e-11
60emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA 78 2e-11
61emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA 78 2e-11
62emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA 78 2e-11
63emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA 78 2e-11
64emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA 78 2e-11
65emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA 78 2e-11
66emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA 78 2e-11
67emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA 78 2e-11
68emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA 78 2e-11
69emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA 78 2e-11
70emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA 78 2e-11
71emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA 78 2e-11
72emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA 78 2e-11
73emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA 78 2e-11
74emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA 78 2e-11
75emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA 78 2e-11
76emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA 78 2e-11
77emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA 78 2e-11
78emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA 78 2e-11
79emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA 78 2e-11
80emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA 78 2e-11
81emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA 78 2e-11
82emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA 78 2e-11
83emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA 78 2e-11
84emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA 78 2e-11
85emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA 78 2e-11
86emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA 78 2e-11
87emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA 78 2e-11
88emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA 78 2e-11
89emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA 78 2e-11
90gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b riboso... 78 2e-11
91gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a riboso... 78 2e-11
92emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA 74 3e-10
93emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA 74 3e-10
94emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA 74 3e-10
95emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA 74 3e-10
96emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA 74 3e-10
97gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence 72 1e-09
98gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cD... 70 5e-09
99emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA 70 5e-09
100emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA 70 5e-09
101emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA 70 5e-09
102emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA 70 5e-09
103emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA 70 5e-09
104emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA 70 5e-09
105ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18)... 70 5e-09
106gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds 70 5e-09
107gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872... 68 2e-08
108ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA 68 2e-08
109emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
110gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds 66 8e-08
111emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA 66 8e-08
112emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ri... 66 8e-08
113ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal... 64 3e-07
114emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 riboso... 64 3e-07
115ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal... 62 1e-06
116gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete... 62 1e-06
117ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal pr... 62 1e-06
118ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal pr... 62 1e-06
119ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal pr... 62 1e-06
120dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-1395... 62 1e-06
121dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full ... 62 1e-06
122ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA 56 8e-05
123gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial... 56 8e-05
124gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 56 8e-05
125gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) g... 56 8e-05
126gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNI... 56 8e-05
127gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 56 8e-05
128emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cell... 56 8e-05
129emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta ... 56 8e-05
130emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta ... 56 8e-05
131emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblas... 56 8e-05
132emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liv... 56 8e-05
133emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liv... 56 8e-05
134emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblas... 56 8e-05
135emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblas... 56 8e-05
136emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta ... 56 8e-05
137emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (... 56 8e-05
138emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal bra... 56 8e-05
139emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta ... 56 8e-05
140emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblas... 56 8e-05
141emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (... 56 8e-05
142emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta ... 56 8e-05
143emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7 56 8e-05
144emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18 56 8e-05
145dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654,... 56 8e-05
146gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 56 8e-05
147emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-9... 56 8e-05
148gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence 56 8e-05
149gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)... 56 8e-05
150gb|AC009517.6| Homo sapiens chromosome 7 clone RP11-181K7, compl... 54 3e-04
151emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on ch... 54 3e-04
152gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mR... 52 0.001
153emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribo... 52 0.001
154gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, comple... 52 0.001
155gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ... 50 0.005
156gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom... 50 0.005
157gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 50 0.005
158ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA 50 0.005
159ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA 50 0.005
160ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribos... 50 0.005
161dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.005
162dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.005
163gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clon... 50 0.005
164dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 50 0.005
165dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 50 0.005
166dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 50 0.005
167dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells ... 50 0.005
168dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 50 0.005
169dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length en... 50 0.005
170dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-... 50 0.005
171dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIK... 50 0.005
172dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-... 50 0.005
173gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701... 50 0.005
174gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715... 50 0.005
175gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 50 0.005
176emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chr... 50 0.005
177gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, c... 50 0.005
178gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 50 0.005
179gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 50 0.005
180ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (... 50 0.005
181gb|AF240376.1|AF240376 Tilapia mossambica ribosomal protein L18 ... 48 0.019
182gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150... 48 0.019
183ref|NM_070254.2| Caenorhabditis elegans Ribosomal Protein, Large... 48 0.019
184gb|AC011194.15|AC011194 Mus musculus chromosome 11, clone RP23-1... 48 0.019
185gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200... 48 0.019
186emb|AL021492.1|CEY45F10D Caenorhabditis elegans YAC Y45F10D, com... 48 0.019
187emb|AL645478.15| Mouse DNA sequence from clone RP23-85A17 on chr... 48 0.019
188gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal ... 46 0.075
189ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosoma... 46 0.075
190ref|XM_541138.2| PREDICTED: Canis familiaris similar to ribosoma... 46 0.075
191gb|AF159901.1|AF159901 Lapemis hardwickii ribosomal protein L14 ... 46 0.075
192dbj|AK221052.1| Arabidopsis thaliana mRNA for hypothetical prote... 46 0.075
193gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can... 46 0.075
194ref|XM_533629.2| PREDICTED: Canis familiaris similar to ribosoma... 44 0.30
195gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, c... 44 0.30
196gb|AC136191.5| Rattus norvegicus BAC CH230-52I17 (Children's Ho... 44 0.30
197gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal ... 44 0.30
198gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, co... 44 0.30
199emb|AL162382.13| Human DNA sequence from clone RP11-248J2 on chr... 42 1.2
200ref|XM_787988.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.2
201gb|AC023781.5| Homo sapiens chromosome 8, clone RP11-149P24, com... 42 1.2
202dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L... 42 1.2
203gb|L41708.1|PS300427E Eucalyptus globulus bicostata symbiont (F0... 42 1.2
204gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map ... 40 4.6
205emb|BX927325.15| Zebrafish DNA sequence from clone DKEYP-47G1 in... 40 4.6
206ref|XM_742113.1| Aspergillus fumigatus Af293 U5 snRNP component ... 40 4.6
207gb|AC122033.5| Mus musculus BAC clone RP24-403A7 from chromosome... 40 4.6
208gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosom... 40 4.6
209emb|AL360011.19| Human DNA sequence from clone RP11-103A2 on chr... 40 4.6
210emb|AL022578.1|HS393P12 Human DNA sequence from clone RP3-393P12... 40 4.6
211gb|AY143579.1| Styrax foveolaria internal transcribed spacer 1, ... 40 4.6
212gb|AC111120.12| Mus musculus chromosome 7, clone RP23-225M4, com... 40 4.6
213emb|BX530057.5| Zebrafish DNA sequence from clone DKEY-48O24 in ... 40 4.6
214gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470... 40 4.6
215gb|AY130355.1| Myxine glutinosa ribosomal protein L18 mRNA, part... 40 4.6
216gb|AF401572.1| Ictalurus punctatus ribosomal protein L18 mRNA, c... 40 4.6
217ref|XM_578444.1| PREDICTED: Rattus norvegicus similar to Ab2-162... 40 4.6
218emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, ... 40 4.6
219gb|AC115850.11| Mus musculus chromosome 7, clone RP24-252O10, co... 40 4.6
220emb|BX682529.6| Zebrafish DNA sequence from clone CH211-194P13 i... 40 4.6
221emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 i... 40 4.6
222gb|AC004107.1|AC004107 Human Cosmid g1248a010 from 7q31.3, compl... 40 4.6
223emb|AJ509090.1|HSA509090 Homo sapiens WASF4 gene for Wiskott-Ald... 40 4.6

>ref|XM_479492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 850

 Score =  174 bits (88), Expect = 1e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 254
           ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 626 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 567

                                                                       
Query: 255 tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 314
           | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 566 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 507

                                               
Query: 315 agtgcctaacagcttccctggcgttcttgggacccc 350
           ||||| ||||||||||||| ||||||||||||||||
Sbjct: 506 agtgcttaacagcttccctagcgttcttgggacccc 471



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  174 bits (88), Expect = 1e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                            
Query: 195      ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 254
                ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 28486302 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 28486243

                                                                            
Query: 255      tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 314
                | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 28486242 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 28486183

                                                    
Query: 315      agtgcctaacagcttccctggcgttcttgggacccc 350
                ||||| ||||||||||||| ||||||||||||||||
Sbjct: 28486182 agtgcttaacagcttccctagcgttcttgggacccc 28486147



to top

>dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0037D09
          Length = 140470

 Score =  174 bits (88), Expect = 1e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                         
Query: 195   ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 254
             ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 52054 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 51995

                                                                         
Query: 255   tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 314
             | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 51994 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 51935

                                                 
Query: 315   agtgcctaacagcttccctggcgttcttgggacccc 350
             ||||| ||||||||||||| ||||||||||||||||
Sbjct: 51934 agtgcttaacagcttccctagcgttcttgggacccc 51899



to top

>dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0618H09
          Length = 142306

 Score =  174 bits (88), Expect = 1e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                         
Query: 195   ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 254
             ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 43843 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 43784

                                                                         
Query: 255   tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 314
             | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 43783 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 43724

                                                 
Query: 315   agtgcctaacagcttccctggcgttcttgggacccc 350
             ||||| ||||||||||||| ||||||||||||||||
Sbjct: 43723 agtgcttaacagcttccctagcgttcttgggacccc 43688



to top

>dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060D13, full
           insert sequence
          Length = 850

 Score =  174 bits (88), Expect = 1e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccacagcttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcc 254
           ||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||||||
Sbjct: 626 ccacaacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttcc 567

                                                                       
Query: 255 tgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaa 314
           | ||||| ||||| ||||||||||| |||| |||||| || |||||||||||   |||||
Sbjct: 566 ttccctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaa 507

                                               
Query: 315 agtgcctaacagcttccctggcgttcttgggacccc 350
           ||||| ||||||||||||| ||||||||||||||||
Sbjct: 506 agtgcttaacagcttccctagcgttcttgggacccc 471



to top

>gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence
          Length = 786

 Score =  155 bits (78), Expect = 1e-34
 Identities = 132/150 (88%)
 Strand = Plus / Plus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 185 cttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccct 244

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           | ||||| ||||| ||||||||||||||||| ||||||||||| ||    || |||||||
Sbjct: 245 tcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgcc 304

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | ||||||||||| |||||||| |||||||
Sbjct: 305 tgacagcttccctagcgttcttaggacccc 334



to top

>gb|AY106208.1| Zea mays PCO085865 mRNA sequence
          Length = 1008

 Score =  155 bits (78), Expect = 1e-34
 Identities = 132/150 (88%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 613 cttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccct 554

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           | ||||| ||||| ||||||||||||||||| ||||||||||| ||    || |||||||
Sbjct: 553 tcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgcc 494

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | ||||||||||| |||||||| |||||||
Sbjct: 493 tgacagcttccctagcgttcttaggacccc 464



to top

>gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal protein L18 mRNA,
           partial cds
          Length = 527

 Score =  137 bits (69), Expect = 3e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccctt 261
           |||||||||||| || | |||||||||||| || |  ||||||||||| ||||| |||||
Sbjct: 318 ttaaaccttgaatccacggctgttcctcctgccacgagccttctcgaacttccttccctt 259

                                                                       
Query: 262 ggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcct 321
           |||||| ||||||||||||||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 258 ggagcgcacatatggcttggtgtggctgtgtggcacgccaggagccttgccaaagtgcct 199

                                        
Query: 322 aacagcttccctggcgttcttgggacccc 350
            || || || | ||| |||||||| ||||
Sbjct: 198 caccgcctcacgggcattcttggggcccc 170



to top

>gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence
          Length = 772

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 608 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 549

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||||||||||||||||||||| |||||||| ||||| ||||| |||||||
Sbjct: 548 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 489

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || || || | ||| |||||||| ||||
Sbjct: 488 tcaccgcctcacgggcattcttggggcccc 459



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Plus

                                                                            
Query: 201      cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
                |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 12690609 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 12690668

                                                                            
Query: 261      tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
                | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 12690669 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 12690728

                                              
Query: 321      taacagcttccctggcgttcttgggacccc 350
                | || ||||||||||||||||| |||||||
Sbjct: 12690729 tcactgcttccctggcgttcttaggacccc 12690758



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Plus

                                                                            
Query: 201      cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
                |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 12687372 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 12687431

                                                                            
Query: 261      tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
                | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 12687432 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 12687491

                                              
Query: 321      taacagcttccctggcgttcttgggacccc 350
                | || ||||||||||||||||| |||||||
Sbjct: 12687492 tcactgcttccctggcgttcttaggacccc 12687521



to top

>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0050D18, complete sequence
          Length = 126350

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Plus

                                                                         
Query: 201   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
             |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 45062 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 45121

                                                                         
Query: 261   tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
             | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 45122 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 45181

                                           
Query: 321   taacagcttccctggcgttcttgggacccc 350
             | || ||||||||||||||||| |||||||
Sbjct: 45182 tcactgcttccctggcgttcttaggacccc 45211



to top

>dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037B18, full
           insert sequence
          Length = 769

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||||||  ||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 608 cttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttccct 549

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           | ||||| || || |||||||||| ||||||||||||||| |||||    ||||||||| 
Sbjct: 548 ttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtgct 489

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || ||||||||||||||||| |||||||
Sbjct: 488 tcactgcttccctggcgttcttaggacccc 459



to top

>gb|AY104839.1| Zea mays PCO137857 mRNA sequence
          Length = 1127

 Score =  131 bits (66), Expect = 2e-27
 Identities = 129/150 (86%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 833 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 774

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||||||||||||||||||||| |||||||| ||||| ||||| |||||||
Sbjct: 773 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 714

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || || || | ||| |||||||| ||||
Sbjct: 713 tcaccgcctcacgggcattcttggggcccc 684



to top

>gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0431G05,
             complete sequence
          Length = 145044

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                         
Query: 201   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
             |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 49877 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 49818

                                                                         
Query: 261   tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
             ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 49817 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 49758

                                           
Query: 321   taacagcttccctggcgttcttgggacccc 350
             | || || || | ||| |||||||||||||
Sbjct: 49757 tgacggcctcacgggcattcttgggacccc 49728



to top

>dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-C09, full
           insert sequence
          Length = 839

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 631 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 572

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 571 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 512

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || || || | ||| |||||||||||||
Sbjct: 511 tgacggcctcacgggcattcttgggacccc 482



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                           
Query: 201     cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
               |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 3172160 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 3172101

                                                                           
Query: 261     tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
               ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 3172100 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 3172041

                                             
Query: 321     taacagcttccctggcgttcttgggacccc 350
               | || || || | ||| |||||||||||||
Sbjct: 3172040 tgacggcctcacgggcattcttgggacccc 3172011



to top

>dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027I12, full
           insert sequence
          Length = 997

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 632 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 573

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 572 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 513

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || || || | ||| |||||||||||||
Sbjct: 512 tgacggcctcacgggcattcttgggacccc 483



to top

>dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108L02, full
           insert sequence
          Length = 824

 Score =  115 bits (58), Expect = 1e-22
 Identities = 127/150 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||| |||||||| || | |||||||||||| || |  ||||||||||| ||||| ||||
Sbjct: 632 cttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccct 573

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct: 572 tggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcc 513

                                         
Query: 321 taacagcttccctggcgttcttgggacccc 350
           | || || || | ||| |||||||||||||
Sbjct: 512 tgacggcctcacgggcattcttgggacccc 483



to top

>ref|NM_185271.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 567

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 206 accttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgcccttggag 265
           |||||||| || | |||||||||||| || |  ||||||||||| ||||| |||||||||
Sbjct: 563 accttgaatccacggctgttcctcctgccacgggccttctcgaacttccttcccttggag 504

                                                                       
Query: 266 cggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcctaaca 325
           || ||||||||||| ||||||||||| ||||| || ||||| || ||||||||||| || 
Sbjct: 503 cgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcctgacg 444

                                    
Query: 326 gcttccctggcgttcttgggacccc 350
           || || | ||| |||||||||||||
Sbjct: 443 gcctcacgggcattcttgggacccc 419



to top

>gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, complete cds
          Length = 793

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 103/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           |||||||||||||||| | |||||||||||| || |   ||||||| || ||||| ||||
Sbjct: 591 cttaaaccttgaagccacggctgttcctcctaccacgaaccttctcaaacttcctaccct 532

                                                                       
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcc 320
           ||||||| ||||| ||||||||||||||||| ||||| || || || ||||| |||||||
Sbjct: 531 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggcgccttgccgaagtgcc 472

            
Query: 321 t 321
           |
Sbjct: 471 t 471



to top

>ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L18); structural
           constituent of ribosome AT3G05590 (RPL18) mRNA, complete
           cds
          Length = 834

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491



to top

>gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC F18C1 genomic sequence,
             complete sequence
          Length = 100887

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                         
Query: 201   cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
             ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 84357 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 84416

                                                           
Query: 261   tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
             |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 84417 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 84462



to top

>gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 794

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491



to top

>emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 575

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 345 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 286

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 285 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 240



to top

>emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZC09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 587 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 528

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 527 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 482



to top

>gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal protein L18 mRNA,
           complete cds
          Length = 778

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 591 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 532

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 531 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 486



to top

>gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 564

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 202 ttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccctt 261
           |||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| |||||
Sbjct: 564 ttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccctt 505

                                                        
Query: 262 ggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           ||  || ||||||||||||| ||| ||||||||||| || |||||
Sbjct: 504 ggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 460



to top

>emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 480 ccgaagtgcct 470



to top

>emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 503 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 444

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 443 ccaaagtgcct 433



to top

>emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 478

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 477 ccaaagtgcct 467



to top

>emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 478

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 477 ccaaagtgcct 467



to top

>emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 488 ccaaagtgcct 478



to top

>emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 488 ccaaagtgcct 478



to top

>emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA
          Length = 616

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 515 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 456

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 455 ccaaagtgcct 445



to top

>emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 548 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 489

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 488 ccaaagtgcct 478



to top

>emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 543 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 484

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 483 ccaaagtgcct 473



to top

>emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 541 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 482

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 481 ccaaagtgcct 471



to top

>emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 543 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 484

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 483 ccaaagtgcct 473



to top

>emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 376 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 317

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 316 ccaaagtgcct 306



to top

>emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 480 ccgaagtgcct 470



to top

>emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 541 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 482

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 481 ccaaagtgcct 471



to top

>emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 480 ccgaagtgcct 470



to top

>emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 479 ccgaagtgcct 469



to top

>emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 480 ccaaagtgcct 470



to top

>emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 456 ccgaagtgcct 446



to top

>emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA
          Length = 659

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 558 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 499

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 498 ccgaagtgcct 488



to top

>emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA
          Length = 618

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 517 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 458

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 457 ccaaagtgcct 447



to top

>emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 479 ccgaagtgcct 469



to top

>emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 485

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 484 ccgaagtgcct 474



to top

>emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 478 ccgaagtgcct 468



to top

>emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 478

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 477 ccgaagtgcct 467



to top

>emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 538 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 478 ccaaagtgcct 468



to top

>emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 485

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 484 ccaaagtgcct 474



to top

>emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   ||| || ||||| 
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttccaggggctttt 485

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 484 ccaaagtgcct 474



to top

>emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 479 ccgaagtgcct 469



to top

>emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 540 ttcctgcccttggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 481

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 480 ccgaagtgcct 470



to top

>gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctg 302
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||   ||| |
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 303 gagctttgccaaagtgcct 321
           |||| || |||||||||||
Sbjct: 489 gagcctttccaaagtgcct 471



to top

>gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctg 302
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||   ||| |
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 303 gagctttgccaaagtgcct 321
           |||| || |||||||||||
Sbjct: 489 gagcctttccaaagtgcct 471



to top

>emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 422 ttcctgcccttggagcggacatagggcttggtgtggctgtg 382



to top

>emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA
          Length = 614

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 514 ttcctgcccttggagcggacatagggcttggtgtggctgtg 474



to top

>emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 537 ttcctgcccttggagcggacatagggcttggtgtggctgtg 497



to top

>emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 544 ttcctgcccttggagcggacatagggcttggtgtggctgtg 504



to top

>emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence
          Length = 839

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 207 ccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgcccttggagc 266
           ||||| |||| ||||| || ||| ||||||||||   ||| || ||||| ||||| | ||
Sbjct: 616 ccttgtagcctctgctatttctctttcctcttgctcgctcaaacttccttccctttgcgc 557

                                                                       
Query: 267 ggacatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgcctaacag 326
           | ||||| ||||| |||||||||||||| || || || ||||| ||||||||| |||| |
Sbjct: 556 gaacataaggctttgtgtggctgtgtgggacaccaggtgctttaccaaagtgcttaacgg 497

                                   
Query: 327 cttccctggcgttcttgggacccc 350
           | ||||| | |||||| |||||||
Sbjct: 496 cctcccttgagttctttggacccc 473



to top

>gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cDNA clone
           MGC:105408 IMAGE:7308070), complete cds
          Length = 640

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 532 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 473

                          
Query: 304 agctttgccaaagtg 318
            || |||||||||||
Sbjct: 472 ggccttgccaaagtg 458



to top

>emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA
          Length = 622

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||| ||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 516 ttcctgcccttggagcgcacatagggcttggtgtggctgtgaggagttcctggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 456 ccgaagtgcct 446



to top

>emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| |||||| |||||||||| ||   ||| || ||||| 
Sbjct: 539 ttcctgcccttggagcggacatagggcttgatgtggctgtgaggagttccaggggctttt 480

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 479 ccaaagtgcct 469



to top

>emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| |||| |||||||||||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggctcggtgtggctgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| ||||||||||||| ||| ||   ||| || ||||| 
Sbjct: 516 ttcctgcccttggagcggacatagggcttggtgtggccgtgaggagttccaggggctttt 457

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 456 ccaaagtgcct 446



to top

>emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||||||||||||||||| || |||||||||||||| ||   ||| || ||||| 
Sbjct: 545 ttcctgcccttggagcggacatagggtttggtgtggctgtgaggagttccaggggctttt 486

                      
Query: 311 ccaaagtgcct 321
           |||||||||||
Sbjct: 485 ccaaagtgcct 475



to top

>emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           ||||||||| ||||||||||||| ||||||||||||||||| ||   |||||| ||||| 
Sbjct: 538 ttcctgcccctggagcggacatagggcttggtgtggctgtgaggagttcctggggctttt 479

                      
Query: 311 ccaaagtgcct 321
           || ||||||||
Sbjct: 478 ccgaagtgcct 468



to top

>ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18), mRNA
          Length = 607

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 526 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 467

                          
Query: 304 agctttgccaaagtg 318
            || |||||||||||
Sbjct: 466 ggccttgccaaagtg 452



to top

>gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds
          Length = 607

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||| ||||||||| |||||||| || |||||||||||||||||   ||||||
Sbjct: 526 ctcgaacttccggcccttggaacggacatagggtttggtgtggctgtgtggagttcctgg 467

                          
Query: 304 agctttgccaaagtg 318
            || |||||||||||
Sbjct: 466 ggccttgccaaagtg 452



to top

>gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872 IMAGE:7117835),
           complete cds
          Length = 655

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||||||| |||||||| ||||| ||||||||||||||||| ||   ||| ||
Sbjct: 556 ctcgaacttcctgcctttggagcgcacatagggcttggtgtggctgtgaggggttccagg 497

                             
Query: 304 agctttgccaaagtgcct 321
           |||||| ||||| |||||
Sbjct: 496 agctttcccaaaatgcct 479



to top

>ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA
          Length = 655

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||||||| |||||||| ||||| ||||||||||||||||| ||   ||| ||
Sbjct: 556 ctcgaacttcctgcctttggagcgcacatagggcttggtgtggctgtgaggggttccagg 497

                             
Query: 304 agctttgccaaagtgcct 321
           |||||| ||||| |||||
Sbjct: 496 agctttcccaaaatgcct 479



to top

>emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZH02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 722

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcctgccct 260
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| ||||| ||||
Sbjct: 563 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 504

                                                         
Query: 261 tggagcggacatatggcttggtgtggctgtgtggcactcctggagc 306
           |||  || ||||||||||||| ||  |||| |||||| || |||||
Sbjct: 503 tggcccgaacatatggcttggagttactgtatggcacaccaggagc 458



to top

>gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds
          Length = 674

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 243 tctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           ||||||| |||||||||||||||||||  || |||||||||||||||||
Sbjct: 527 tctcgaacttcctgcccttggagcggatgtagggcttggtgtggctgtg 479



to top

>emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggc 287
           ||||||||||||||||||||||| |||||||||||||
Sbjct: 539 ttcctgcccttggagcggacatagggcttggtgtggc 503



to top

>emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ribosomal protein L18
          Length = 714

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 218 ctgctgttcctccttcctcttgccttctcgaatttcctgcccttggagcggacatatggc 277
           ||||| || ||||| ||||| |||||||| |||||||| ||||| || |  ||||| |||
Sbjct: 537 ctgctctttctcctccctctagccttctcaaatttccttccctttgacctaacataaggc 478

                                        
Query: 278 ttggtgtggctgtgtggcactcctggagc 306
           ||||| |||||||||||||| || |||||
Sbjct: 477 ttggtatggctgtgtggcacaccaggagc 449



to top

>ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC456183), mRNA
          Length = 665

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| |||||||||||||||||| || ||||||||||||||
Sbjct: 562 ctcgaacttccggcccttggagcggacatagggtttggtgtggctgtg 515



to top

>emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 ribosomal protein (l18 gene)
          Length = 541

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           ||||||||||||||||| || || ||||||||||||||||||||
Sbjct: 497 ttcctgcccttggagcgaacgtagggcttggtgtggctgtgtgg 454



to top

>ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC472492), mRNA
          Length = 789

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 747 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 697



to top

>gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete sequence
          Length = 155260

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                
Query: 244   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
             |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 43627 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 43677



to top

>ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 459 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 409



to top

>ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 459 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 409



to top

>ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC136143), mRNA
          Length = 480

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 438 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 388



to top

>dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-13958, similar to human
           ribosomal protein L18 (RPL18), mRNA, RefSeq: NM_000979.2
          Length = 664

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||| |||| ||||||||||||||| || || |||||||||||||||||
Sbjct: 563 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtgtgg 513



to top

>dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full insert sequence
          Length = 630

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 269 acatatggcttggtgtggctgtgtggcactcctggagctttgccaaagtgc 319
           |||||||| |||||||| || |||||||| |||||||||||||| ||||||
Sbjct: 494 acatatggtttggtgtgactatgtggcacgcctggagctttgccgaagtgc 444



to top

>ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA
          Length = 648

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511



to top

>gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial cds
          Length = 499

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 487 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 440



to top

>gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:8373
           IMAGE:2820119), complete cds
          Length = 648

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 532 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 485



to top

>gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) gene, complete cds
          Length = 11093

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 244  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
            |||||| |||| ||||||||||| |||||| || ||||||||||||||
Sbjct: 1542 ctcgaacttccagcccttggagcagacatagggtttggtgtggctgtg 1589



to top

>gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNING: chimeric clone
            ****
          Length = 1234

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 244  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
            |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 1134 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 1087



to top

>gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:33859
           IMAGE:5261251), complete cds
          Length = 665

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511



to top

>emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 639

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509



to top

>emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481



to top

>emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1606

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 244  ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
            |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 1559 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 1512



to top

>emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 604

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 523 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 476



to top

>emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liver of Homo sapiens
           (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481



to top

>emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liver of Homo sapiens
           (human)
          Length = 606

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481



to top

>emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 611

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 528 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 481



to top

>emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498



to top

>emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 612

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 529 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 482



to top

>emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498



to top

>emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal brain of Homo sapiens
           (human)
          Length = 687

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509



to top

>emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 628

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498



to top

>emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 631

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 545 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 498



to top

>emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 639

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509



to top

>emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 637

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 556 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 509



to top

>emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7
          Length = 665

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 532 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 485



to top

>emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18
          Length = 755

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| |||||||||||| || || |||||||||||||||||
Sbjct: 621 ctcgaacttccggcccttggagcgcacgtagggcttggtgtggctgtg 574



to top

>dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654, highly similar to
           HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)
           mRNA
          Length = 656

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 558 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 511



to top

>gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:9403
           IMAGE:3878799), complete cds
          Length = 648

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 546 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 499



to top

>emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-973N13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195840

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 244    ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
              |||||| |||| ||||||||||| |||||| || ||||||||||||||
Sbjct: 144142 ctcgaacttccagcccttggagcagacatagggtttggtgtggctgtg 144095



to top

>gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence
          Length = 599

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| |||||||||||| ||||| || ||||||||||||||
Sbjct: 554 ctcgaacttccggcccttggagcgaacatagggtttggtgtggctgtg 507



to top

>gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18) mRNA, complete cds
          Length = 630

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
           |||||| |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 540 ctcgaacttccggcccttggagcggacgtagggtttggtgtggctgtg 493



to top

>gb|AC009517.6| Homo sapiens chromosome 7 clone RP11-181K7, complete sequence
          Length = 141395

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 244   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgt 290
             |||||| |||| ||||||||||||||  ||||| |||||||||||||
Sbjct: 78821 ctcgaacttccggcccttggagcggatgtatggtttggtgtggctgt 78775



to top

>emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on chromosome 11 Contains the
             5' end of the Abr gene for active BCR-related protein, a
             ribosomal protein L18 (Rpl18) pseudogene, a ribosomal
             protein L36 (Rpl36) pseudogene and four CpG islands,
             complete sequence
          Length = 212940

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 70361 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 70302

                        
Query: 311   ccaaagtgcct 321
             ||||| |||||
Sbjct: 70301 ccaaaatgcct 70291



to top

>gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mRNA, partial
           sequence
          Length = 497

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 257 cccttggagcggacatatggcttggtgtggctgtgtgg 294
           ||||||||||| ||||| |||||||| |||||||||||
Sbjct: 480 cccttggagcgcacatagggcttggtatggctgtgtgg 443



to top

>emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribosomal protein L18 (rpl18
           gene)
          Length = 573

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 227 ctccttcctcttgccttctcgaatttcctgcccttggagcggacatatgg 276
           |||||||||||| ||||||| || ||||| ||||||||||| || |||||
Sbjct: 548 ctccttcctcttcccttctcaaacttccttcccttggagcgcacgtatgg 499



to top

>gb|AC124505.4| Mus musculus BAC clone RP23-421P23 from 7, complete sequence
          Length = 222439

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
             |||| ||||||||| |||||||| || |||| |||||||||||    ||||||||| |||
Sbjct: 90635 ttccggcccttggaccggacatagggtttggggtggctgtgtgtggttcctggagccttg 90576

                       
Query: 311   ccaaagtgcc 320
             ||||| ||||
Sbjct: 90575 ccaaaatgcc 90566



to top

>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 236843

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 244   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgt 292
             |||||| |||| ||||||||| | |||||| || |||||||||||||||
Sbjct: 42386 ctcgaacttccggcccttggaacagacatagggtttggtgtggctgtgt 42338



to top

>gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosome 6, complete sequence
          Length = 211910

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 94871 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 94812

                  
Query: 311   ccaaa 315
             |||||
Sbjct: 94811 ccaaa 94807



to top

>gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone IMAGE:5685697),
            partial cds
          Length = 3034

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
            |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 2893 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 2834

                 
Query: 311  ccaaa 315
            |||||
Sbjct: 2833 ccaaa 2829



to top

>ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA
          Length = 708

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 584 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 525

                
Query: 311 ccaaa 315
           |||||
Sbjct: 524 ccaaa 520



to top

>ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA
          Length = 773

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 288
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 548 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 504



to top

>ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L18
           (LOC672898), mRNA
          Length = 945

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 854 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 795

                
Query: 311 ccaaa 315
           |||||
Sbjct: 794 ccaaa 790



to top

>dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530019P09 product:procollagen-lysine,
            2-oxoglutarate 5-dioxygenase 1, full insert sequence
          Length = 3565

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
            |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 3478 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 3419

                 
Query: 311  ccaaa 315
            |||||
Sbjct: 3418 ccaaa 3414



to top

>dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830033B22 product:ribosomal
           protein L18, full insert sequence
          Length = 641

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 311 ccaaa 315
           |||||
Sbjct: 494 ccaaa 490



to top

>gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clone MGC:129138
           IMAGE:8122333), complete cds
          Length = 773

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 288
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 548 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 504



to top

>dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0026A12 product:ribosomal protein L18,
           full insert sequence
          Length = 675

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 585 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 526

                
Query: 311 ccaaa 315
           |||||
Sbjct: 525 ccaaa 521



to top

>dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0014M02 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 311 ccaaa 315
           |||||
Sbjct: 494 ccaaa 490



to top

>dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830126C06 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 311 ccaaa 315
           |||||
Sbjct: 492 ccaaa 488



to top

>dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004N22
           product:ribosomal protein L18, full insert sequence
          Length = 640

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 311 ccaaa 315
           |||||
Sbjct: 492 ccaaa 488



to top

>dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730080N03 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 311 ccaaa 315
           |||||
Sbjct: 492 ccaaa 488



to top

>dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410015P13 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 311 ccaaa 315
           |||||
Sbjct: 492 ccaaa 488



to top

>dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2300008F05 product:ribosomal protein L18,
           full insert sequence
          Length = 642

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 555 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 496

                
Query: 311 ccaaa 315
           |||||
Sbjct: 495 ccaaa 491



to top

>dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700088D17 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 552 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 493

                
Query: 311 ccaaa 315
           |||||
Sbjct: 492 ccaaa 488



to top

>dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700124C09 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 554 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 495

                
Query: 311 ccaaa 315
           |||||
Sbjct: 494 ccaaa 490



to top

>gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701, complete cds
          Length = 750

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 539 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 480

                
Query: 311 ccaaa 315
           |||||
Sbjct: 479 ccaaa 475



to top

>gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715, complete cds
          Length = 644

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 539 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 480

                
Query: 311 ccaaa 315
           |||||
Sbjct: 479 ccaaa 475



to top

>gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102603
           IMAGE:2655484), complete cds
          Length = 638

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 530 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 471

                
Query: 311 ccaaa 315
           |||||
Sbjct: 470 ccaaa 466



to top

>emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chromosome 2, complete
             sequence
          Length = 190165

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
             |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 90401 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 90460

                  
Query: 311   ccaaa 315
             |||||
Sbjct: 90461 ccaaa 90465



to top

>gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, complete cds
          Length = 629

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggct 288
           |||||| |||| ||||||||||||||| || || |||||||||||
Sbjct: 547 ctcgaacttccggcccttggagcggacgtagggtttggtgtggct 503



to top

>gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102572
           IMAGE:6485569), complete cds
          Length = 643

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 538 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 479

                
Query: 311 ccaaa 315
           |||||
Sbjct: 478 ccaaa 474



to top

>gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102181
           IMAGE:6823249), complete cds
          Length = 666

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 542 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 483

                
Query: 311 ccaaa 315
           |||||
Sbjct: 482 ccaaa 478



to top

>ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (LOC652986) on
           chromosome 6
          Length = 809

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
           |||| ||||||||| |||||||| || ||||| |||||||||||   |||||| || |||
Sbjct: 639 ttccggcccttggaacggacatagggtttggtatggctgtgtggggttcctggggccttg 580

                
Query: 311 ccaaa 315
           |||||
Sbjct: 579 ccaaa 575



to top

>gb|AF240376.1|AF240376 Tilapia mossambica ribosomal protein L18 (L18) gene, complete cds
          Length = 5828

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 243  tctcgaatttcctgcccttggagcggac 270
            ||||||| ||||||||||||||||||||
Sbjct: 5408 tctcgaacttcctgcccttggagcggac 5381



to top

>gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150D5, complete sequence
          Length = 168172

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 244    ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
              |||||| |||| |||||||||| |||| || || ||||||||||||||
Sbjct: 154945 ctcgaacttccggcccttggagtggacgtagggtttggtgtggctgtg 154898



to top

>ref|NM_070254.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-18) (rpl-18) mRNA, complete cds
          Length = 666

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 272 tatggcttggtgtggctgtgtggcactcctggagct 307
           |||||||||||||||  |||||| ||||||||||||
Sbjct: 530 tatggcttggtgtgggagtgtgggactcctggagct 495



to top

>gb|AC011194.15|AC011194 Mus musculus chromosome 11, clone RP23-196F5, complete sequence
          Length = 181320

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
             |||| ||||||||| |||||||| || ||||| |||||||||||
Sbjct: 44918 ttccagcccttggaacggacatagggtttggtatggctgtgtgg 44875



to top

>gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200H5, complete sequence
          Length = 153562

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 244   ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtg 291
             |||||| |||| |||||||||| |||| || || ||||||||||||||
Sbjct: 50820 ctcgaacttccggcccttggagtggacgtagggtttggtgtggctgtg 50867



to top

>emb|AL021492.1|CEY45F10D Caenorhabditis elegans YAC Y45F10D, complete sequence
          Length = 59573

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 272   tatggcttggtgtggctgtgtggcactcctggagct 307
             |||||||||||||||  |||||| ||||||||||||
Sbjct: 18922 tatggcttggtgtgggagtgtgggactcctggagct 18887



to top

>emb|AL645478.15| Mouse DNA sequence from clone RP23-85A17 on chromosome 11, complete
             sequence
          Length = 121560

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 251   ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
             |||| ||||||||| |||||||| || ||||| |||||||||||
Sbjct: 63740 ttccagcccttggaacggacatagggtttggtatggctgtgtgg 63697



to top

>gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal protein L18-like
           mRNA, complete sequence
          Length = 804

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 257 cccttggagcggacatatggcttggtgtggctgtg 291
           ||||||||||| || || |||||||||||||||||
Sbjct: 677 cccttggagcgcacgtagggcttggtgtggctgtg 643



to top

>ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC480848), mRNA
          Length = 659

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||| ||||||||| |  || || || |||||||||||||||||   ||||||
Sbjct: 566 ctcgaacttccggcccttggatctcacgtagggtttggtgtggctgtgtggggttcctgg 507

                          
Query: 304 agctttgccaaagtg 318
            || |||||||||||
Sbjct: 506 ggccttgccaaagtg 492



to top

>ref|XM_541138.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC484021), mRNA
          Length = 647

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 244 ctcgaatttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
           |||||| |||| ||||||||| |  || || || |||||||||||||||||   ||||||
Sbjct: 551 ctcgaacttccggcccttggatctcacgtagggtttggtgtggctgtgtggggttcctgg 492

                          
Query: 304 agctttgccaaagtg 318
            || |||||||||||
Sbjct: 491 ggccttgccaaagtg 477



to top

>gb|AF159901.1|AF159901 Lapemis hardwickii ribosomal protein L14 mRNA, partial cds
          Length = 494

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 257 cccttggagcggacatatggcttggtgtggctgtg 291
           |||||||| |||||||||||||| ||||| |||||
Sbjct: 352 cccttggatcggacatatggcttagtgtgactgtg 318



to top

>dbj|AK221052.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-76-K07
          Length = 204

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 201 cttaaaccttgaagcccctgctgttcctccttcctcttgccttctcgaatttcct 255
           ||||||||||||| || |  || |||||| ||||||| ||||||||||| |||||
Sbjct: 56  cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttcct 2



to top

>gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 191877

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 256   gcccttggagcggacatatggcttggtgtggctgtgtgg 294
             |||||||| | ||||||| || |||||||||||||||||
Sbjct: 91314 gcccttggggtggacatagggtttggtgtggctgtgtgg 91352



to top

>ref|XM_533629.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC476422), mRNA
          Length = 531

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 277 cttggtgtggctgtgtggcactcctggagctttgccaaagtg 318
           ||||||||||||||||||   |||||| || |||||||||||
Sbjct: 528 cttggtgtggctgtgtggggttcctggggccttgccaaagtg 487



to top

>gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, complete sequence
          Length = 163642

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                          
Query: 251    ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
              |||| ||||||||||||||| || |  |||||||||||||| |||  |||||| || |||
Sbjct: 155692 ttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggccttg 155633

                
Query: 311    cc 312
              ||
Sbjct: 155632 cc 155631



to top

>gb|AC136191.5| Rattus norvegicus  BAC CH230-52I17 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 221923

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 277   cttggtgtggctgtgtggcactcctggagctttgccaaagtg 318
             ||||||||||||||||||   |||||| || |||||||||||
Sbjct: 14896 cttggtgtggctgtgtggagttcctggggccttgccaaagtg 14937



to top

>gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal protein L18 mRNA,
           complete cds
          Length = 567

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 257 cccttggagcggacatatggcttggtgtggctgtgtgg 294
           |||||||| || || || ||||||||||||||||||||
Sbjct: 512 cccttggaccgcacgtacggcttggtgtggctgtgtgg 475



to top

>gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, complete sequence
          Length = 111700

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                          
Query: 251    ttcctgcccttggagcggacatatggcttggtgtggctgtgtggcactcctggagctttg 310
              |||| ||||||||||||||| || |  |||||||||||||| |||  |||||| || |||
Sbjct: 102278 ttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggccttg 102337

                
Query: 311    cc 312
              ||
Sbjct: 102338 cc 102339



to top

>emb|AL162382.13| Human DNA sequence from clone RP11-248J2 on chromosome 6, complete
             sequence
          Length = 55594

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    tgagaactcattgacacagga 101
             |||||||||||||||||||||
Sbjct: 24838 tgagaactcattgacacagga 24858



to top

>ref|XM_787988.1| PREDICTED: Strongylocentrotus purpuratus similar to CG10185-PA
            (LOC588296), partial mRNA
          Length = 4296

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  ttcctgcccttggagcggaca 271
            |||||||||||||||||||||
Sbjct: 1094 ttcctgcccttggagcggaca 1114



to top

>gb|AC023781.5| Homo sapiens chromosome 8, clone RP11-149P24, complete sequence
          Length = 147607

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   caaaaaggtgatgataataaa 155
             |||||||||||||||||||||
Sbjct: 52509 caaaaaggtgatgataataaa 52529



to top

>dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L18, complete cds
          Length = 564

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 257 cccttggagcggacatatggcttggtgtg 285
           |||||||||||||| || |||||||||||
Sbjct: 513 cccttggagcggacgtagggcttggtgtg 485



to top

>gb|L41708.1|PS300427E Eucalyptus globulus bicostata symbiont (F00073) mRNA, ESTun427
          Length = 246

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 199 agcttaaaccttgaagcccctgctgttcctcct 231
           |||| ||||| |||| |||||||||||||||||
Sbjct: 34  agctcaaaccctgaatcccctgctgttcctcct 2



to top

>gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map human ortholog p11.23,
              complete sequence
          Length = 142154

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 221    ctgttcctccttcctcttgc 240
              ||||||||||||||||||||
Sbjct: 131062 ctgttcctccttcctcttgc 131043



to top

>emb|BX927325.15| Zebrafish DNA sequence from clone DKEYP-47G1 in linkage group 7, complete
              sequence
          Length = 208845

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    ccaaaaaggtgatgataata 153
              ||||||||||||||||||||
Sbjct: 142376 ccaaaaaggtgatgataata 142395



to top

>ref|XM_742113.1| Aspergillus fumigatus Af293 U5 snRNP component (Afu8g03990) partial
           mRNA
          Length = 3015

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 220 gctgttcctccttcctcttgccttctcg 247
           ||||||||||||||| ||||||| ||||
Sbjct: 586 gctgttcctccttccgcttgcctactcg 559



to top

>gb|AC122033.5| Mus musculus BAC clone RP24-403A7 from chromosome 17, complete sequence
          Length = 119877

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 256   gcccttggagcggacatatggcttggtgtggctgtgtggcactcctgg 303
             |||||||||| ||||||| |  ||||| ||||||||||| | ||||||
Sbjct: 80444 gcccttggagtggacataggatttggtatggctgtgtgggattcctgg 80397



to top

>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete sequence
          Length = 178501

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 46     agttgcaaaacaaccaaaca 65
              ||||||||||||||||||||
Sbjct: 132779 agttgcaaaacaaccaaaca 132798



to top

>emb|AL360011.19| Human DNA sequence from clone RP11-103A2 on chromosome 10 Contains the
             HTR7 gene for 5-hydroxytryptamine receptor 7 (adenylate
             cyclase-coupled) and a CpG island, complete sequence
          Length = 157636

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   ctgttcctccttcctcttgc 240
             ||||||||||||||||||||
Sbjct: 90774 ctgttcctccttcctcttgc 90793



to top

>emb|AL022578.1|HS393P12 Human DNA sequence from clone RP3-393P12 on chromosome Xp11.21 Contains
             a C2H2 type zinc finger pseudogene, a WAS protein family
             member 2 (WASF2) pseudogene (LOC286404), a ribosomal
             protein L7 (RPL7) pseudogene and the 5' end of a gene for
             a novel zinc finger protein, complete sequence
          Length = 104597

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   ctgttcctccttcctcttgc 240
             ||||||||||||||||||||
Sbjct: 41784 ctgttcctccttcctcttgc 41765



to top

>gb|AY143579.1| Styrax foveolaria internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 632

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  tgcaaaacaaccaaacacca 68
           ||||||||||||||||||||
Sbjct: 601 tgcaaaacaaccaaacacca 582



to top

>gb|AC111120.12| Mus musculus chromosome 7, clone RP23-225M4, complete sequence
          Length = 151727

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 314    aagtgcctaacagcttccct 333
              ||||||||||||||||||||
Sbjct: 133902 aagtgcctaacagcttccct 133883



to top

>emb|BX530057.5| Zebrafish DNA sequence from clone DKEY-48O24 in linkage group 1,
             complete sequence
          Length = 178280

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   caaaaaggtgatgataataa 154
             ||||||||||||||||||||
Sbjct: 38733 caaaaaggtgatgataataa 38714



to top

>gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470-3108875 strain AX4,
             complete sequence
          Length = 541399

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   caaaaaggtgatgataataa 154
             ||||||||||||||||||||
Sbjct: 40611 caaaaaggtgatgataataa 40630



to top

>gb|AY130355.1| Myxine glutinosa ribosomal protein L18 mRNA, partial cds
          Length = 479

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 251 ttcctgcccttggagcggacatatggcttggtgtggctgtgtgg 294
           ||||| |||||||| || ||||| ||||| | ||||||||||||
Sbjct: 478 ttcctccccttggatcgaacatagggctttgcgtggctgtgtgg 435



to top

>gb|AF401572.1| Ictalurus punctatus ribosomal protein L18 mRNA, complete cds
          Length = 635

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 275 ggcttggtgtggctgtgtggcactcctggagctttgccaaagtgccta 322
           ||||||||||||||||| ||   ||| || ||||| ||||||||||||
Sbjct: 498 ggcttggtgtggctgtggggagttccaggggctttcccaaagtgccta 451



to top

>ref|XM_578444.1| PREDICTED: Rattus norvegicus similar to Ab2-162 (LOC366313), mRNA
          Length = 879

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 31  gcaagcatggtctcaagttgcaaaacaa 58
           |||||||||| ||||||||||| |||||
Sbjct: 446 gcaagcatggcctcaagttgcagaacaa 473



to top

>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence
          Length = 162077

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   ccaaaaaggtgatgataata 153
             ||||||||||||||||||||
Sbjct: 86062 ccaaaaaggtgatgataata 86081



to top

>gb|AC115850.11| Mus musculus chromosome 7, clone RP24-252O10, complete sequence
          Length = 161457

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   aagtgcctaacagcttccct 333
             ||||||||||||||||||||
Sbjct: 41911 aagtgcctaacagcttccct 41892



to top

>emb|BX682529.6| Zebrafish DNA sequence from clone CH211-194P13 in linkage group 19,
             complete sequence
          Length = 176981

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 40    gtctcaagttgcaaaacaaccaaa 63
             ||||||||| ||||||||||||||
Sbjct: 94373 gtctcaagtggcaaaacaaccaaa 94350



to top

>emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 in linkage group 20,
              complete sequence
          Length = 194459

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    aaaaggtgatgataataaac 156
              ||||||||||||||||||||
Sbjct: 101326 aaaaggtgatgataataaac 101307



to top

>gb|AC004107.1|AC004107 Human Cosmid g1248a010 from 7q31.3, complete sequence
          Length = 38309

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    tgagaactcattgacacagg 100
             ||||||||||||||||||||
Sbjct: 25233 tgagaactcattgacacagg 25214



to top

>emb|AJ509090.1|HSA509090 Homo sapiens WASF4 gene for Wiskott-Aldrich syndrome protein family
            member 4, exons 1-3
          Length = 9223

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 221  ctgttcctccttcctcttgc 240
            ||||||||||||||||||||
Sbjct: 5342 ctgttcctccttcctcttgc 5323


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,315,159
Number of Sequences: 3902068
Number of extensions: 3315159
Number of successful extensions: 70479
Number of sequences better than 10.0: 223
Number of HSP's better than 10.0 without gapping: 223
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70140
Number of HSP's gapped (non-prelim): 332
length of query: 350
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 328
effective length of database: 17,147,199,772
effective search space: 5624281525216
effective search space used: 5624281525216
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top