ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart27g05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC136524.2| Oryza sativa (japonica cultivar-group) chromosome... 119 9e-24
2dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 119 9e-24
3dbj|AK058638.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 9e-24
4gb|AC146577.2| Pan troglodytes BAC clone CH251-189A13 from Y, co... 46 0.11
5gb|AC145770.1| Pan troglodytes BAC clone CH251-576K13 from Y, co... 46 0.11
6dbj|BS000576.2| Pan troglodytes chromosome Y clone:PTB-045N05, c... 46 0.11
7gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 46 0.11
8gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 44 0.43
9gb|AC138739.8| Mus musculus chromosome 9, clone RP23-380A10, com... 42 1.7
10gb|AE012302.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 1.7
11dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 42 1.7
12gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 1.7
13emb|BX824537.1|CNS0A7TX Arabidopsis thaliana Full-length cDNA Co... 42 1.7
14gb|AC108011.4| Homo sapiens BAC clone RP13-511O19 from 4, comple... 42 1.7
15gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 6.8
16gb|AC107690.10| Mus musculus chromosome 3, clone RP24-349N15, co... 40 6.8
17gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 6.8
18gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosom... 40 6.8
19emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chr... 40 6.8
20gb|AC002519.1|HUAC002519 Human Chromosome 16 BAC clone CIT987SK-... 40 6.8
21gb|AC079316.15| Homo sapiens 12 BAC RP11-43D4 (Roswell Park Canc... 40 6.8
22gb|AC121910.3| Mus musculus BAC clone RP24-180H14 from chromosom... 40 6.8
23gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia regio... 40 6.8
24emb|AL662918.7| Human DNA sequence from clone RP11-176B3 on chro... 40 6.8
25emb|AL445188.5| Human DNA sequence from clone RP11-260E14 on chr... 40 6.8
26emb|AL139118.12| Human DNA sequence from clone RP11-162K11 on ch... 40 6.8
27emb|AL139079.2|CJ11168X6 Campylobacter jejuni subsp. jejuni NCTC... 40 6.8
28gb|AC117463.5| Homo sapiens 3 BAC RP11-452B4 (Roswell Park Cance... 40 6.8
29gb|AC161171.5| Mus musculus chromosome 3, clone RP24-326F21, com... 40 6.8
30gb|AC152397.6| Mus musculus chromosome 18, clone RP23-307D12, co... 40 6.8
31gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome... 40 6.8
32dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
33gb|AC026348.23| Homo sapiens 3 BAC RP11-553D4 (Roswell Park Canc... 40 6.8
34dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
35dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.8
36emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 6.8
37gb|AC157017.3| Mus musculus 10 BAC RP24-559D16 (Roswell Park Can... 40 6.8
38gb|AC153966.4| Mus musculus 10 BAC RP24-357P6 (Roswell Park Canc... 40 6.8
39gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 40 6.8
40gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromoso... 40 6.8
41emb|AL928966.3| Mouse DNA sequence from clone RP24-388A9 on chro... 40 6.8
42emb|AL928797.6| Mouse DNA sequence from clone RP23-178B19 on chr... 40 6.8 
>gb|AC136524.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0474A01,
             complete sequence
          Length = 140077

 Score =  119 bits (60), Expect = 9e-24
 Identities = 93/104 (89%)
 Strand = Plus / Minus

                                                                         
Query: 392   gcgttcatctgatcgaggagtatgaccacggccatggccagcgccggctcgaagtctggc 451
             |||| |||||| |||||||| ||||| ||||||||||| ||||||||||||||| | |||
Sbjct: 59966 gcgtgcatctggtcgaggaggatgacgacggccatggcgagcgccggctcgaagcccggc 59907

                                                         
Query: 452   tccaccatcagccggaacacgtccggtccgatggcggcctcctt 495
             ||||||| |||||||||||||||||| || | ||||||||||||
Sbjct: 59906 tccaccaccagccggaacacgtccgggcccacggcggcctcctt 59863
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  119 bits (60), Expect = 9e-24
 Identities = 93/104 (89%)
 Strand = Plus / Minus

                                                                            
Query: 392      gcgttcatctgatcgaggagtatgaccacggccatggccagcgccggctcgaagtctggc 451
                |||| |||||| |||||||| ||||| ||||||||||| ||||||||||||||| | |||
Sbjct: 14112411 gcgtgcatctggtcgaggaggatgacgacggccatggcgagcgccggctcgaagcccggc 14112352

                                                            
Query: 452      tccaccatcagccggaacacgtccggtccgatggcggcctcctt 495
                ||||||| |||||||||||||||||| || | ||||||||||||
Sbjct: 14112351 tccaccaccagccggaacacgtccgggcccacggcggcctcctt 14112308
to top
>dbj|AK058638.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-D08, full
           insert sequence
          Length = 1230

 Score =  119 bits (60), Expect = 9e-24
 Identities = 93/104 (89%)
 Strand = Plus / Minus

                                                                       
Query: 392 gcgttcatctgatcgaggagtatgaccacggccatggccagcgccggctcgaagtctggc 451
           |||| |||||| |||||||| ||||| ||||||||||| ||||||||||||||| | |||
Sbjct: 719 gcgtgcatctggtcgaggaggatgacgacggccatggcgagcgccggctcgaagcccggc 660

                                                       
Query: 452 tccaccatcagccggaacacgtccggtccgatggcggcctcctt 495
           ||||||| |||||||||||||||||| || | ||||||||||||
Sbjct: 659 tccaccaccagccggaacacgtccgggcccacggcggcctcctt 616
to top
>gb|AC146577.2| Pan troglodytes BAC clone CH251-189A13 from Y, complete sequence
          Length = 171643

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 335    gctagctgcaggcatgcatggct 357
              |||||||||||||||||||||||
Sbjct: 163803 gctagctgcaggcatgcatggct 163825
to top
>gb|AC145770.1| Pan troglodytes BAC clone CH251-576K13 from Y, complete sequence
          Length = 177726

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 335    gctagctgcaggcatgcatggct 357
              |||||||||||||||||||||||
Sbjct: 137305 gctagctgcaggcatgcatggct 137283
to top
>dbj|BS000576.2| Pan troglodytes chromosome Y clone:PTB-045N05, complete sequences
          Length = 190089

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 335    gctagctgcaggcatgcatggct 357
              |||||||||||||||||||||||
Sbjct: 142390 gctagctgcaggcatgcatggct 142368
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 335      gctagctgcaggcatgcatggct 357
                |||||||||||||||||||||||
Sbjct: 23375887 gctagctgcaggcatgcatggct 23375909
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 413     atgaccacggccatggccagcg 434
               ||||||||||||||||||||||
Sbjct: 3619542 atgaccacggccatggccagcg 3619563
to top
>gb|AC138739.8| Mus musculus chromosome 9, clone RP23-380A10, complete sequence
          Length = 217813

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 243    cttcctgccccctcttttttc 263
              |||||||||||||||||||||
Sbjct: 154715 cttcctgccccctcttttttc 154695
to top
>gb|AE012302.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 210 of
             460 of the complete genome
          Length = 12828

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 421   ggccatggccagcgccggctc 441
             |||||||||||||||||||||
Sbjct: 12387 ggccatggccagcgccggctc 12407
to top
>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 25      ttattttcactaacaaaaaga 45
               |||||||||||||||||||||
Sbjct: 2178530 ttattttcactaacaaaaaga 2178550
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 421     ggccatggccagcgccggctc 441
               |||||||||||||||||||||
Sbjct: 2652618 ggccatggccagcgccggctc 2652598
to top
>emb|BX824537.1|CNS0A7TX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH54ZH01 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1851

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 22   tatttattttcactaacaaaa 42
            |||||||||||||||||||||
Sbjct: 1329 tatttattttcactaacaaaa 1309
to top
>gb|AC108011.4| Homo sapiens BAC clone RP13-511O19 from 4, complete sequence
          Length = 81894

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 293   tctgtatgatttgtgcattga 313
             |||||||||||||||||||||
Sbjct: 63732 tctgtatgatttgtgcattga 63712
to top
>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 24      tttattttcactaacaaaaa 43
               ||||||||||||||||||||
Sbjct: 1645774 tttattttcactaacaaaaa 1645793
to top
>gb|AC107690.10| Mus musculus chromosome 3, clone RP24-349N15, complete sequence
          Length = 166260

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 100    acatcctgaatccaaaacatcaca 123
              ||||||| ||||||||||||||||
Sbjct: 147150 acatccttaatccaaaacatcaca 147127
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 418    cacggccatggccagcgccg 437
              ||||||||||||||||||||
Sbjct: 890120 cacggccatggccagcgccg 890139
to top
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence
          Length = 235813

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 243    cttcctgccccctctttttt 262
              ||||||||||||||||||||
Sbjct: 206297 cttcctgccccctctttttt 206316
to top
>emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chromosome 13, complete
              sequence
          Length = 204148

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 245    tcctgccccctcttttttcc 264
              ||||||||||||||||||||
Sbjct: 162877 tcctgccccctcttttttcc 162896
to top
>gb|AC002519.1|HUAC002519 Human Chromosome 16 BAC clone CIT987SK-A-355G7, complete sequence
          Length = 139958

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 4      gccacatgatctatgtgctatttatttt 31
              |||||||| || ||||||||||||||||
Sbjct: 108334 gccacatggtcaatgtgctatttatttt 108307
to top
>gb|AC079316.15| Homo sapiens 12 BAC RP11-43D4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 178905

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   cttcctgccccctctttttt 262
             ||||||||||||||||||||
Sbjct: 62479 cttcctgccccctctttttt 62460
to top
>gb|AC121910.3| Mus musculus BAC clone RP24-180H14 from chromosome 13, complete
             sequence
          Length = 143473

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   tcctgccccctcttttttcc 264
             ||||||||||||||||||||
Sbjct: 19612 tcctgccccctcttttttcc 19631
to top
>gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 2
             of 11 of the complete sequence
          Length = 613322

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   agctgcaggcatgcatggct 357
             ||||||||||||||||||||
Sbjct: 93284 agctgcaggcatgcatggct 93265
to top
>emb|AL662918.7| Human DNA sequence from clone RP11-176B3 on chromosome 1, complete
             sequence
          Length = 90140

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    gtagaacacctctaaatgtgatct 90
             |||||||| |||||||||||||||
Sbjct: 70165 gtagaacatctctaaatgtgatct 70142
to top
>emb|AL445188.5| Human DNA sequence from clone RP11-260E14 on chromosome 13, complete
              sequence
          Length = 164061

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 338    agctgcaggcatgcatggct 357
              ||||||||||||||||||||
Sbjct: 153364 agctgcaggcatgcatggct 153345
to top
>emb|AL139118.12| Human DNA sequence from clone RP11-162K11 on chromosome 10 Contains the
             5' end of a novel gene, part of the PLCE1 gene for
             phospholipase C, epsilon 1 (PLCE, KIAA1516), a novel gene
             and the 5' end of a histone deacetylase 1 (HD1, RPD3,
             RPD3L1) (HDAC1) pseudogene, complete sequence
          Length = 45754

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 108   aatccaaaacatcacaacatggca 131
             ||||||| ||||||||||||||||
Sbjct: 33738 aatccaacacatcacaacatggca 33715
to top
>emb|AL139079.2|CJ11168X6 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
             6/6
          Length = 155932

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    tttattttcactaacaaaaa 43
             ||||||||||||||||||||
Sbjct: 19059 tttattttcactaacaaaaa 19078
to top
>gb|AC117463.5| Homo sapiens 3 BAC RP11-452B4 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 78261

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   ttcactaacaaaaagatagtgagagaaa 57
            |||||||| ||||||| |||||||||||
Sbjct: 9452 ttcactaaaaaaaagagagtgagagaaa 9479
to top
>gb|AC161171.5| Mus musculus chromosome 3, clone RP24-326F21, complete sequence
          Length = 153637

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 100  acatcctgaatccaaaacatcaca 123
            ||||||| ||||||||||||||||
Sbjct: 3380 acatccttaatccaaaacatcaca 3357
to top
>gb|AC152397.6| Mus musculus chromosome 18, clone RP23-307D12, complete sequence
          Length = 218647

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 12     atctatgtgctatttattttcact 35
              ||||| ||||||||||||||||||
Sbjct: 136570 atctaggtgctatttattttcact 136593
to top
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence
          Length = 220673

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 243   cttcctgccccctctttttt 262
             ||||||||||||||||||||
Sbjct: 70908 cttcctgccccctctttttt 70927
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 25       ttattttcactaacaaaaag 44
                ||||||||||||||||||||
Sbjct: 14330288 ttattttcactaacaaaaag 14330307
to top
>gb|AC026348.23| Homo sapiens 3 BAC RP11-553D4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 104159

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 338   agctgcaggcatgcatggct 357
             ||||||||||||||||||||
Sbjct: 82106 agctgcaggcatgcatggct 82125
to top
>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0703C03
          Length = 162620

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     ttattttcactaacaaaaag 44
              ||||||||||||||||||||
Sbjct: 145844 ttattttcactaacaaaaag 145863
to top
>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_A10
          Length = 101249

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    ttattttcactaacaaaaag 44
             ||||||||||||||||||||
Sbjct: 33368 ttattttcactaacaaaaag 33387
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 426     tggccagcgccggctcgaag 445
               ||||||||||||||||||||
Sbjct: 2536280 tggccagcgccggctcgaag 2536299
to top
>gb|AC157017.3| Mus musculus 10 BAC RP24-559D16 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 170093

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 294    ctgtatgatttgtgcattga 313
              ||||||||||||||||||||
Sbjct: 100003 ctgtatgatttgtgcattga 99984
to top
>gb|AC153966.4| Mus musculus 10 BAC RP24-357P6 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 155839

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   ctgtatgatttgtgcattga 313
             ||||||||||||||||||||
Sbjct: 25887 ctgtatgatttgtgcattga 25868
to top
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 39      aaaaagatagtgagagaaac 58
               ||||||||||||||||||||
Sbjct: 3072841 aaaaagatagtgagagaaac 3072822
to top
>gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromosome ul, complete
             sequence
          Length = 174770

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    aaaagatagtgagagaaacc 59
             ||||||||||||||||||||
Sbjct: 77572 aaaagatagtgagagaaacc 77591
to top
>emb|AL928966.3| Mouse DNA sequence from clone RP24-388A9 on chromosome 2, complete
              sequence
          Length = 173369

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 13     tctatgtgctatttattttc 32
              ||||||||||||||||||||
Sbjct: 172897 tctatgtgctatttattttc 172916
to top
>emb|AL928797.6| Mouse DNA sequence from clone RP23-178B19 on chromosome 2, complete
            sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 13   tctatgtgctatttattttc 32
            ||||||||||||||||||||
Sbjct: 1528 tctatgtgctatttattttc 1547


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,490,423
Number of Sequences: 3902068
Number of extensions: 4490423
Number of successful extensions: 80397
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80026
Number of HSP's gapped (non-prelim): 371
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top