ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart27d08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF498270.1| Haynaldia villosa clone kong36 mRNA 440 e-120
2ref|XM_465274.1| Oryza sativa (japonica cultivar-group), mRNA 100 9e-18
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 100 9e-18
4dbj|AP004890.3| Oryza sativa (japonica cultivar-group) genomic D... 100 9e-18
5dbj|AK068494.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 9e-18
6gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14... 90 9e-15
7gb|AF029897.1|AF029897 Triticum aestivum acetyl-coenzyme A carbo... 90 9e-15
8emb|X83518.1|HVKNOX3 H.vulgare Knox3 gene 88 3e-14
9gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (L... 88 3e-14
10gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete se... 82 2e-12
11emb|AJ400713.1|TAE400713 Triticum aestivum vp1B gene for VIVIPAR... 80 8e-12
12gb|AY133248.1| Aegilops tauschii starch synthase II gene, comple... 72 2e-09
13emb|AJ302096.1|ASP302096 Aegilops speltoides Pina gene for puroi... 72 2e-09
14dbj|AB201447.1| Triticum aestivum wSSII-D gene for starch syntha... 72 2e-09
15emb|AJ507214.1|HVU507214 Hordeum vulgare bbr gene for barley B r... 70 8e-09
16gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence 68 3e-08
17gb|AY107525.1| Zea mays PCO115693 mRNA sequence 66 1e-07
18gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 64 5e-07
19gb|AF474071.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC... 64 5e-07
20emb|CR626933.1| Triticum turgidum 62 2e-06
21emb|CR626929.1| Triticum aestivum 62 2e-06
22gb|AF326781.1| Triticum monococcum actin (ACT-1) gene, partial c... 58 3e-05
23dbj|AB178167.1| Triticum aestivum Wcbf2-2 mRNA for AP2/EREBP typ... 58 3e-05
24gb|AF099671.1|AF099671 Secale cereale thaumatin-like protein 2 p... 58 3e-05
25gb|AF099670.1|AF099670 Secale cereale thaumatin-like protein 3 p... 58 3e-05
26gb|AF096927.1|AF096927 Secale cereale thaumatin-like protein 1 p... 58 3e-05
27gb|AY230322.1| Triticum aestivum FCA-A1 (Fca) gene, partial cds 56 1e-04
28gb|AF376136.1|AF376136 Triticum aestivum putative CRT/DRE-bindin... 56 1e-04
29emb|AM000057.1| Hordeum vulgare HKT1 gene for high-affinity sodi... 56 1e-04
30gb|AF277253.1|AF277253 Australopyrum velutinum isolate H6724 dis... 54 5e-04
31gb|AF458279.1| Triticum monococcum isolate Tm896 rga2 protein (r... 52 0.002
32gb|AF458278.1| Triticum monococcum isolate Tm13010 rga2 protein ... 52 0.002
33gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 52 0.002
34gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 50 0.007
35emb|CR626934.1| Triticum aestivum 50 0.007
36gb|AY270159.1| Triticum aestivum resistance protein T10rga2-1A g... 50 0.007
37gb|AF458280.1| Triticum urartu isolate Tu11498 rga2 protein (rga... 50 0.007
38gb|AF458276.1| Triticum turgidum subsp. dicoccoides isolate Td44... 50 0.007
39gb|AF458275.1| Triticum turgidum subsp. durum isolate Langdon rg... 50 0.007
40gb|AF458273.1| Triticum aestivum isolate ThLr101A rga2 protein (... 50 0.007
41gb|AF458272.1| Triticum aestivum isolate Weique rga2 protein (rg... 50 0.007
42gb|AF458271.1| Triticum aestivum isolate Tesia rga2 protein (rga... 50 0.007
43gb|AF458270.1| Triticum aestivum isolate Pavon rga2 protein (rga... 50 0.007
44gb|AF458269.1| Triticum aestivum isolate Opata rga2 protein (rga... 50 0.007
45gb|AF458268.1| Triticum aestivum isolate Nocazari rga2 protein (... 50 0.007
46gb|AF458267.1| Triticum aestivum isolate Galvez rga2 protein (rg... 50 0.007
47gb|AF458266.1| Triticum aestivum isolate Esmer rga2 protein (rga... 50 0.007
48gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156... 50 0.007
49emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 48 0.029
50gb|AF458277.1| Triticum turgidum subsp. dicoccoides isolate Td98... 48 0.029
51dbj|AB182943.1| Triticum aestivum Wknox1a gene for KN1 homeobox ... 48 0.029
52gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full i... 46 0.11
53emb|X65606.1|HVBKIN12G H.vulgare BKIN12 gene for protein kinase 46 0.11
54gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence 46 0.11
55gb|AY747601.1| Triticum aestivum cultivar Triple Dirk D line VRN... 46 0.11
56gb|AY747600.1| Triticum aestivum cultivar Triple Dirk C line VRN... 46 0.11
57gb|AC004681.3| Arabidopsis thaliana chromosome 2 clone T26B15 ma... 44 0.45
58gb|AY750993.1| Hordeum vulgare cultivar Strider VRN-H1 gene, com... 44 0.45
59gb|AF277249.1|AF277249 Taeniatherum caput-medusae isolate H10254... 44 0.45
60gb|AY896052.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
61gb|AY896044.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
62gb|AY896042.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
63gb|AY896040.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
64gb|AY896036.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
65gb|AY896035.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
66gb|AY553259.1| Hordeum murinum isolate Hor_mur phosphoenolpyruva... 42 1.8
67emb|CR626926.1| Aegilops tauschii 42 1.8
68dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 1.8
69gb|AC154549.2| Mus musculus BAC clone RP23-443L15 from chromosom... 42 1.8
70gb|AY943294.1| Hordeum vulgare subsp. vulgare clone BAC 673I14, ... 42 1.8
71gb|AC154676.2| Mus musculus BAC clone RP23-146O19 from 17, compl... 42 1.8
72gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 1.8
73emb|BX001051.29| Zebrafish DNA sequence from clone DKEYP-68F9 in... 42 1.8
74gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's H... 40 7.1
75gb|AC116739.13| Mus musculus chromosome 17, clone RP23-435B24, c... 40 7.1
76gb|AC122929.4| Mus musculus BAC clone RP23-12A18 from chromosome... 40 7.1
77gb|AC104518.5| Mus Musculus Strain 129S6/SvEvTac chromosome 17 B... 40 7.1
78emb|CR607262.1| full-length cDNA clone CS0DC012YG09 of Neuroblas... 40 7.1
79emb|CR604478.1| full-length cDNA clone CS0DC024YC08 of Neuroblas... 40 7.1
80emb|CR600761.1| full-length cDNA clone CS0DD003YI02 of Neuroblas... 40 7.1
81emb|CR596068.1| full-length cDNA clone CS0DD006YF08 of Neuroblas... 40 7.1
82emb|CR593042.1| full-length cDNA clone CS0DC024YB09 of Neuroblas... 40 7.1
83ref|NM_005169.2| Homo sapiens paired-like (aristaless) homeobox ... 40 7.1
84gb|AC151987.4| Mus musculus BAC clone RP23-356C20 from chromosom... 40 7.1
85gb|AF201084.1|AF201084 Secale cereale secalin precursor (gsec2-1... 40 7.1
86gb|AF182067.1|AF182067S1 Mus musculus secretory protein BV8 (Bv8... 40 7.1
87gb|BC041564.1| Homo sapiens paired-like (aristaless) homeobox 2a... 40 7.1
88gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, co... 40 7.1
89emb|CR354610.16| Zebrafish DNA sequence from clone DKEY-29L6 in ... 40 7.1
90gb|AY896037.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 40 7.1
91emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ... 40 7.1
92gb|U51561.1|U51561 Homo sapiens cosmid clone N79E2 from 22q12, c... 40 7.1
93dbj|AP000593.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 7.1
94gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 7.1
95gb|AF022723.1|HOMOARIX2 Homo sapiens Arix homeodomain protein (A... 40 7.1

>gb|AF498270.1| Haynaldia villosa clone kong36 mRNA
          Length = 1083

 Score =  440 bits (222), Expect = e-120
 Identities = 337/373 (90%), Gaps = 3/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 gtactacacaagatatacgtatacatgggttttacagagcagcatactggacaggatcac 204
           ||||||||||||||| |||||||||||||   ||| ||||| || || ||||| ||||||
Sbjct: 877 gtactacacaagatacacgtatacatggggcgtactgagcaacagaccggacaagatcac 818

                                                                       
Query: 205 aaagattcttgcttgattgcgcaagaacaactcagggtg--gctctacttgcgccttgcc 262
           ||| ||||||||||| ||||||||| ||||||| |||||  |||||||||||||||||||
Sbjct: 817 aaa-attcttgcttggttgcgcaagcacaactcggggtgtggctctacttgcgccttgcc 759

                                                                       
Query: 263 aatatcggcacggcagtccttgcattttcagaaccggagctctgccgtgaccacgacgac 322
           ||||||||||| |||||||||||| || ||||||||| ||||||||| ||||||||||||
Sbjct: 758 aatatcggcacagcagtccttgcacttccagaaccggtgctctgccgcgaccacgacgac 699

                                                                       
Query: 323 ggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatattccgcctcttc 382
           ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 698 ggctttgccctgcccgccatcagcgccgacgctgcactagcttttatattccgcctcttc 639

                                                                       
Query: 383 agcgcgaggtctatcttgccttttgaggctgagccggatggctctgggaagatggaggag 442
           ||||| ||||||| |||| |||| || |||||||| |||||||| ||||||||||||| |
Sbjct: 638 agcgcaaggtctagcttgtctttcgaagctgagcctgatggctccgggaagatggaggcg 579

                                                                       
Query: 443 gccttgatcgccgctctcttgtcctttctgctcttctcgaaatttgaggcgaacctcaca 502
           ||||||||||| |||||||||||||| ||| ||||||||||||| |||||||||||||||
Sbjct: 578 gccttgatcgctgctctcttgtccttcctgttcttctcgaaattcgaggcgaacctcaca 519

                        
Query: 503 cgggctgctgcgg 515
           || ||||| ||||
Sbjct: 518 cgagctgcagcgg 506



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 19  cagtccagcatcatcacttacaaggcaaatcagattctcatgatatgtcacag 71
           |||||||| ||||||| |||||||||||||||| |||||||||||||||||||
Sbjct: 998 cagtccagaatcatcagttacaaggcaaatcagtttctcatgatatgtcacag 946



to top

>ref|XM_465274.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1323

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                        
Query: 317  gacgacggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatattccgc 376
            |||||||||||| |||||| |||||||||||| || || |||| |||||||||||| |||
Sbjct: 1017 gacgacggcttcaccctgctcgccatcagcgctgaggcagcaccagcttttatatttcgc 958

                                                                        
Query: 377  ctcttcagcgcgaggtctatcttgccttttgaggctgagccggatggctctgggaagatg 436
            |||||||| || || || | ||||   ||||| | |||||  |||| ||| |||||||||
Sbjct: 957  ctcttcagtgcaagatccagcttgttctttgaagttgagcttgatgactccgggaagatg 898

                                                                        
Query: 437  gaggaggccttgatcgccgctctcttgtcctttctgctcttctcgaaatttgaggcgaac 496
            || |  ||||| || || ||||| |||||| ||||||||||||| || ||||| || |||
Sbjct: 897  gaagcagccttaattgctgctcttttgtcccttctgctcttctcaaattttgatgcaaac 838

                  
Query: 497  ctcaca 502
             |||||
Sbjct: 837  ttcaca 832



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                            
Query: 317      gacgacggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatattccgc 376
                |||||||||||| |||||| |||||||||||| || || |||| |||||||||||| |||
Sbjct: 13011838 gacgacggcttcaccctgctcgccatcagcgctgaggcagcaccagcttttatatttcgc 13011779

                                                                            
Query: 377      ctcttcagcgcgaggtctatcttgccttttgaggctgagccggatggctctgggaagatg 436
                |||||||| || || || | ||||   ||||| | |||||  |||| ||| |||||||||
Sbjct: 13011778 ctcttcagtgcaagatccagcttgttctttgaagttgagcttgatgactccgggaagatg 13011719

                                                                            
Query: 437      gaggaggccttgatcgccgctctcttgtcctttctgctcttctcgaaatttgaggcgaac 496
                || |  ||||| || || ||||| |||||| ||||||||||||| || ||||| || |||
Sbjct: 13011718 gaagcagccttaattgctgctcttttgtcccttctgctcttctcaaattttgatgcaaac 13011659

                      
Query: 497      ctcaca 502
                 |||||
Sbjct: 13011658 ttcaca 13011653



to top

>dbj|AP004890.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0688H12
          Length = 139279

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                          
Query: 317    gacgacggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatattccgc 376
              |||||||||||| |||||| |||||||||||| || || |||| |||||||||||| |||
Sbjct: 121481 gacgacggcttcaccctgctcgccatcagcgctgaggcagcaccagcttttatatttcgc 121422

                                                                          
Query: 377    ctcttcagcgcgaggtctatcttgccttttgaggctgagccggatggctctgggaagatg 436
              |||||||| || || || | ||||   ||||| | |||||  |||| ||| |||||||||
Sbjct: 121421 ctcttcagtgcaagatccagcttgttctttgaagttgagcttgatgactccgggaagatg 121362

                                                                          
Query: 437    gaggaggccttgatcgccgctctcttgtcctttctgctcttctcgaaatttgaggcgaac 496
              || |  ||||| || || ||||| |||||| ||||||||||||| || ||||| || |||
Sbjct: 121361 gaagcagccttaattgctgctcttttgtcccttctgctcttctcaaattttgatgcaaac 121302

                    
Query: 497    ctcaca 502
               |||||
Sbjct: 121301 ttcaca 121296



to top

>dbj|AK068494.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156M22, full
            insert sequence
          Length = 1323

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 152/186 (81%)
 Strand = Plus / Minus

                                                                        
Query: 317  gacgacggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatattccgc 376
            |||||||||||| |||||| |||||||||||| || || |||| |||||||||||| |||
Sbjct: 1017 gacgacggcttcaccctgctcgccatcagcgctgaggcagcaccagcttttatatttcgc 958

                                                                        
Query: 377  ctcttcagcgcgaggtctatcttgccttttgaggctgagccggatggctctgggaagatg 436
            |||||||| || || || | ||||   ||||| | |||||  |||| ||| |||||||||
Sbjct: 957  ctcttcagtgcaagatccagcttgttctttgaagttgagcttgatgactccgggaagatg 898

                                                                        
Query: 437  gaggaggccttgatcgccgctctcttgtcctttctgctcttctcgaaatttgaggcgaac 496
            || |  ||||| || || ||||| |||||| ||||||||||||| || ||||| || |||
Sbjct: 897  gaagcagccttaattgctgctcttttgtcccttctgctcttctcaaattttgatgcaaac 838

                  
Query: 497  ctcaca 502
             |||||
Sbjct: 837  ttcaca 832



to top

>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||||||||   ||||||||||||||||||||||||| |||| ||||||
Sbjct: 6380 taagagcgtttagatcactaaagtagtgatctaaacactcttatattagtttacagaggg 6321

                 
Query: 144  agtac 148
            |||||
Sbjct: 6320 agtac 6316



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            |||||| |||||||||||||  |||||||||||||| ||||||||||| ||||  |||||
Sbjct: 6338 taagagtgtttagatcactactttagtgatctaaacgctcttatattagtttacggaggg 6397

                  
Query: 144  agtact 149
            ||||||
Sbjct: 6398 agtact 6403



to top

>gb|AF029897.1|AF029897 Triticum aestivum acetyl-coenzyme A carboxylase (Acc-1,1) gene,
            nuclear gene encoding plastid protein, partial cds
          Length = 9285

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            |||||||||||||| |||||| |||||||||||||||||||||||||  |||| ||||||
Sbjct: 6403 taagagcgtttagaacactattttagtgatctaaacactcttatattggtttacagaggg 6462

                 
Query: 144  agtac 148
            |||||
Sbjct: 6463 agtac 6467



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            |||||| |||||||||||||   ||||| ||||||| ||||||||||| ||||  |||||
Sbjct: 6445 taagagtgtttagatcactaaaatagtgttctaaacgctcttatattagtttacggaggg 6386

                
Query: 144  agta 147
            ||||
Sbjct: 6385 agta 6382



to top

>emb|X83518.1|HVKNOX3 H.vulgare Knox3 gene
          Length = 10815

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||||||||  |||||||||||||| ||||||||||| |||| ||||||
Sbjct: 7556 taagagcgtttagatcactactttagtgatctaaacgctcttatattagtttacagaggg 7615

                
Query: 144  agta 147
            ||||
Sbjct: 7616 agta 7619



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatatta 131
            ||||||||||||||||||||   ||||||||||||| |||||||||||
Sbjct: 7598 taagagcgtttagatcactaaagtagtgatctaaacgctcttatatta 7551



to top

>gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (Lrr19), TAK19-1 (Tak19-1), and
             LRK19 (Lrk19) genes, complete cds
          Length = 35872

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                         
Query: 84    taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
             ||||||||||||||||||||  |||||||||||||| |||||||||| ||||| ||||||
Sbjct: 21716 taagagcgtttagatcactactttagtgatctaaacgctcttatatttatttacagaggg 21657

                 
Query: 144   agta 147
             ||||
Sbjct: 21656 agta 21653



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                         
Query: 84    taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
             ||||||||||||||||||||   ||||||||||||| ||||||||||  |||| ||||||
Sbjct: 21674 taagagcgtttagatcactaaagtagtgatctaaacgctcttatatttctttacagaggg 21733

                 
Query: 144   agta 147
             ||||
Sbjct: 21734 agta 21737



to top

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           ||||||||||||||||||||   |||||||| |||||||||||||||||||||  |||||
Sbjct: 765 taagagcgtttagatcactaaaatagtgatcaaaacactcttatattaatttacggaggg 824

                
Query: 144 agtac 148
           |||||
Sbjct: 825 agtac 829



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| |||| ||||||||| |||||||||||||| ||||||||||| ||||  |||||
Sbjct: 807 taagagtgttttgatcactattttagtgatctaaacgctcttatattagtttactgaggg 748

              
Query: 144 agt 146
           |||
Sbjct: 747 agt 745



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 100  actatgttagtgatctaaacactcttatattaatttaaagagggagta 147
            ||||| ||||||||||||||  |||||||||  |||| ||||||||||
Sbjct: 8876 actattttagtgatctaaacgatcttatatttctttacagagggagta 8829



to top

>emb|AJ400713.1|TAE400713 Triticum aestivum vp1B gene for VIVIPAROUS1, exons 1-6
          Length = 4034

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||| ||||| |||||||||||||  ||||||||||| |||| ||||||
Sbjct: 2732 taagagcgtttagattactattttagtgatctaaatgctcttatattagtttacagaggg 2791

                
Query: 144  agta 147
            ||||
Sbjct: 2792 agta 2795



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||| ||||||||||||   |||| |||||||| ||||||||||| ||||  |||||
Sbjct: 2774 taagagcatttagatcactaaaatagtaatctaaacgctcttatattagtttacggaggg 2715

                
Query: 144  agta 147
            ||||
Sbjct: 2714 agta 2711



to top

>gb|AY133248.1| Aegilops tauschii starch synthase II gene, complete cds
          Length = 9024

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||||||||   |||| |||||||| ||||||||||||||||  |||||
Sbjct: 2874 taagagcgtttagatcactaaagtagtaatctaaacgctcttatattaatttacggaggg 2815

                
Query: 144  agta 147
            ||||
Sbjct: 2814 agta 2811



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||| ||||  |||||||||||||| |||||||| || |||| ||| ||
Sbjct: 2832 taagagcgtttagattactactttagtgatctaaacgctcttatagtagtttacagacgg 2891

                
Query: 144  agta 147
            ||||
Sbjct: 2892 agta 2895



to top

>emb|AJ302096.1|ASP302096 Aegilops speltoides Pina gene for puroindoline a, cultivar PI 393494
          Length = 2570

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||||||||| |||||  ||||||| ||||||||||| ||||  |||||
Sbjct: 1410 taagagcgtttagatcactattttagtattctaaacgctcttatattagtttacggaggg 1469

                
Query: 144  agta 147
            ||||
Sbjct: 1470 agta 1473



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||  ||||   ||||||||||||| ||||||||||| |||| ||||||
Sbjct: 1452 taagagcgtttagaatactaaaatagtgatctaaacgctcttatattagtttacagaggg 1393

                   
Query: 144  agtacta 150
            |||||||
Sbjct: 1392 agtacta 1386



to top

>dbj|AB201447.1| Triticum aestivum wSSII-D gene for starch synthase II-D, complete cds
          Length = 7010

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||||||||   |||| |||||||| ||||||||||||||||  |||||
Sbjct: 1630 taagagcgtttagatcactaaagtagtaatctaaacgctcttatattaatttacggaggg 1571

                
Query: 144  agta 147
            ||||
Sbjct: 1570 agta 1567



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||| ||||  |||||||||||||| |||||||| || |||| ||| ||
Sbjct: 1588 taagagcgtttagattactactttagtgatctaaacgctcttatagtagtttacagacgg 1647

                
Query: 144  agta 147
            ||||
Sbjct: 1648 agta 1651



to top

>emb|AJ507214.1|HVU507214 Hordeum vulgare bbr gene for barley B recombinant
          Length = 4946

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatatt 130
            ||||||||||||||||||||  ||||||||||| |||||||||||||
Sbjct: 4310 taagagcgtttagatcactactttagtgatctagacactcttatatt 4356



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatatt 130
            |||||| || ||||||||||   ||||||||||||| ||||||||||
Sbjct: 4352 taagagtgtctagatcactaaagtagtgatctaaacgctcttatatt 4306



to top

>gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence
          Length = 1082

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                      
Query: 92   tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
            ||||||||||||  |||||||||||||  ||||||||||| |||| ||||||||||||
Sbjct: 971  tttagatcactactttagtgatctaaaagctcttatattagtttacagagggagtact 1028



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 113 tctaaacactcttatattaatttaaagagggagtac 148
           ||||||| ||||||||||| ||||| ||||||||||
Sbjct: 969 tctaaacgctcttatattagtttaaggagggagtac 934



to top

>gb|AY107525.1| Zea mays PCO115693 mRNA sequence
          Length = 726

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 313 ccacgacgacggcttcgccctgcccgccatcagcgcagacgctgcactagcttttatatt 372
           |||||| ||||||||| ||||||| |||||||| || |  || || | ||||||||| ||
Sbjct: 521 ccacgaggacggcttcaccctgcctgccatcagtgctgtagcggctccagcttttatgtt 462

                                
Query: 373 ccgcctcttcagcgcgaggtc 393
           ||||||||||||| |||||||
Sbjct: 461 ccgcctcttcagcacgaggtc 441



to top

>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus
              region
          Length = 160897

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                          
Query: 84     taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
              ||||||| |||||| |||||  ||||| || ||||||||||||||||| |||| ||||||
Sbjct: 150213 taagagcatttagaacactactttagtaatttaaacactcttatattagtttacagaggg 150272

                  
Query: 144    agta 147
              ||||
Sbjct: 150273 agta 150276



to top

>gb|AF474071.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC clone 745c13,
             complete sequence
          Length = 102842

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                         
Query: 84    taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
             ||||||| ||||||  ||||  ||||| |||||||||||||||||||| |||| ||||||
Sbjct: 34573 taagagcatttagaatactactttagtaatctaaacactcttatattagtttacagaggg 34514

                 
Query: 144   agta 147
             ||||
Sbjct: 34513 agta 34510



to top

>emb|CR626933.1| Triticum turgidum
          Length = 25216

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 87    gagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagt 146
             ||||||||||||||| |   |||||||||||| |||||||||||  |||| |||||||||
Sbjct: 11696 gagcgtttagatcaccaaagtagtgatctaaatactcttatatttctttatagagggagt 11755

                
Query: 147   act 149
             |||
Sbjct: 11756 act 11758



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||||||||||  || ||||||||||| ||| ||||||  ||||  |||||||||
Sbjct: 11727 tttagatcactactttggtgatctaaacgctcatatatttctttacggagggagta 11672



to top

>emb|CR626929.1| Triticum aestivum
          Length = 20745

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 87    gagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagt 146
             ||||||||||||||| |   |||||||||||| |||||||||||  |||| |||||||||
Sbjct: 14414 gagcgtttagatcaccaaagtagtgatctaaatactcttatatttctttatagagggagt 14473

                
Query: 147   act 149
             |||
Sbjct: 14474 act 14476



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||||||||||  || ||||||||||| ||| ||||||  ||||  |||||||||
Sbjct: 14445 tttagatcactactttggtgatctaaacgctcatatatttctttacggagggagta 14390



to top

>gb|AF326781.1| Triticum monococcum actin (ACT-1) gene, partial cds; putative chromosome
              condensation factor (CCF), putative resistance protein
              (RGA-2), putative resistance protein (RGA2) and putative
              nodulin-like-like protein (NLL) gene, complete cds; and
              retrotransposons Josephine, Angela-2, Angela-4, Heidi,
              Greti, Angela-3, Fatima, Erika-1, Angela-6, Angela-5,
              Barbara, Isabelle, Erika-2, and Claudia
          Length = 211009

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 92     tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
              ||||||||||||| ||| | |||||| ||||||||||||| |||| ||| |||||||
Sbjct: 201043 tttagatcactattttacttatctaagcactcttatattagtttacagatggagtac 200987



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                       
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
             ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 29769 tttagatcactactttagtgatctaaaaggtcttatattagtttacagagggaatact 29826



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
             ||||||||||||   ||||||||||||   |||||||||| |||| |||||||||||
Sbjct: 29795 tttagatcactaaagtagtgatctaaaaggtcttatattagtttacagagggagtac 29739



to top

>dbj|AB178167.1| Triticum aestivum Wcbf2-2 mRNA for AP2/EREBP type transcription
           factor, complete cds
          Length = 941

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 107 tagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||||||||||||||||||||||| ||||  |||||||||
Sbjct: 782 tagtgatctaaacactcttatattagtttacggagggagta 822



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| |||||||||||||| ||| |||| ||||  ||||||||||| ||||  |||||
Sbjct: 801 taagagtgtttagatcactattttaatgatttaaatgctcttatattagtttaccgaggg 742

               
Query: 144 agta 147
           ||||
Sbjct: 741 agta 738



to top

>gb|AF099671.1|AF099671 Secale cereale thaumatin-like protein 2 precursor (TLP2) mRNA,
           complete cds
          Length = 975

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           ||||||||||||   ||||| ||||||||||||||||||| ||||  ||||||||||
Sbjct: 669 tttagatcactaaagtagtgttctaaacactcttatattagtttacggagggagtac 725



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| ||||||| |||||  |||||||||||||  || |||||||| |||| ||||||
Sbjct: 703 taagagtgtttagaacactactttagtgatctaaatgcttttatattagtttacagaggg 644

               
Query: 144 agta 147
           ||||
Sbjct: 643 agta 640



to top

>gb|AF099670.1|AF099670 Secale cereale thaumatin-like protein 3 precursor (TLP3) gene,
           complete cds
          Length = 1003

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           ||||||||||||   ||||| ||||||||||||||||||| ||||  ||||||||||
Sbjct: 761 tttagatcactaaagtagtgttctaaacactcttatattagtttacggagggagtac 817



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| ||||||| |||||  |||||||||||||  || |||||||| |||| ||||||
Sbjct: 795 taagagtgtttagaacactactttagtgatctaaatgcttttatattagtttacagaggg 736

               
Query: 144 agta 147
           ||||
Sbjct: 735 agta 732



to top

>gb|AF096927.1|AF096927 Secale cereale thaumatin-like protein 1 precursor (TLP1) mRNA,
           complete cds
          Length = 1151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           ||||||||||||   ||||| ||||||||||||||||||| ||||  ||||||||||
Sbjct: 659 tttagatcactaaagtagtgttctaaacactcttatattagtttacggagggagtac 715



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| ||||||| |||||  |||||||||||||  || |||||||| |||| ||||||
Sbjct: 693 taagagtgtttagaacactactttagtgatctaaatgcttttatattagtttacagaggg 634

               
Query: 144 agta 147
           ||||
Sbjct: 633 agta 630



to top

>gb|AY230322.1| Triticum aestivum FCA-A1 (Fca) gene, partial cds
          Length = 9585

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 115  taaacactcttatattaatttaaagagggagtacta 150
            ||||||||||||||||||||||  ||||||||||||
Sbjct: 9214 taaacactcttatattaatttacggagggagtacta 9249



to top

>gb|AF376136.1|AF376136 Triticum aestivum putative CRT/DRE-binding factor (CBF1) mRNA,
           complete cds
          Length = 800

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||| |||||||||||||| ||| |||| ||||  ||||||||||| ||||  |||||
Sbjct: 758 taagagtgtttagatcactattttaatgatttaaatgctcttatattagtttaccgaggg 699

               
Query: 144 agta 147
           ||||
Sbjct: 698 agta 695



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 107 tagtgatctaaacactcttatattaa 132
           ||||||||||||||||||||||||||
Sbjct: 739 tagtgatctaaacactcttatattaa 764



to top

>emb|AM000057.1| Hordeum vulgare HKT1 gene for high-affinity sodium transporter, exons
            1-3
          Length = 2155

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 92   tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagta 147
            |||||| |||||  ||||| |||||||| ||||||||||| |||| ||||||||||
Sbjct: 1283 tttagaacactactttagtaatctaaacgctcttatattagtttacagagggagta 1338



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||| ||||   ||||| ||||||  || |||||||| |||| || |||
Sbjct: 1317 taagagcgtttagattactaaagtagtgttctaaatgcttttatattagtttacaggggg 1258

                  
Query: 144  agtact 149
            ||||||
Sbjct: 1257 agtact 1252



to top

>gb|AF277253.1|AF277253 Australopyrum velutinum isolate H6724 disrupted meiotic cDNA 1
           protein (DMC1) gene, partial cds
          Length = 1062

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 107 tagtgatctaaacactcttatattaatttaaagagggagtact 149
           ||||||||||||| ||||||||||  |||| ||||||||||||
Sbjct: 843 tagtgatctaaacgctcttatatttctttacagagggagtact 885



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 54/64 (84%), Gaps = 6/64 (9%)
 Strand = Plus / Minus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           ||||||||||||||||||||      |||||||||| ||||||||||  |||| ||||||
Sbjct: 862 taagagcgtttagatcacta------tgatctaaacgctcttatatttctttacagaggg 809

               
Query: 144 agta 147
           ||||
Sbjct: 808 agta 805



to top

>gb|AF458279.1| Triticum monococcum isolate Tm896 rga2 protein (rga2) gene, partial
           cds
          Length = 1438

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
           ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 247 tttagatcactactttagtgatctaaaaggtcttatattagtttacagagggaatact 190



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           ||||||||||||   ||||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaaagtagtgatctaaaaggtcttatattagtttacagagggagtac 277



to top

>gb|AF458278.1| Triticum monococcum isolate Tm13010 rga2 protein (rga2) gene,
           partial cds
          Length = 1439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
           ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 247 tttagatcactactttagtgatctaaaaggtcttatattagtttacagagggaatact 190



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           ||||||||||||   |||||||||||| | |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaaagtagtgatctaaa-agtcttatattagtttacagagggagtac 276



to top

>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, exons 1 and 2
          Length = 2205

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 107 tagtgatctaaacactcttatattaattta 136
           |||||||||||||||||||||||| |||||
Sbjct: 108 tagtgatctaaacactcttatatttattta 79



to top

>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 84     taagagcgtttagatcactatgttagtgatctaaacactcttatattaattta 136
              |||||| ||||||||||| || ||| |||||| ||| ||||||||||| ||||
Sbjct: 177681 taagagagtttagatcacaattttaatgatctcaacgctcttatattagttta 177733



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                          
Query: 84     taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
              |||||||||| |||||| ||   | ||||||||||| ||||||||||| ||||  |||||
Sbjct: 177723 taagagcgttgagatcattaaaattgtgatctaaactctcttatattagtttacggaggg 177664

                 
Query: 144    agt 146
              |||
Sbjct: 177663 agt 177661



to top

>emb|CR626934.1| Triticum aestivum
          Length = 94398

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 57/67 (85%), Gaps = 3/67 (4%)
 Strand = Plus / Plus

                                                                         
Query: 84    taagagcgtttagatcacta---tgttagtgatctaaacactcttatattaatttaaaga 140
             ||||||||||||||||||||   |  ||||||||||||| |||| ||||| ||| | |||
Sbjct: 47967 taagagcgtttagatcactagagtagtagtgatctaaacgctctcatatttattcacaga 48026

                    
Query: 141   gggagta 147
             |||||||
Sbjct: 48027 gggagta 48033



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 107   tagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||||||||||| ||||||||||| |||| | ||||||||
Sbjct: 47986 tagtgatctaaacgctcttatattattttacatagggagta 47946



to top

>gb|AY270159.1| Triticum aestivum resistance protein T10rga2-1A gene, complete cds
          Length = 4768

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                     
Query: 92   tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
            |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 1135 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 1190



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 50/58 (86%), Gaps = 1/58 (1%)
 Strand = Plus / Minus

                                                                      
Query: 92   tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
            ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 1160 tttagatcactac-ttagtgatctaaaaggtcttatattagtttacagagggaatact 1104



to top

>gb|AF458280.1| Triticum urartu isolate Tu11498 rga2 protein (rga2) gene, partial
           cds
          Length = 1437

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458276.1| Triticum turgidum subsp. dicoccoides isolate Td4467 rga2 protein
           (rga2) gene, partial cds
          Length = 1436

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458275.1| Triticum turgidum subsp. durum isolate Langdon rga2 protein (rga2)
           gene, partial cds
          Length = 1438

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458273.1| Triticum aestivum isolate ThLr101A rga2 protein (rga2) gene,
           partial cds
          Length = 1438

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458272.1| Triticum aestivum isolate Weique rga2 protein (rga2) gene, partial
           cds
          Length = 1435

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458271.1| Triticum aestivum isolate Tesia rga2 protein (rga2) gene, partial
           cds
          Length = 1438

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458270.1| Triticum aestivum isolate Pavon rga2 protein (rga2) gene, partial
           cds
          Length = 1438

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458269.1| Triticum aestivum isolate Opata rga2 protein (rga2) gene, partial
           cds
          Length = 1437

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AF458268.1| Triticum aestivum isolate Nocazari rga2 protein (rga2) gene,
           partial cds
          Length = 1437

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| | ||||||||||||   |||||||||| |||| |||||||||||
Sbjct: 220 tttagatcactaag-tagtgatctaaaaggtcttatattagtttacagagggagtac 275



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 50/58 (86%), Gaps = 1/58 (1%)
 Strand = Plus / Minus

                                                                     
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
           ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 245 tttagatcactac-ttagtgatctaaaaggtcttatattagtttacagagggaatact 189



to top

>gb|AF458267.1| Triticum aestivum isolate Galvez rga2 protein (rga2) gene, partial
           cds
          Length = 1436

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| | ||||||||||||   |||||||||| |||| |||||||||||
Sbjct: 220 tttagatcactaag-tagtgatctaaaaggtcttatattagtttacagagggagtac 275



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 50/58 (86%), Gaps = 1/58 (1%)
 Strand = Plus / Minus

                                                                     
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
           ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 245 tttagatcactac-ttagtgatctaaaaggtcttatattagtttacagagggaatact 189



to top

>gb|AF458266.1| Triticum aestivum isolate Esmer rga2 protein (rga2) gene, partial
           cds
          Length = 1437

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Plus

                                                                    
Query: 92  tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 276



to top

>gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156G16, complete sequence
          Length = 187012

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                      
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtac 148
             |||||||||||| || |||||||||||   |||||||||| |||| |||||||||||
Sbjct: 47549 tttagatcactaagt-agtgatctaaaaggtcttatattagtttacagagggagtac 47494



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 50/58 (86%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                       
Query: 92    tttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
             ||||||||||||  |||||||||||||   |||||||||| |||| ||||||| ||||
Sbjct: 47524 tttagatcactac-ttagtgatctaaaaggtcttatattagtttacagagggaatact 47580



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                        
Query: 90   cgtttagatcactatgttagtgatctaaacactcttatattaatttaaagagggagtact 149
            ||||||||||| ||  ||||| |||||||| ||||||||||| || |  |||||||||||
Sbjct: 1728 cgtttagatcattactttagttatctaaacgctcttatattacttcatggagggagtact 1787



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                        
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
            ||||||||||||||| ||||   || ||||||||||  | |||||||| |||| ||| ||
Sbjct: 1764 taagagcgtttagataactaaagtaatgatctaaacgtttttatattagtttacagaagg 1705

                  
Query: 144  agtact 149
            ||||||
Sbjct: 1704 agtact 1699



to top

>gb|AF458277.1| Triticum turgidum subsp. dicoccoides isolate Td9803 rga2 protein
           (rga2) gene, partial cds
          Length = 1441

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 51/59 (86%), Gaps = 2/59 (3%)
 Strand = Plus / Plus

                                                                      
Query: 92  tttagatcactatgt--tagtgatctaaacactcttatattaatttaaagagggagtac 148
           |||||||||||| ||  ||||||||||||   |||||||||| |||| |||||||||||
Sbjct: 221 tttagatcactaagtagtagtgatctaaaaggtcttatattagtttacagagggagtac 279



to top

>dbj|AB182943.1| Triticum aestivum Wknox1a gene for KN1 homeobox protein, complete cds
          Length = 9755

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 108  agtgatctaaacactcttatattaatttaaagagggagta 147
            |||||||||||||||||||||||  ||||  |||||||||
Sbjct: 8008 agtgatctaaacactcttatatttctttacggagggagta 7969



to top

>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA
           sequence
          Length = 1768

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 107 tagtgatctaaacactcttatattaatttaaagagggagtact 149
           |||||||||||| | |||||||||| | || ||||||||||||
Sbjct: 397 tagtgatctaaaaagtcttatattagtctacagagggagtact 439



to top

>emb|X65606.1|HVBKIN12G H.vulgare BKIN12 gene for protein kinase
          Length = 5574

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 92   tttagatcactatgttagtgatctaaacactcttatatt 130
            ||||||| ||||  ||||||||||||||| |||||||||
Sbjct: 2288 tttagataactactttagtgatctaaacattcttatatt 2326



to top

>gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence
          Length = 261265

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 45/50 (90%), Gaps = 3/50 (6%)
 Strand = Plus / Minus

                                                               
Query: 84    taagagcgtttagatcactatgt-tagtgatc--taaacactcttatatt 130
             ||||||||||||||||||||| | ||||||||  ||||||| ||||||||
Sbjct: 11930 taagagcgtttagatcactatttctagtgatctataaacacacttatatt 11881



to top

>gb|AY747601.1| Triticum aestivum cultivar Triple Dirk D line VRN-A1 (VRN-A1) gene,
            complete cds; and Stowaway MITE and gypsy retrotransposon
            Sukkula, complete sequence
          Length = 12464

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatatt 130
            ||||||||||||| ||||||  | |||||||| ||| ||||||||||
Sbjct: 4968 taagagcgtttaggtcactacttgagtgatctgaacgctcttatatt 5014



to top

>gb|AY747600.1| Triticum aestivum cultivar Triple Dirk C line VRN-A1 (VRN-A1) gene,
            complete cds; and Stowaway MITE and gypsy retrotransposon
            Sukkula, complete sequence
          Length = 12233

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 84   taagagcgtttagatcactatgttagtgatctaaacactcttatatt 130
            ||||||||||||| ||||||  | |||||||| ||| ||||||||||
Sbjct: 4737 taagagcgtttaggtcactacttgagtgatctgaacgctcttatatt 4783



to top

>gb|AC004681.3| Arabidopsis thaliana chromosome 2 clone T26B15 map TEn5, complete
             sequence
          Length = 78732

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 127   tattaatttaaagagggagtac 148
             ||||||||||||||||||||||
Sbjct: 62073 tattaatttaaagagggagtac 62094



to top

>gb|AY750993.1| Hordeum vulgare cultivar Strider VRN-H1 gene, complete cds; and
             transposon MITE-like and retrotransposon Lolaog, complete
             sequence
          Length = 17220

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 106   ttagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 16731 ttagtaatctaaacgcttttatattaatttacagatggagta 16690



to top

>gb|AF277249.1|AF277249 Taeniatherum caput-medusae isolate H10254 disrupted meiotic cDNA 1
           protein (DMC1) gene, partial cds
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 55/66 (83%), Gaps = 5/66 (7%)
 Strand = Plus / Plus

                                                                       
Query: 84  taagagcgtttagatcactatgttagtgatctaaacactcttatattaatttaaagaggg 143
           |||||||||||||||||     |||||||| ||||| ||||||||||  |||| ||||||
Sbjct: 828 taagagcgtttagatca-----ttagtgatataaacgctcttatatttctttacagaggg 882

                 
Query: 144 agtact 149
            |||||
Sbjct: 883 tgtact 888



to top

>gb|AY896052.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 924 ttagtaatctaaacgcttttatattaatttacagatggagta 883



to top

>gb|AY896044.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1261

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 925 ttagtaatctaaacgcttttatattaatttacagatggagta 884



to top

>gb|AY896042.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 924 ttagtaatctaaacgcttttatattaatttacagatggagta 883



to top

>gb|AY896040.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 924 ttagtaatctaaacgcttttatattaatttacagatggagta 883



to top

>gb|AY896036.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 924 ttagtaatctaaacgcttttatattaatttacagatggagta 883



to top

>gb|AY896035.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 106 ttagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||| |||||||| || ||||||||||||| ||| ||||||
Sbjct: 924 ttagtaatctaaacgcttttatattaatttacagatggagta 883



to top

>gb|AY553259.1| Hordeum murinum isolate Hor_mur phosphoenolpyruvate carboxylase
           (pepC) gene, exons 1, 2 and partial cds
          Length = 1117

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 107 tagtgatctaaacactcttatattaatttaaagagggagta 147
           ||||||||||||  ||||||||||| ||||  |||||||||
Sbjct: 574 tagtgatctaaatgctcttatattagtttacggagggagta 614



to top

>emb|CR626926.1| Aegilops tauschii
          Length = 94421

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 107   tagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||||||||||| |||| ||||| ||| | ||||||||||
Sbjct: 85588 tagtgatctaaacgctctcatatttattcacagagggagta 85628



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 107   tagtgatctaaacactcttatattaatttaaagagggagta 147
             ||||||||||||| || |||||||| |||| | ||||||||
Sbjct: 85581 tagtgatctaaacgcttttatattattttacatagggagta 85541



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 324     gcttcgccctgcccgccatcagcgc 348
               ||||||||||| |||||||||||||
Sbjct: 4410692 gcttcgccctggccgccatcagcgc 4410716



to top

>gb|AC154549.2| Mus musculus BAC clone RP23-443L15 from chromosome 17, complete sequence
          Length = 191523

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 105    gttagtgatctaaacactcttatat 129
              |||| ||||||||||||||||||||
Sbjct: 108939 gttaatgatctaaacactcttatat 108915



to top

>gb|AY943294.1| Hordeum vulgare subsp. vulgare clone BAC 673I14, complete sequence
          Length = 108608

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 115   taaacactcttatattaatttaaagagggagta 147
             ||||| |||||||||||||||| ||||| ||||
Sbjct: 73089 taaacgctcttatattaatttatagaggaagta 73121



to top

>gb|AC154676.2| Mus musculus BAC clone RP23-146O19 from 17, complete sequence
          Length = 180352

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 105   gttagtgatctaaacactcttatat 129
             |||| ||||||||||||||||||||
Sbjct: 40589 gttaatgatctaaacactcttatat 40565



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 324     gcttcgccctgcccgccatcagcgc 348
               ||||||||||| |||||||||||||
Sbjct: 4412383 gcttcgccctggccgccatcagcgc 4412407



to top

>emb|BX001051.29| Zebrafish DNA sequence from clone DKEYP-68F9 in linkage group 9, complete
              sequence
          Length = 213486

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 111    gatctaaacactcttatattaattt 135
              |||||||||| ||||||||||||||
Sbjct: 185976 gatctaaacattcttatattaattt 185952



to top

>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 231716

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 275    gcagtccttgcattttcaga 294
              ||||||||||||||||||||
Sbjct: 144129 gcagtccttgcattttcaga 144110



to top

>gb|AC116739.13| Mus musculus chromosome 17, clone RP23-435B24, complete sequence
          Length = 222382

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 455    gctctcttgtcctttctgct 474
              ||||||||||||||||||||
Sbjct: 155063 gctctcttgtcctttctgct 155082



to top

>gb|AC122929.4| Mus musculus BAC clone RP23-12A18 from chromosome 6, complete sequence
          Length = 252503

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 421    tggctctgggaagatggagg 440
              ||||||||||||||||||||
Sbjct: 130373 tggctctgggaagatggagg 130354



to top

>gb|AC104518.5| Mus Musculus Strain 129S6/SvEvTac chromosome 17 BAC, RP22-187D17,
             Complete Sequence, complete sequence
          Length = 163367

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 455   gctctcttgtcctttctgct 474
             ||||||||||||||||||||
Sbjct: 60826 gctctcttgtcctttctgct 60807



to top

>emb|CR607262.1| full-length cDNA clone CS0DC012YG09 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1649

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 392 gccggatggctctgggaaga 373



to top

>emb|CR604478.1| full-length cDNA clone CS0DC024YC08 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1284

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 37  gccggatggctctgggaaga 18



to top

>emb|CR600761.1| full-length cDNA clone CS0DD003YI02 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1658

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 394 gccggatggctctgggaaga 375



to top

>emb|CR596068.1| full-length cDNA clone CS0DD006YF08 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1651

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 398 gccggatggctctgggaaga 379



to top

>emb|CR593042.1| full-length cDNA clone CS0DC024YB09 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1663

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 394 gccggatggctctgggaaga 375



to top

>ref|NM_005169.2| Homo sapiens paired-like (aristaless) homeobox 2a (PHOX2A), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 405 gccggatggctctgggaaga 386



to top

>gb|AC151987.4| Mus musculus BAC clone RP23-356C20 from chromosome 17, complete sequence
          Length = 245262

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 110    tgatctaaacactcttatat 129
              ||||||||||||||||||||
Sbjct: 166311 tgatctaaacactcttatat 166330



to top

>gb|AF201084.1|AF201084 Secale cereale secalin precursor (gsec2-1) gene, complete cds
          Length = 4971

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 32/35 (91%), Gaps = 2/35 (5%)
 Strand = Plus / Plus

                                               
Query: 84   taagagcgtttagatcactatgttagtgatctaaa 118
            ||||||||||  ||||||||| |||||||||||||
Sbjct: 2974 taagagcgtt--gatcactattttagtgatctaaa 3006



to top

>gb|AF182067.1|AF182067S1 Mus musculus secretory protein BV8 (Bv8) gene, exons 1 and 2
          Length = 12920

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 421  tggctctgggaagatggagg 440
            ||||||||||||||||||||
Sbjct: 6954 tggctctgggaagatggagg 6935



to top

>gb|BC041564.1| Homo sapiens paired-like (aristaless) homeobox 2a, mRNA (cDNA clone
           MGC:52227 IMAGE:5923445), complete cds
          Length = 1698

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 403 gccggatggctctgggaaga 384



to top

>gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, complete sequence
          Length = 165190

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 455    gctctcttgtcctttctgct 474
              ||||||||||||||||||||
Sbjct: 149162 gctctcttgtcctttctgct 149143



to top

>emb|CR354610.16| Zebrafish DNA sequence from clone DKEY-29L6 in linkage group 13,
            complete sequence
          Length = 113182

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 457  tctcttgtcctttctgctcttctc 480
            |||||| |||||||||||||||||
Sbjct: 4045 tctcttctcctttctgctcttctc 4068



to top

>gb|AY896037.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 MADS box
           transcription factor (Vrn1) gene, partial cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 106 ttagtgatctaaacactcttatattaatttaaagag 141
           ||||| |||||||| || ||||||||||||| ||||
Sbjct: 923 ttagtaatctaaacgcttttatattaatttacagag 888



to top

>emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E (5 of 5)
          Length = 2199546

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 168     catgggttttacagagcagc 187
               ||||||||||||||||||||
Sbjct: 1731591 catgggttttacagagcagc 1731572



to top

>gb|U51561.1|U51561 Homo sapiens cosmid clone N79E2 from 22q12, complete sequence
          Length = 39683

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   tcttatattaatttaaagag 141
             ||||||||||||||||||||
Sbjct: 35567 tcttatattaatttaaagag 35586



to top

>dbj|AP000593.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-4J8, complete
             sequence
          Length = 124635

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   gccggatggctctgggaaga 434
             ||||||||||||||||||||
Sbjct: 30118 gccggatggctctgggaaga 30137



to top

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 328     cgccctgcccgccatcagcg 347
               ||||||||||||||||||||
Sbjct: 3400711 cgccctgcccgccatcagcg 3400692



to top

>gb|AF022723.1|HOMOARIX2 Homo sapiens Arix homeodomain protein (ARIX) gene, exon 2
          Length = 510

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 gccggatggctctgggaaga 434
           ||||||||||||||||||||
Sbjct: 210 gccggatggctctgggaaga 191


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,136,337
Number of Sequences: 3902068
Number of extensions: 4136337
Number of successful extensions: 86018
Number of sequences better than 10.0: 95
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 85700
Number of HSP's gapped (non-prelim): 314
length of query: 523
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 500
effective length of database: 17,143,297,704
effective search space: 8571648852000
effective search space used: 8571648852000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top