Clone Name	rbart27b06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK103409.1| Oryza sativa (japonica cultivar-group) cDNA clon...	325	9e-86
2	dbj|AK059278.1| Oryza sativa (japonica cultivar-group) cDNA clon...	317	2e-83
3	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	208	1e-50
4	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	208	1e-50
5	emb|BX000502.2|CNS08CDS Oryza sativa chromosome 12, . BAC OSJNBb...	208	1e-50
6	gb|AC123527.3| Oryza sativa (japonica cultivar-group) chromosome...	200	3e-48
7	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	200	3e-48
8	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	200	3e-48
9	gb|AY106160.1| Zea mays PCO089266 mRNA sequence	86	1e-13
10	gb|BT014117.1| Lycopersicon esculentum clone 133222R, mRNA sequence	72	2e-09
11	ref|NM_120499.4| Arabidopsis thaliana calcium ion binding AT5G04...	70	8e-09
12	gb|BT008838.1| Arabidopsis thaliana At5g04170 mRNA, complete cds	70	8e-09
13	gb|AY081342.1| Arabidopsis thaliana EF-hand calcium binding prot...	70	8e-09
14	emb|BX831460.1|CNS0A1WC Arabidopsis thaliana Full-length cDNA Co...	70	8e-09
15	emb|BX831038.1|CNS0A1WE Arabidopsis thaliana Full-length cDNA Co...	70	8e-09
16	emb|BX830610.1|CNS0A1Z3 Arabidopsis thaliana Full-length cDNA Co...	70	8e-09
17	emb|BX830373.1|CNS0A1YJ Arabidopsis thaliana Full-length cDNA Co...	70	8e-09
18	ref|NM_111865.4| Arabidopsis thaliana calcium ion binding AT3G10...	68	3e-08
19	ref|NM_180667.2| Arabidopsis thaliana calcium ion binding AT3G10...	68	3e-08
20	ref|NM_001035591.1| Arabidopsis thaliana calcium ion binding AT3...	68	3e-08
21	gb|BT015172.1| Arabidopsis thaliana At3g10300 gene, complete cds	68	3e-08
22	gb|AY062498.1| Arabidopsis thaliana Unknown protein (At3g10300; ...	68	3e-08
23	emb|BX823832.1|CNS0A7KF Arabidopsis thaliana Full-length cDNA Co...	68	3e-08
24	gb|DQ226650.1| Boechera divaricarpa isolate SLW-5-G06 mRNA sequence	64	5e-07
25	emb|BX830151.1|CNS0A1YG Arabidopsis thaliana Full-length cDNA Co...	62	2e-06
26	emb|AL391716.1|ATF21E1 Arabidopsis thaliana DNA chromosome 5, BA...	56	1e-04
27	emb|BX831366.1|CNS0A273 Arabidopsis thaliana Full-length cDNA Co...	54	5e-04
28	emb|BX831737.1|CNS0A1X3 Arabidopsis thaliana Full-length cDNA Co...	54	5e-04
29	emb|BX831278.1|CNS0A1WK Arabidopsis thaliana Full-length cDNA Co...	52	0.002
30	emb|BX830845.1|CNS09ZFX Arabidopsis thaliana Full-length cDNA Co...	52	0.002
31	gb|AY742306.1| Malus x domestica calcium-binding EF hand family ...	50	0.008
32	emb|BX829719.1|CNS0A1ZB Arabidopsis thaliana Full-length cDNA Co...	50	0.008
33	emb|BX830310.1|CNS0A08N Arabidopsis thaliana Full-length cDNA Co...	50	0.008
34	gb|AY431726.1| Aedes aegypti ASAP ID: 35119 questionable: large ...	48	0.030
35	emb|AJ251828.1|PSA251828 Pisum sativum partial mRNA for putative...	48	0.030
36	emb|CR718554.2|CNS0GHDS Tetraodon nigroviridis full-length cDNA	46	0.12
37	emb|CR716203.2|CNS0GFKK Tetraodon nigroviridis full-length cDNA	46	0.12
38	emb|CR710713.2|CNS0GBC5 Tetraodon nigroviridis full-length cDNA	46	0.12
39	emb|CR706457.2|CNS0G81X Tetraodon nigroviridis full-length cDNA	46	0.12
40	emb|CR684420.2|CNS0FR1S Tetraodon nigroviridis full-length cDNA	46	0.12
41	gb|AC009400.4|ATAC009400 Arabidopsis thaliana chromosome III BAC...	44	0.47
42	emb|CR704396.2|CNS0G6GO Tetraodon nigroviridis full-length cDNA	44	0.47
43	emb|CR702313.2|CNS0G4UT Tetraodon nigroviridis full-length cDNA	44	0.47
44	emb|CR701693.1|CNS0G4DL Tetraodon nigroviridis full-length cDNA	44	0.47
45	emb|CR701182.2|CNS0G3ZE Tetraodon nigroviridis full-length cDNA	44	0.47
46	emb|CR700340.1|CNS0G3C0 Tetraodon nigroviridis full-length cDNA	44	0.47
47	emb|CR696556.2|CNS0G0EW Tetraodon nigroviridis full-length cDNA	44	0.47
48	emb|CR694535.1|CNS0FYUR Tetraodon nigroviridis full-length cDNA	44	0.47
49	emb|CR692906.2|CNS0FXLI Tetraodon nigroviridis full-length cDNA	44	0.47
50	emb|CR692493.2|CNS0FXA1 Tetraodon nigroviridis full-length cDNA	44	0.47
51	emb|CR691997.2|CNS0FWW9 Tetraodon nigroviridis full-length cDNA	44	0.47
52	emb|CR688852.2|CNS0FUGW Tetraodon nigroviridis full-length cDNA	44	0.47
53	emb|CR684360.2|CNS0FR04 Tetraodon nigroviridis full-length cDNA	44	0.47
54	emb|CR679151.2|CNS0FMZF Tetraodon nigroviridis full-length cDNA	44	0.47
55	emb|CR671534.2|CNS0FH4K Tetraodon nigroviridis full-length cDNA	44	0.47
56	emb|CR670949.1|CNS0FGOB Tetraodon nigroviridis full-length cDNA	44	0.47
57	emb|CR669089.2|CNS0FF8N Tetraodon nigroviridis full-length cDNA	44	0.47
58	gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome	44	0.47
59	emb|AL591793.1|SME591793 Sinorhizobium meliloti 1021 complete ch...	42	1.9
60	emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chr...	42	1.9
61	gb|AC154341.2| Mus musculus BAC clone RP23-240C2 from 16, comple...	42	1.9
62	emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chr...	42	1.9
63	gb|AF009663.1|HSTCRB75A Homo sapiens T cell receptor beta locus,...	40	7.3
64	gb|AY513883.1| Homo sapiens T-cell receptor beta mRNA, partial cds	40	7.3
65	gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribo...	40	7.3
66	gb|AF009662.1|HSTCRBB27 Homo sapiens T cell receptor beta locus,...	40	7.3
67	gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein...	40	7.3
68	ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) ...	40	7.3
69	gb|AF289077.4| Homo sapiens chromosome 8 clone CTD-2003M15 map p...	40	7.3
70	gb|AY464739.1| Uncultured archaeon clone AF02 16S ribosomal RNA ...	40	7.3
71	gb|BC071724.1| Homo sapiens cDNA clone IMAGE:5212614, **** WARNI...	40	7.3
72	emb|AL591472.7| Human DNA sequence from clone RP11-438A6 on chro...	40	7.3
73	emb|AL137801.11| Human DNA sequence from clone RP4-609B14 on chr...	40	7.3
74	emb|BX072100.1|CNS09RSO Single read from an extremity of a full-...	40	7.3
75	emb|BX072099.1|CNS09RSN Single read from an extremity of a full-...	40	7.3
76	emb|BX071992.1|CNS09RPO Single read from an extremity of a full-...	40	7.3
77	emb|BX071991.1|CNS09RPN Single read from an extremity of a full-...	40	7.3
78	emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-...	40	7.3
79	emb|BX071469.1|CNS09RB5 Single read from an extremity of a full-...	40	7.3
80	emb|BX071376.1|CNS09R8K Single read from an extremity of a full-...	40	7.3
81	emb|BX071012.1|CNS09QYG Single read from an extremity of a full-...	40	7.3
82	emb|BX071011.1|CNS09QYF Single read from an extremity of a full-...	40	7.3
83	emb|BX070723.1|CNS09QQF Single read from an extremity of a full-...	40	7.3
84	emb|BX070722.1|CNS09QQE Single read from an extremity of a full-...	40	7.3
85	emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-...	40	7.3
86	emb|BX069681.1|CNS09PXH Single read from an extremity of a full-...	40	7.3
87	emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-...	40	7.3
88	emb|BX060948.1|CNS09J6W Single read from an extremity of a full-...	40	7.3
89	emb|BX060936.1|CNS09J6K Single read from an extremity of a full-...	40	7.3
90	emb|BX060935.1|CNS09J6J Single read from an extremity of a full-...	40	7.3
91	emb|BX069234.1|CNS09PL2 Single read from an extremity of a full-...	40	7.3
92	emb|BX068985.1|CNS09PE5 Single read from an extremity of a full-...	40	7.3
93	emb|BX068984.1|CNS09PE4 Single read from an extremity of a full-...	40	7.3
94	emb|BX068769.1|CNS09P85 Single read from an extremity of a full-...	40	7.3
95	emb|BX068768.1|CNS09P84 Single read from an extremity of a full-...	40	7.3
96	emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-...	40	7.3
97	emb|BX067647.1|CNS09OCZ Single read from an extremity of a full-...	40	7.3
98	emb|BX067520.1|CNS09O9G Single read from an extremity of a full-...	40	7.3
99	emb|BX067519.1|CNS09O9F Single read from an extremity of a full-...	40	7.3
100	emb|BX067280.1|CNS09O2S Single read from an extremity of a full-...	40	7.3
101	emb|BX067279.1|CNS09O2R Single read from an extremity of a full-...	40	7.3
102	emb|BX067196.1|CNS09O0G Single read from an extremity of a full-...	40	7.3
103	emb|BX066817.1|CNS09NPX Single read from an extremity of a full-...	40	7.3
104	emb|BX066816.1|CNS09NPW Single read from an extremity of a full-...	40	7.3
105	emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-...	40	7.3
106	emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-...	40	7.3
107	emb|BX066544.1|CNS09NIC Single read from an extremity of a full-...	40	7.3
108	emb|BX066543.1|CNS09NIB Single read from an extremity of a full-...	40	7.3
109	emb|BX066504.1|CNS09NH8 Single read from an extremity of a full-...	40	7.3
110	emb|BX066033.1|CNS09N45 Single read from an extremity of a full-...	40	7.3
111	emb|BX066032.1|CNS09N44 Single read from an extremity of a full-...	40	7.3
112	emb|BX065783.1|CNS09MX7 Single read from an extremity of a full-...	40	7.3
113	emb|BX065536.1|CNS09MQC Single read from an extremity of a full-...	40	7.3
114	emb|BX065162.1|CNS09MFY Single read from an extremity of a full-...	40	7.3
115	emb|BX065161.1|CNS09MFX Single read from an extremity of a full-...	40	7.3
116	emb|BX064927.1|CNS09M9F Single read from an extremity of a full-...	40	7.3
117	emb|BX064864.1|CNS09M7O Single read from an extremity of a full-...	40	7.3
118	emb|BX064863.1|CNS09M7N Single read from an extremity of a full-...	40	7.3
119	emb|BX064747.1|CNS09M4F Single read from an extremity of a full-...	40	7.3
120	emb|BX064324.1|CNS09LSO Single read from an extremity of a full-...	40	7.3
121	emb|BX064323.1|CNS09LSN Single read from an extremity of a full-...	40	7.3
122	emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-...	40	7.3
123	emb|BX063827.1|CNS09LEV Single read from an extremity of a full-...	40	7.3
124	emb|BX063826.1|CNS09LEU Single read from an extremity of a full-...	40	7.3
125	emb|BX063741.1|CNS09LCH Single read from an extremity of a full-...	40	7.3
126	emb|BX063740.1|CNS09LCG Single read from an extremity of a full-...	40	7.3
127	emb|BX063296.1|CNS09L04 Single read from an extremity of a full-...	40	7.3
128	emb|BX063295.1|CNS09L03 Single read from an extremity of a full-...	40	7.3
129	emb|BX063245.1|CNS09KYP Single read from an extremity of a full-...	40	7.3
130	emb|BX063244.1|CNS09KYO Single read from an extremity of a full-...	40	7.3
131	emb|BX063171.1|CNS09KWN Single read from an extremity of a full-...	40	7.3
132	emb|BX063170.1|CNS09KWM Single read from an extremity of a full-...	40	7.3
133	emb|BX062638.1|CNS09KHU Single read from an extremity of a full-...	40	7.3
134	emb|BX062637.1|CNS09KHT Single read from an extremity of a full-...	40	7.3
135	emb|BX062521.1|CNS09KEL Single read from an extremity of a full-...	40	7.3
136	emb|BX062520.1|CNS09KEK Single read from an extremity of a full-...	40	7.3
137	emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-...	40	7.3
138	emb|BX062317.1|CNS09K8X Single read from an extremity of a full-...	40	7.3
139	emb|BX062059.1|CNS09K1R Single read from an extremity of a full-...	40	7.3
140	emb|BX062058.1|CNS09K1Q Single read from an extremity of a full-...	40	7.3
141	emb|BX062038.1|CNS09K16 Single read from an extremity of a full-...	40	7.3
142	emb|BX062037.1|CNS09K15 Single read from an extremity of a full-...	40	7.3
143	emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-...	40	7.3
144	emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-...	40	7.3
145	emb|BX061503.1|CNS09JMB Single read from an extremity of a full-...	40	7.3
146	emb|BX061502.1|CNS09JMA Single read from an extremity of a full-...	40	7.3
147	emb|BX061238.1|CNS09JEY Single read from an extremity of a full-...	40	7.3
148	emb|BX061237.1|CNS09JEX Single read from an extremity of a full-...	40	7.3
149	emb|BX061207.1|CNS09JE3 Single read from an extremity of a full-...	40	7.3
150	emb|BX061125.1|CNS09JBT Single read from an extremity of a full-...	40	7.3
151	emb|BX060724.1|CNS09J0O Single read from an extremity of a full-...	40	7.3
152	emb|BX060723.1|CNS09J0N Single read from an extremity of a full-...	40	7.3
153	emb|BX060569.1|CNS09IWD Single read from an extremity of a full-...	40	7.3
154	emb|BX059883.1|CNS09IDB Single read from an extremity of a full-...	40	7.3
155	emb|BX059882.1|CNS09IDA Single read from an extremity of a full-...	40	7.3
156	emb|BX059853.1|CNS09ICH Single read from an extremity of a full-...	40	7.3
157	emb|BX059852.1|CNS09ICG Single read from an extremity of a full-...	40	7.3
158	emb|BX059824.1|CNS09IBO Single read from an extremity of a full-...	40	7.3
159	emb|BX059823.1|CNS09IBN Single read from an extremity of a full-...	40	7.3
160	emb|BX059792.1|CNS09IAS Single read from an extremity of a full-...	40	7.3
161	emb|BX059791.1|CNS09IAR Single read from an extremity of a full-...	40	7.3
162	emb|BX059612.1|CNS09I5S Single read from an extremity of a full-...	40	7.3
163	emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-...	40	7.3
164	emb|BX059266.1|CNS09HW6 Single read from an extremity of a full-...	40	7.3
165	emb|BX059235.1|CNS09HVB Single read from an extremity of a full-...	40	7.3
166	emb|BX059234.1|CNS09HVA Single read from an extremity of a full-...	40	7.3
167	emb|BX059042.1|CNS09HPY Single read from an extremity of a full-...	40	7.3
168	emb|BX058790.1|CNS09HIY Single read from an extremity of a full-...	40	7.3
169	emb|BX058355.1|CNS09H6V Single read from an extremity of a full-...	40	7.3
170	emb|BX056726.1|CNS09FXM Single read from an extremity of a full-...	40	7.3
171	emb|BX056725.1|CNS09FXL Single read from an extremity of a full-...	40	7.3
172	emb|BX057699.1|CNS09GON Single read from an extremity of a full-...	40	7.3
173	emb|BX057210.1|CNS09GB2 Single read from an extremity of a full-...	40	7.3
174	emb|BX057196.1|CNS09GAO Single read from an extremity of a full-...	40	7.3
175	emb|BX057158.1|CNS09G9M Single read from an extremity of a full-...	40	7.3
176	emb|BX057093.1|CNS09G7T Single read from an extremity of a full-...	40	7.3
177	emb|BX057044.1|CNS09G6G Single read from an extremity of a full-...	40	7.3
178	emb|BX056961.1|CNS09G45 Single read from an extremity of a full-...	40	7.3
179	emb|BX056409.1|CNS09FOT Single read from an extremity of a full-...	40	7.3
180	emb|BX055358.1|CNS09EVM Single read from an extremity of a full-...	40	7.3
181	emb|BX055357.1|CNS09EVL Single read from an extremity of a full-...	40	7.3
182	emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-...	40	7.3
183	emb|BX055194.1|CNS09ER2 Single read from an extremity of a full-...	40	7.3
184	emb|BX055189.1|CNS09EQX Single read from an extremity of a full-...	40	7.3
185	emb|BX055188.1|CNS09EQW Single read from an extremity of a full-...	40	7.3
186	emb|BX054843.1|CNS09EHB Single read from an extremity of a full-...	40	7.3
187	emb|BX054842.1|CNS09EHA Single read from an extremity of a full-...	40	7.3
188	emb|BX054817.1|CNS09EGL Single read from an extremity of a full-...	40	7.3
189	emb|BX054816.1|CNS09EGK Single read from an extremity of a full-...	40	7.3
190	emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-...	40	7.3
191	emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-...	40	7.3
192	emb|BX053073.1|CNS09D45 Single read from an extremity of a full-...	40	7.3
193	emb|BX053072.1|CNS09D44 Single read from an extremity of a full-...	40	7.3
194	emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-...	40	7.3
195	emb|BX054430.1|CNS09E5U Single read from an extremity of a full-...	40	7.3
196	emb|BX054417.1|CNS09E5H Single read from an extremity of a full-...	40	7.3
197	emb|BX054379.1|CNS09E4F Single read from an extremity of a full-...	40	7.3
198	emb|BX054108.1|CNS09DWW Single read from an extremity of a full-...	40	7.3
199	emb|BX054107.1|CNS09DWV Single read from an extremity of a full-...	40	7.3
200	emb|BX053844.1|CNS09DPK Single read from an extremity of a full-...	40	7.3
201	emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-...	40	7.3
202	emb|BX053757.1|CNS09DN5 Single read from an extremity of a full-...	40	7.3
203	emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-...	40	7.3
204	emb|BX053554.1|CNS09DHI Single read from an extremity of a full-...	40	7.3
205	emb|BX052869.1|CNS09CYH Single read from an extremity of a full-...	40	7.3
206	emb|BX052868.1|CNS09CYG Single read from an extremity of a full-...	40	7.3
207	emb|BX052583.1|CNS09CQJ Single read from an extremity of a full-...	40	7.3
208	emb|BX052582.1|CNS09CQI Single read from an extremity of a full-...	40	7.3
209	emb|BX052554.1|CNS09CPQ Single read from an extremity of a full-...	40	7.3
210	emb|BX052553.1|CNS09CPP Single read from an extremity of a full-...	40	7.3
211	emb|BX052540.1|CNS09CPC Single read from an extremity of a full-...	40	7.3
212	emb|BX052539.1|CNS09CPB Single read from an extremity of a full-...	40	7.3
213	emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-...	40	7.3
214	emb|BX052272.1|CNS09CHW Single read from an extremity of a full-...	40	7.3
215	emb|BX052271.1|CNS09CHV Single read from an extremity of a full-...	40	7.3
216	emb|BX052222.1|CNS09CGI Single read from an extremity of a full-...	40	7.3
217	emb|BX052221.1|CNS09CGH Single read from an extremity of a full-...	40	7.3
218	emb|BX051688.1|CNS09C1O Single read from an extremity of a full-...	40	7.3
219	emb|BX051644.1|CNS09C0G Single read from an extremity of a full-...	40	7.3
220	emb|BX051423.1|CNS09BUB Single read from an extremity of a full-...	40	7.3
221	emb|BX051422.1|CNS09BUA Single read from an extremity of a full-...	40	7.3
222	emb|BX051408.1|CNS09BTW Single read from an extremity of a full-...	40	7.3
223	emb|BX051372.1|CNS09BSW Single read from an extremity of a full-...	40	7.3
224	emb|BX051371.1|CNS09BSV Single read from an extremity of a full-...	40	7.3
225	emb|BX050253.1|CNS09AXT Single read from an extremity of a full-...	40	7.3
226	emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-...	40	7.3
227	emb|BX050089.1|CNS09AT9 Single read from an extremity of a full-...	40	7.3
228	emb|BX050810.1|CNS09BDA Single read from an extremity of a full-...	40	7.3
229	emb|BX050809.1|CNS09BD9 Single read from an extremity of a full-...	40	7.3
230	emb|BX050569.1|CNS09B6L Single read from an extremity of a full-...	40	7.3
231	emb|BX031018.1|CNS08W3I Single read from an extremity of a full-...	40	7.3
232	emb|BX049265.1|CNS09A6D Single read from an extremity of a full-...	40	7.3
233	emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-...	40	7.3
234	emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-...	40	7.3
235	emb|BX046433.1|CNS097ZP Single read from an extremity of a full-...	40	7.3
236	emb|BX046386.1|CNS097YE Single read from an extremity of a full-...	40	7.3
237	emb|BX046385.1|CNS097YD Single read from an extremity of a full-...	40	7.3
238	emb|BX048281.1|CNS099F1 Single read from an extremity of a full-...	40	7.3
239	emb|BX048280.1|CNS099F0 Single read from an extremity of a full-...	40	7.3
240	emb|BX048092.1|CNS0999S Single read from an extremity of a full-...	40	7.3
241	emb|BX047771.1|CNS0990V Single read from an extremity of a full-...	40	7.3
242	emb|BX047770.1|CNS0990U Single read from an extremity of a full-...	40	7.3
243	emb|BX047425.1|CNS098R9 Single read from an extremity of a full-...	40	7.3
244	emb|BX047424.1|CNS098R8 Single read from an extremity of a full-...	40	7.3
245	emb|BX047421.1|CNS098R5 Single read from an extremity of a full-...	40	7.3
246	emb|BX047145.1|CNS098JH Single read from an extremity of a full-...	40	7.3
247	emb|BX047144.1|CNS098JG Single read from an extremity of a full-...	40	7.3
248	emb|BX045784.1|CNS097HO Single read from an extremity of a full-...	40	7.3
249	emb|BX045783.1|CNS097HN Single read from an extremity of a full-...	40	7.3
250	emb|BX045690.1|CNS097F2 Single read from an extremity of a full-...	40	7.3
251	emb|BX045582.1|CNS097C2 Single read from an extremity of a full-...	40	7.3
252	emb|BX045428.1|CNS0977S Single read from an extremity of a full-...	40	7.3
253	emb|BX045427.1|CNS0977R Single read from an extremity of a full-...	40	7.3
254	emb|BX045137.1|CNS096ZP Single read from an extremity of a full-...	40	7.3
255	emb|BX045136.1|CNS096ZO Single read from an extremity of a full-...	40	7.3
256	emb|BX044981.1|CNS096VD Single read from an extremity of a full-...	40	7.3
257	emb|BX044980.1|CNS096VC Single read from an extremity of a full-...	40	7.3
258	emb|BX044908.1|CNS096TC Single read from an extremity of a full-...	40	7.3
259	emb|BX044907.1|CNS096TB Single read from an extremity of a full-...	40	7.3
260	emb|BX044546.1|CNS096JA Single read from an extremity of a full-...	40	7.3
261	emb|BX044545.1|CNS096J9 Single read from an extremity of a full-...	40	7.3
262	emb|BX043973.1|CNS0963D Single read from an extremity of a full-...	40	7.3
263	emb|BX043909.1|CNS0961L Single read from an extremity of a full-...	40	7.3
264	emb|BX043850.1|CNS095ZY Single read from an extremity of a full-...	40	7.3
265	emb|BX043849.1|CNS095ZX Single read from an extremity of a full-...	40	7.3
266	emb|BX043551.1|CNS095RN Single read from an extremity of a full-...	40	7.3
267	emb|BX042541.1|CNS094ZL Single read from an extremity of a full-...	40	7.3
268	emb|BX042527.1|CNS094Z7 Single read from an extremity of a full-...	40	7.3
269	emb|BX042526.1|CNS094Z6 Single read from an extremity of a full-...	40	7.3
270	emb|BX042393.1|CNS094VH Single read from an extremity of a full-...	40	7.3
271	emb|BX042392.1|CNS094VG Single read from an extremity of a full-...	40	7.3
272	emb|BX042234.1|CNS094R2 Single read from an extremity of a full-...	40	7.3
273	emb|BX042233.1|CNS094R1 Single read from an extremity of a full-...	40	7.3
274	emb|BX041744.1|CNS094DG Single read from an extremity of a full-...	40	7.3
275	emb|BX041743.1|CNS094DF Single read from an extremity of a full-...	40	7.3
276	emb|BX042002.1|CNS094KM Single read from an extremity of a full-...	40	7.3
277	emb|BX042001.1|CNS094KL Single read from an extremity of a full-...	40	7.3
278	emb|BX041959.1|CNS094JF Single read from an extremity of a full-...	40	7.3
279	emb|BX041958.1|CNS094JE Single read from an extremity of a full-...	40	7.3
280	emb|BX041268.1|CNS09408 Single read from an extremity of a full-...	40	7.3
281	emb|BX041267.1|CNS09407 Single read from an extremity of a full-...	40	7.3
282	emb|BX041134.1|CNS093WI Single read from an extremity of a full-...	40	7.3
283	emb|BX041133.1|CNS093WH Single read from an extremity of a full-...	40	7.3
284	emb|BX041099.1|CNS093VJ Single read from an extremity of a full-...	40	7.3
285	emb|BX041072.1|CNS093US Single read from an extremity of a full-...	40	7.3
286	emb|BX041071.1|CNS093UR Single read from an extremity of a full-...	40	7.3
287	emb|BX040846.1|CNS093OI Single read from an extremity of a full-...	40	7.3
288	emb|BX040845.1|CNS093OH Single read from an extremity of a full-...	40	7.3
289	emb|BX040802.1|CNS093NA Single read from an extremity of a full-...	40	7.3
290	emb|BX040801.1|CNS093N9 Single read from an extremity of a full-...	40	7.3
291	emb|BX040787.1|CNS093MV Single read from an extremity of a full-...	40	7.3
292	emb|BX040786.1|CNS093MU Single read from an extremity of a full-...	40	7.3
293	emb|BX039654.1|CNS092RE Single read from an extremity of a full-...	40	7.3
294	emb|BX039653.1|CNS092RD Single read from an extremity of a full-...	40	7.3
295	emb|BX039398.1|CNS092KA Single read from an extremity of a full-...	40	7.3
296	emb|BX039397.1|CNS092K9 Single read from an extremity of a full-...	40	7.3
297	emb|BX039233.1|CNS092FP Single read from an extremity of a full-...	40	7.3
298	emb|BX039232.1|CNS092FO Single read from an extremity of a full-...	40	7.3
299	emb|BX037342.1|CNS090Z6 Single read from an extremity of a full-...	40	7.3
300	emb|BX037341.1|CNS090Z5 Single read from an extremity of a full-...	40	7.3
301	emb|BX036731.1|CNS090I7 Single read from an extremity of a full-...	40	7.3
302	emb|BX036730.1|CNS090I6 Single read from an extremity of a full-...	40	7.3
303	emb|BX036687.1|CNS090GZ Single read from an extremity of a full-...	40	7.3
304	emb|BX036655.1|CNS090G3 Single read from an extremity of a full-...	40	7.3
305	emb|BX036654.1|CNS090G2 Single read from an extremity of a full-...	40	7.3
306	emb|BX037079.1|CNS090RV Single read from an extremity of a full-...	40	7.3
307	emb|BX036920.1|CNS090NG Single read from an extremity of a full-...	40	7.3
308	emb|BX036919.1|CNS090NF Single read from an extremity of a full-...	40	7.3
309	emb|BX036823.1|CNS090KR Single read from an extremity of a full-...	40	7.3
310	emb|BX036225.1|CNS09045 Single read from an extremity of a full-...	40	7.3
311	emb|BX036224.1|CNS09044 Single read from an extremity of a full-...	40	7.3
312	emb|BX036193.1|CNS09039 Single read from an extremity of a full-...	40	7.3
313	emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-...	40	7.3
314	emb|BX035977.1|CNS08ZX9 Single read from an extremity of a full-...	40	7.3
315	emb|BX035586.1|CNS08ZME Single read from an extremity of a full-...	40	7.3
316	emb|BX035585.1|CNS08ZMD Single read from an extremity of a full-...	40	7.3
317	emb|BX035383.1|CNS08ZGR Single read from an extremity of a full-...	40	7.3
318	emb|BX034653.1|CNS08YWH Single read from an extremity of a full-...	40	7.3
319	emb|BX034652.1|CNS08YWG Single read from an extremity of a full-...	40	7.3
320	emb|BX034453.1|CNS08YQX Single read from an extremity of a full-...	40	7.3
321	emb|BX034452.1|CNS08YQW Single read from an extremity of a full-...	40	7.3
322	emb|BX034377.1|CNS08YOT Single read from an extremity of a full-...	40	7.3
323	emb|BX034376.1|CNS08YOS Single read from an extremity of a full-...	40	7.3
324	emb|BX034140.1|CNS08YI8 Single read from an extremity of a full-...	40	7.3
325	emb|BX033967.1|CNS08YDF Single read from an extremity of a full-...	40	7.3
326	emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-...	40	7.3
327	emb|BX033760.1|CNS08Y7O Single read from an extremity of a full-...	40	7.3
328	emb|BX033507.1|CNS08Y0N Single read from an extremity of a full-...	40	7.3
329	emb|BX033506.1|CNS08Y0M Single read from an extremity of a full-...	40	7.3
330	emb|BX033244.1|CNS08XTC Single read from an extremity of a full-...	40	7.3
331	emb|BX033243.1|CNS08XTB Single read from an extremity of a full-...	40	7.3
332	emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-...	40	7.3
333	emb|BX033233.1|CNS08XT1 Single read from an extremity of a full-...	40	7.3
334	emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-...	40	7.3
335	emb|BX033106.1|CNS08XPI Single read from an extremity of a full-...	40	7.3
336	emb|BX032954.1|CNS08XLA Single read from an extremity of a full-...	40	7.3
337	emb|BX032953.1|CNS08XL9 Single read from an extremity of a full-...	40	7.3
338	emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-...	40	7.3
339	emb|BX032911.1|CNS08XK3 Single read from an extremity of a full-...	40	7.3
340	emb|BX032790.1|CNS08XGQ Single read from an extremity of a full-...	40	7.3
341	emb|BX032728.1|CNS08XF0 Single read from an extremity of a full-...	40	7.3
342	emb|BX032620.1|CNS08XC0 Single read from an extremity of a full-...	40	7.3
343	emb|BX032619.1|CNS08XBZ Single read from an extremity of a full-...	40	7.3
344	emb|BX032445.1|CNS08X75 Single read from an extremity of a full-...	40	7.3
345	emb|BX032411.1|CNS08X67 Single read from an extremity of a full-...	40	7.3
346	emb|BX032378.1|CNS08X5A Single read from an extremity of a full-...	40	7.3
347	emb|BX031936.1|CNS08WT0 Single read from an extremity of a full-...	40	7.3
348	emb|BX031925.1|CNS08WSP Single read from an extremity of a full-...	40	7.3
349	emb|BX031924.1|CNS08WSO Single read from an extremity of a full-...	40	7.3
350	emb|BX031877.1|CNS08WRD Single read from an extremity of a full-...	40	7.3
351	emb|BX031876.1|CNS08WRC Single read from an extremity of a full-...	40	7.3
352	emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-...	40	7.3
353	emb|BX031827.1|CNS08WPZ Single read from an extremity of a full-...	40	7.3
354	emb|BX031537.1|CNS08WHX Single read from an extremity of a full-...	40	7.3
355	emb|BX031536.1|CNS08WHW Single read from an extremity of a full-...	40	7.3
356	emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-...	40	7.3
357	emb|BX030748.1|CNS08VW0 Single read from an extremity of a full-...	40	7.3
358	emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-...	40	7.3
359	emb|BX031288.1|CNS08WB0 Single read from an extremity of a full-...	40	7.3
360	emb|BX031287.1|CNS08WAZ Single read from an extremity of a full-...	40	7.3
361	emb|BX031286.1|CNS08WAY Single read from an extremity of a full-...	40	7.3
362	emb|BX031263.1|CNS08WAB Single read from an extremity of a full-...	40	7.3
363	emb|BX031262.1|CNS08WAA Single read from an extremity of a full-...	40	7.3
364	emb|BX031186.1|CNS08W86 Single read from an extremity of a full-...	40	7.3
365	emb|BX031185.1|CNS08W85 Single read from an extremity of a full-...	40	7.3
366	emb|BX030362.1|CNS08VLA Single read from an extremity of a full-...	40	7.3
367	emb|BX030361.1|CNS08VL9 Single read from an extremity of a full-...	40	7.3
368	emb|BX030263.1|CNS08VIJ Single read from an extremity of a full-...	40	7.3
369	emb|BX030262.1|CNS08VII Single read from an extremity of a full-...	40	7.3
370	emb|BX030060.1|CNS08VCW Single read from an extremity of a full-...	40	7.3
371	emb|BX030059.1|CNS08VCV Single read from an extremity of a full-...	40	7.3
372	emb|BX030002.1|CNS08VBA Single read from an extremity of a full-...	40	7.3
373	emb|BX030001.1|CNS08VB9 Single read from an extremity of a full-...	40	7.3
374	emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-...	40	7.3
375	emb|BX029261.1|CNS08UQP Single read from an extremity of a full-...	40	7.3
376	emb|BX029684.1|CNS08V2G Single read from an extremity of a full-...	40	7.3
377	emb|BX029683.1|CNS08V2F Single read from an extremity of a full-...	40	7.3
378	emb|BX029602.1|CNS08V06 Single read from an extremity of a full-...	40	7.3
379	emb|BX029601.1|CNS08V05 Single read from an extremity of a full-...	40	7.3
380	emb|BX028637.1|CNS08U9D Single read from an extremity of a full-...	40	7.3
381	emb|BX028636.1|CNS08U9C Single read from an extremity of a full-...	40	7.3
382	emb|BX028526.1|CNS08U6A Single read from an extremity of a full-...	40	7.3
383	emb|BX028525.1|CNS08U69 Single read from an extremity of a full-...	40	7.3
384	emb|BX022357.1|CNS08PEX Single read from an extremity of a full-...	40	7.3
385	emb|BX022356.1|CNS08PEW Single read from an extremity of a full-...	40	7.3
386	emb|BX022256.1|CNS08PC4 Single read from an extremity of a full-...	40	7.3
387	emb|BX026844.1|CNS08SVK Single read from an extremity of a full-...	40	7.3
388	emb|BX026843.1|CNS08SVJ Single read from an extremity of a full-...	40	7.3
389	emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-...	40	7.3
390	emb|BX026788.1|CNS08SU0 Single read from an extremity of a full-...	40	7.3
391	emb|BX026033.1|CNS08S91 Single read from an extremity of a full-...	40	7.3
392	emb|BX025925.1|CNS08S61 Single read from an extremity of a full-...	40	7.3
393	emb|BX025869.1|CNS08S4H Single read from an extremity of a full-...	40	7.3
394	emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-...	40	7.3
395	emb|BX025697.1|CNS08RZP Single read from an extremity of a full-...	40	7.3
396	emb|BX025388.1|CNS08RR4 Single read from an extremity of a full-...	40	7.3
397	emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-...	40	7.3
398	emb|BX025348.1|CNS08RQ0 Single read from an extremity of a full-...	40	7.3
399	emb|BX025145.1|CNS08RKD Single read from an extremity of a full-...	40	7.3
400	emb|BX025106.1|CNS08RJA Single read from an extremity of a full-...	40	7.3
401	emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-...	40	7.3
402	emb|BX025078.1|CNS08RII Single read from an extremity of a full-...	40	7.3
403	emb|BX025073.1|CNS08RID Single read from an extremity of a full-...	40	7.3
404	emb|BX025072.1|CNS08RIC Single read from an extremity of a full-...	40	7.3
405	emb|BX025038.1|CNS08RHE Single read from an extremity of a full-...	40	7.3
406	emb|BX025037.1|CNS08RHD Single read from an extremity of a full-...	40	7.3
407	emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-...	40	7.3
408	emb|BX025032.1|CNS08RH8 Single read from an extremity of a full-...	40	7.3
409	emb|BX022875.1|CNS08PTB Single read from an extremity of a full-...	40	7.3
410	emb|BX024670.1|CNS08R76 Single read from an extremity of a full-...	40	7.3
411	emb|BX024599.1|CNS08R57 Single read from an extremity of a full-...	40	7.3
412	emb|BX024325.1|CNS08QXL Single read from an extremity of a full-...	40	7.3
413	emb|BX024324.1|CNS08QXK Single read from an extremity of a full-...	40	7.3
414	emb|BX024252.1|CNS08QVK Single read from an extremity of a full-...	40	7.3
415	emb|BX024209.1|CNS08QUD Single read from an extremity of a full-...	40	7.3
416	emb|BX024208.1|CNS08QUC Single read from an extremity of a full-...	40	7.3
417	emb|BX024181.1|CNS08QTL Single read from an extremity of a full-...	40	7.3
418	emb|BX024145.1|CNS08QSL Single read from an extremity of a full-...	40	7.3
419	emb|BX024144.1|CNS08QSK Single read from an extremity of a full-...	40	7.3
420	emb|BX023943.1|CNS08QMZ Single read from an extremity of a full-...	40	7.3
421	emb|BX023815.1|CNS08QJF Single read from an extremity of a full-...	40	7.3
422	emb|BX023814.1|CNS08QJE Single read from an extremity of a full-...	40	7.3
423	emb|BX023165.1|CNS08Q1D Single read from an extremity of a full-...	40	7.3
424	emb|BX022543.1|CNS08PK3 Single read from an extremity of a full-...	40	7.3
425	emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-...	40	7.3
426	emb|BX022222.1|CNS08PB6 Single read from an extremity of a full-...	40	7.3
427	emb|BX022054.1|CNS08P6I Single read from an extremity of a full-...	40	7.3
428	emb|BX019696.1|CNS08ND0 Single read from an extremity of a full-...	40	7.3
429	emb|BX019695.1|CNS08NCZ Single read from an extremity of a full-...	40	7.3
430	emb|BX019694.1|CNS08NCY Single read from an extremity of a full-...	40	7.3
431	emb|BX019693.1|CNS08NCX Single read from an extremity of a full-...	40	7.3
432	emb|BX019660.1|CNS08NC0 Single read from an extremity of a full-...	40	7.3
433	emb|BX021963.1|CNS08P3Z Single read from an extremity of a full-...	40	7.3
434	emb|BX021191.1|CNS08OIJ Single read from an extremity of a full-...	40	7.3
435	emb|BX021190.1|CNS08OII Single read from an extremity of a full-...	40	7.3
436	emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-...	40	7.3
437	emb|BX020633.1|CNS08O31 Single read from an extremity of a full-...	40	7.3
438	emb|BX020480.1|CNS08NYS Single read from an extremity of a full-...	40	7.3
439	emb|BX020350.1|CNS08NV6 Single read from an extremity of a full-...	40	7.3
440	emb|BX020305.1|CNS08NTX Single read from an extremity of a full-...	40	7.3
441	emb|BX020304.1|CNS08NTW Single read from an extremity of a full-...	40	7.3
442	emb|BX020052.1|CNS08NMW Single read from an extremity of a full-...	40	7.3
443	emb|BX019953.1|CNS08NK5 Single read from an extremity of a full-...	40	7.3
444	emb|BX018974.1|CNS08MSY Single read from an extremity of a full-...	40	7.3
445	emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-...	40	7.3
446	emb|BX018002.1|CNS08M1Y Single read from an extremity of a full-...	40	7.3
447	emb|BX017981.1|CNS08M1D Single read from an extremity of a full-...	40	7.3
448	emb|BX017980.1|CNS08M1C Single read from an extremity of a full-...	40	7.3
449	emb|BX018633.1|CNS08MJH Single read from an extremity of a full-...	40	7.3
450	emb|BX018524.1|CNS08MGG Single read from an extremity of a full-...	40	7.3
451	emb|BX018377.1|CNS08MCD Single read from an extremity of a full-...	40	7.3
452	emb|BX018376.1|CNS08MCC Single read from an extremity of a full-...	40	7.3
453	emb|BX017782.1|CNS08LVU Single read from an extremity of a full-...	40	7.3
454	emb|BX017737.1|CNS08LUL Single read from an extremity of a full-...	40	7.3
455	emb|BX017736.1|CNS08LUK Single read from an extremity of a full-...	40	7.3
456	emb|BX017331.1|CNS08LJB Single read from an extremity of a full-...	40	7.3
457	emb|BX017330.1|CNS08LJA Single read from an extremity of a full-...	40	7.3
458	emb|BX016974.1|CNS08L9E Single read from an extremity of a full-...	40	7.3
459	emb|BX016973.1|CNS08L9D Single read from an extremity of a full-...	40	7.3
460	emb|BX016911.1|CNS08L7N Single read from an extremity of a full-...	40	7.3
461	emb|BX016910.1|CNS08L7M Single read from an extremity of a full-...	40	7.3
462	emb|BX016643.1|CNS08L07 Single read from an extremity of a full-...	40	7.3
463	emb|BX016525.1|CNS08KWX Single read from an extremity of a full-...	40	7.3
464	emb|BX016524.1|CNS08KWW Single read from an extremity of a full-...	40	7.3
465	emb|BX016411.1|CNS08KTR Single read from an extremity of a full-...	40	7.3
466	emb|BX016410.1|CNS08KTQ Single read from an extremity of a full-...	40	7.3
467	emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-...	40	7.3
468	emb|BX015957.1|CNS08KH5 Single read from an extremity of a full-...	40	7.3
469	emb|BX015024.1|CNS08JR8 Single read from an extremity of a full-...	40	7.3
470	emb|BX015022.1|CNS08JR6 Single read from an extremity of a full-...	40	7.3
471	emb|BX015021.1|CNS08JR5 Single read from an extremity of a full-...	40	7.3
472	emb|BX014943.1|CNS08JOZ Single read from an extremity of a full-...	40	7.3
473	emb|BX014218.1|CNS08J4U Single read from an extremity of a full-...	40	7.3
474	emb|BX014116.1|CNS08J20 Single read from an extremity of a full-...	40	7.3
475	emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-...	40	7.3
476	emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-...	40	7.3
477	emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-...	40	7.3
478	emb|BX013493.1|CNS08IKP Single read from an extremity of a full-...	40	7.3
479	emb|BX013460.1|CNS08IJS Single read from an extremity of a full-...	40	7.3
480	emb|BX013459.1|CNS08IJR Single read from an extremity of a full-...	40	7.3
481	emb|BX013448.1|CNS08IJG Single read from an extremity of a full-...	40	7.3
482	emb|BX013447.1|CNS08IJF Single read from an extremity of a full-...	40	7.3
483	emb|BX012831.1|CNS08I2B Single read from an extremity of a full-...	40	7.3
484	emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-...	40	7.3
485	emb|BX012260.1|CNS08HMG Single read from an extremity of a full-...	40	7.3
486	emb|BX012259.1|CNS08HMF Single read from an extremity of a full-...	40	7.3
487	emb|BX012237.1|CNS08HLT Single read from an extremity of a full-...	40	7.3
488	emb|BX012236.1|CNS08HLS Single read from an extremity of a full-...	40	7.3
489	emb|BX012210.1|CNS08HL2 Single read from an extremity of a full-...	40	7.3
490	emb|BX012209.1|CNS08HL1 Single read from an extremity of a full-...	40	7.3
491	emb|BX010378.1|CNS08G66 Single read from an extremity of a full-...	40	7.3
492	emb|BX010377.1|CNS08G65 Single read from an extremity of a full-...	40	7.3
493	emb|BX010325.1|CNS08G4P Single read from an extremity of a full-...	40	7.3
494	emb|BX010324.1|CNS08G4O Single read from an extremity of a full-...	40	7.3
495	emb|BX010209.1|CNS08G1H Single read from an extremity of a full-...	40	7.3
496	emb|BX009864.1|CNS08FRW Single read from an extremity of a full-...	40	7.3
497	emb|BX009863.1|CNS08FRV Single read from an extremity of a full-...	40	7.3
498	emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-...	40	7.3
499	emb|BX009833.1|CNS08FR1 Single read from an extremity of a full-...	40	7.3
500	emb|BX009698.1|CNS08FNA Single read from an extremity of a full-...	40	7.3

---

>dbj|AK103409.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128E16, full
           insert sequence
          Length = 1056

 Score =  325 bits (164), Expect = 9e-86
 Identities = 278/316 (87%)
 Strand = Plus / Minus

                                                                       
Query: 227 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
           |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 935 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 876

                                                                       
Query: 287 cggagtaagccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaac 346
           | ||| | || ||||| ||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 875 ccgagaaggcagtgtctttctccttgaacttctcagtcagacccttaactgtgaggcagc 816

                                                                       
Query: 347 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
           | ||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 815 attcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 756

                                                                       
Query: 407 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 755 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 696

                                                                       
Query: 467 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctcaaatatagacc 526
           |||  || | ||||||||||||||||||| ||||||| ||||||||||| || || ||||
Sbjct: 695 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctcgaaaatggacc 636

                           
Query: 527 tccaattctgaagact 542
           ||||||||||||||||
Sbjct: 635 tccaattctgaagact 620

---

>dbj|AK059278.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-C08, full
           insert sequence
          Length = 1104

 Score =  317 bits (160), Expect = 2e-83
 Identities = 277/316 (87%)
 Strand = Plus / Minus

                                                                       
Query: 227 atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
           |||||||||  || ||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 947 atgcaatgagaaaggggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 888

                                                                       
Query: 287 cggagtaagccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaac 346
           | ||| | || ||||| || |||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 887 ccgagaaggctgtgtctttttccttgaacttctcagtcagacccttaactgtgaggcagc 828

                                                                       
Query: 347 actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
           | ||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 827 attcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 768

                                                                       
Query: 407 acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 767 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 708

                                                                       
Query: 467 gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctcaaatatagacc 526
           |||  || | ||||||||||||||||||||||||||| ||||||||||| || || ||||
Sbjct: 707 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctcgaaaatggacc 648

                           
Query: 527 tccaattctgaagact 542
           ||||||||||||||||
Sbjct: 647 tccaattctgaagact 632

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  208 bits (105), Expect = 1e-50
 Identities = 153/169 (90%)
 Strand = Plus / Plus

                                                                           
Query: 347     actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
               ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 1794422 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1794481

                                                                           
Query: 407     acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
               |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1794482 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1794541

                                                                
Query: 467     gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
               |||  || | ||||||||||||||||||||||||||| |||||||||||
Sbjct: 1794542 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 1794590



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                           
Query: 227     atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
               |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 1793614 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1793673

                                                            
Query: 287     cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
               | ||| | || ||||| || |||||||||||||||||||||||||
Sbjct: 1793674 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 1793718

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  208 bits (105), Expect = 1e-50
 Identities = 153/169 (90%)
 Strand = Plus / Plus

                                                                           
Query: 347     actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
               ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 1794400 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1794459

                                                                           
Query: 407     acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
               |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1794460 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1794519

                                                                
Query: 467     gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
               |||  || | ||||||||||||||||||||||||||| |||||||||||
Sbjct: 1794520 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 1794568



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                           
Query: 227     atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
               |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 1793592 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1793651

                                                            
Query: 287     cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
               | ||| | || ||||| || |||||||||||||||||||||||||
Sbjct: 1793652 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 1793696

---

>emb|BX000502.2|CNS08CDS Oryza sativa chromosome 12, . BAC OSJNBb0041E01 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 132026

 Score =  208 bits (105), Expect = 1e-50
 Identities = 153/169 (90%)
 Strand = Plus / Minus

                                                                         
Query: 347   actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
             ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 46060 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 46001

                                                                         
Query: 407   acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
             |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 46000 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 45941

                                                              
Query: 467   gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
             |||  || | ||||||||||||||||||||||||||| |||||||||||
Sbjct: 45940 gcaattctgttgcatcaattttaccacttcggtcacgatcaaacctctc 45892



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 227   atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
             |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 46868 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 46809

                                                          
Query: 287   cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
             | ||| | || ||||| || |||||||||||||||||||||||||
Sbjct: 46808 ccgagaaggctgtgtctttttccttgaacttctcagtcagaccct 46764

---

>gb|AC123527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0068G15, complete sequence
          Length = 146175

 Score =  200 bits (101), Expect = 3e-48
 Identities = 152/169 (89%)
 Strand = Plus / Plus

                                                                         
Query: 347   actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
             ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 80910 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 80969

                                                                         
Query: 407   acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
             |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 80970 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 81029

                                                              
Query: 467   gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
             |||  || | ||||||||||||||||||| ||||||| |||||||||||
Sbjct: 81030 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 81078



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                         
Query: 227   atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
             |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 79938 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 79997

                                                          
Query: 287   cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
             | ||| | || ||||| ||||||||||||||||||||||||||||
Sbjct: 79998 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 80042

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  200 bits (101), Expect = 3e-48
 Identities = 152/169 (89%)
 Strand = Plus / Plus

                                                                           
Query: 347     actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
               ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 1863080 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1863139

                                                                           
Query: 407     acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
               |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1863140 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1863199

                                                                
Query: 467     gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
               |||  || | ||||||||||||||||||| ||||||| |||||||||||
Sbjct: 1863200 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 1863248



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                           
Query: 227     atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
               |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 1862108 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1862167

                                                            
Query: 287     cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
               | ||| | || ||||| ||||||||||||||||||||||||||||
Sbjct: 1862168 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 1862212

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  200 bits (101), Expect = 3e-48
 Identities = 152/169 (89%)
 Strand = Plus / Plus

                                                                           
Query: 347     actcaataaagttatcatattcgactgctttgctcatgcccccagtcttgtcgaatttag 406
               ||||||| |||||||||||||| |  |||||| || |||||||||||||||| || || |
Sbjct: 1860801 actcaatgaagttatcatattcaatggctttgttcttgcccccagtcttgtcaaactttg 1860860

                                                                           
Query: 407     acacgagcaagtctagcacagttggagaaactgaataacccagactgagaagagcatcac 466
               |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1860861 acacaagcaagtctagcacagttggagaaactgaatatcccagactgagaagagcatcac 1860920

                                                                
Query: 467     gcagctccgatgcatcaattttaccacttcggtcacggtcaaacctctc 515
               |||  || | ||||||||||||||||||| ||||||| |||||||||||
Sbjct: 1860921 gcaattctgttgcatcaattttaccactttggtcacgatcaaacctctc 1860969



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                           
Query: 227     atgcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacc 286
               |||||||||  |||||||| ||||||| |||||| ||||||||| | ||||| ||||| |
Sbjct: 1859829 atgcaatgagaaaagggagtacagtcagcatgaaagcctcgtaagtaaaagtcgcagagc 1859888

                                                            
Query: 287     cggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
               | ||| | || ||||| ||||||||||||||||||||||||||||
Sbjct: 1859889 ccgagaaggcagtgtctttctccttgaacttctcagtcagaccct 1859933

---

>gb|AY106160.1| Zea mays PCO089266 mRNA sequence
          Length = 571

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                       
Query: 229 gcaatgatgaaagggagcacagtcaacatgaatgcctcgtaactgaaagttgcagacccg 288
           ||||||| |||||| ||||| |||| |||||| ||||||||  ||||||| || ||||| 
Sbjct: 358 gcaatgaggaaaggcagcacggtcagcatgaaggcctcgtaggtgaaagtcgccgaccca 299

                                                      
Query: 289 gagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
           ||||| || ||||| ||||||||||||||||| ||||| ||||
Sbjct: 298 gagtaggctgtgtcattctccttgaacttctctgtcagcccct 256

---

>gb|BT014117.1| Lycopersicon esculentum clone 133222R, mRNA sequence
          Length = 1324

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 301 tccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagtta 360
           ||||||||||||||||||||||| || || || || || ||||| |||||||| ||||||
Sbjct: 991 tccttctccttgaacttctcagttagccctttaacggtgaggcagcactcaatgaagtta 932

                   
Query: 361 tcatattc 368
           ||||||||
Sbjct: 931 tcatattc 924

---

>ref|NM_120499.4| Arabidopsis thaliana calcium ion binding AT5G04170 mRNA, complete cds
          Length = 1475

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1166 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1107

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1106 taacagtgagacagcactcaatgaaattgtcatattcga 1068



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 929 acctctcaaaaatggacctccagttctgaagact 896

---

>gb|BT008838.1| Arabidopsis thaliana At5g04170 mRNA, complete cds
          Length = 1065

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1018 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 959

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 958  taacagtgagacagcactcaatgaaattgtcatattcga 920



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 781 acctctcaaaaatggacctccagttctgaagact 748

---

>gb|AY081342.1| Arabidopsis thaliana EF-hand calcium binding protein-like (At5g04170)
            mRNA, complete cds
          Length = 1325

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1044 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 985

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 984  taacagtgagacagcactcaatgaaattgtcatattcga 946



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 807 acctctcaaaaatggacctccagttctgaagact 774

---

>emb|BX831460.1|CNS0A1WC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS93ZB02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1320

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1099 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1040

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1039 taacagtgagacagcactcaatgaaattgtcatattcga 1001



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 862 acctctcaaaaatggacctccagttctgaagact 829

---

>emb|BX831038.1|CNS0A1WE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS51ZG02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1306

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1098 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1039

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1038 taacagtgagacagcactcaatgaaattgtcatattcga 1000



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 861 acctctcaaaaatggacctccagttctgaagact 828

---

>emb|BX830610.1|CNS0A1Z3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB94ZA02 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1278

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1075 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1016

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1015 taacagtgagacagcactcaatgaaattgtcatattcga 977



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 838 acctctcaaaaatggacctccagttctgaagact 805

---

>emb|BX830373.1|CNS0A1YJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB76ZE09 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1296

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1107 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 1048

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1047 taacagtgagacagcactcaatgaaattgtcatattcga 1009



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 870 acctctcaaaaatggacctccagttctgaagact 837

---

>ref|NM_111865.4| Arabidopsis thaliana calcium ion binding AT3G10300 transcript
           variant AT3G10300.3 mRNA, complete cds
          Length = 1258

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagact 806



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                        
Query: 295  gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 354
            ||||| |||||||||||||||||||| || || ||||| || || |  |||||||| || 
Sbjct: 1053 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 994

                            
Query: 355  aagttatcatattcga 370
            || || ||||||||||
Sbjct: 993  aaattgtcatattcga 978

---

>ref|NM_180667.2| Arabidopsis thaliana calcium ion binding AT3G10300 transcript
           variant AT3G10300.2 mRNA, complete cds
          Length = 1471

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagact 806



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 295  gccgtgtccttctccttgaacttctc 320
            ||||| ||||||||||||||||||||
Sbjct: 1266 gccgtatccttctccttgaacttctc 1241

---

>ref|NM_001035591.1| Arabidopsis thaliana calcium ion binding AT3G10300 transcript
           variant AT3G10300.4 mRNA, complete cds
          Length = 1272

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 843 tcaaacctctcaaagatagacctccaattctgaagact 806



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 295  gccgtgtccttctccttgaacttctc 320
            ||||| ||||||||||||||||||||
Sbjct: 1046 gccgtatccttctccttgaacttctc 1021

---

>gb|BT015172.1| Arabidopsis thaliana At3g10300 gene, complete cds
          Length = 1008

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 728 tcaaacctctcaaagatagacctccaattctgaagact 691



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 295 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 354
           ||||| |||||||||||||||||||| || || ||||| || || |  |||||||| || 
Sbjct: 938 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 879

                           
Query: 355 aagttatcatattcga 370
           || || ||||||||||
Sbjct: 878 aaattgtcatattcga 863

---

>gb|AY062498.1| Arabidopsis thaliana Unknown protein (At3g10300; F14P13.10) mRNA,
           complete cds
          Length = 1196

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 786 tcaaacctctcaaagatagacctccaattctgaagact 749



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 295 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 354
           ||||| |||||||||||||||||||| || || ||||| || || |  |||||||| || 
Sbjct: 996 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 937

                           
Query: 355 aagttatcatattcga 370
           || || ||||||||||
Sbjct: 936 aaattgtcatattcga 921

---

>emb|BX823832.1|CNS0A7KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS80ZD12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 654

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 505 tcaaacctctcaaatatagacctccaattctgaagact 542
           |||||||||||||| |||||||||||||||||||||||
Sbjct: 241 tcaaacctctcaaagatagacctccaattctgaagact 204



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 295 gccgtgtccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaata 354
           ||||| |||||||||||||||||||| || || ||||| || || |  |||||||| || 
Sbjct: 451 gccgtatccttctccttgaacttctcggtgagcccctttacagtcaaacaacactcgatg 392

                           
Query: 355 aagttatcatattcga 370
           || || ||||||||||
Sbjct: 391 aaattgtcatattcga 376

---

>gb|DQ226650.1| Boechera divaricarpa isolate SLW-5-G06 mRNA sequence
          Length = 1323

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 255 catgaatgcctcgtaactgaaagttgcagacccggagtaagccgtgtccttctccttgaa 314
           |||||| | ||||||| ||||||| || ||||| ||   |||||| || |||||||||||
Sbjct: 801 catgaacgtctcgtaattgaaagtagctgaccctgatagagccgtatctttctccttgaa 860

                                                                   
Query: 315 cttctcagtcagacccttgactgtaaggcaacactcaataaagttatcatattcga 370
           |||||||||||| ||||| || || | ||| ||||| || || || ||||||||||
Sbjct: 861 cttctcagtcagcccctttacagtcaagcagcactcgatgaaattgtcatattcga 916



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                  
Query: 505  tcaaacctctcaaatatagacctccaattctgaagact 542
            |||||||||||||| || ||||||||||||||||||||
Sbjct: 1051 tcaaacctctcaaagatggacctccaattctgaagact 1088

---

>emb|BX830151.1|CNS0A1YG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB62ZG12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1299

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                        
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
            ||||||| || || || ||||| || ||||||||||||||||||||||| || || ||||
Sbjct: 1104 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtgagcccct 1045

                                                   
Query: 332  tgactgtaaggcaacactcaataaagttatcatattcga 370
            | || || || || |||||||| || || ||||||||||
Sbjct: 1044 taacagtgagacagcactcaatgaaattgtcatattcga 1006



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 867 acctctcaaaaatggacctccagttctgaagact 834

---

>emb|AL391716.1|ATF21E1 Arabidopsis thaliana DNA chromosome 5, BAC clone F21E1 (ESSA project)
          Length = 97451

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 272   tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcagaccct 331
             ||||||| || || || ||||| || ||||||||||||||||||||||| ||||| ||||
Sbjct: 51019 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcagcccct 50960

---

>emb|BX831366.1|CNS0A273 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS82ZD05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1326

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctcagtcag 326
            ||||||| || || || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 1106 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctctgtcag 1052



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 871 acctctcaaaaatggacctccagttctgaagact 838

---

>emb|BX831737.1|CNS0A1X3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH27ZA04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1263

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                        
Query: 304  ttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagttatca 363
            ||||||||||||||||| ||||| ||||| || || || || |||||||| || || |||
Sbjct: 1023 ttctccttgaacttctctgtcagccccttaacagtgagacagcactcaatgaaattgtca 964

                   
Query: 364  tattcga 370
            |||||||
Sbjct: 963  tattcga 957



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 817 acctctcaaaaatggacctccagttctgaagact 784

---

>emb|BX831278.1|CNS0A1WK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS74ZD10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1375

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 289  gagtaagccgtgtccttctccttgaacttctcagtcag 326
            ||||| || ||||||||||||||||||||||| |||||
Sbjct: 1090 gagtatgctgtgtccttctccttgaacttctctgtcag 1053

---

>emb|BX830845.1|CNS09ZFX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS30ZB01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1305

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 289  gagtaagccgtgtccttctccttgaacttctcagtcag 326
            ||||| || ||||||||||||||||||||||| |||||
Sbjct: 1080 gagtatgctgtgtccttctccttgaacttctctgtcag 1043



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 860 acctctcaaaaatggacctccagttctgaagact 827

---

>gb|AY742306.1| Malus x domestica calcium-binding EF hand family protein mRNA,
           partial cds
          Length = 339

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 247 acagtcaacatgaatgcctcgtaactgaaagtt 279
           ||||||||||||||  |||||||||||||||||
Sbjct: 98  acagtcaacatgaactcctcgtaactgaaagtt 66

---

>emb|BX829719.1|CNS0A1ZB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB30ZH09 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1410

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctc 320
            ||||||| || || || ||||| || |||||||||||||||||||||||
Sbjct: 1169 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctc 1121

---

>emb|BX830310.1|CNS0A08N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB72ZB04 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1271

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 272  tgaaagttgcagacccggagtaagccgtgtccttctccttgaacttctc 320
            ||||||| || || || ||||| || |||||||||||||||||||||||
Sbjct: 1030 tgaaagtagctgagcctgagtatgctgtgtccttctccttgaacttctc 982



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 509 acctctcaaatatagacctccaattctgaagact 542
           |||||||||| || |||||||| |||||||||||
Sbjct: 793 acctctcaaaaatggacctccagttctgaagact 760

---

>gb|AY431726.1| Aedes aegypti ASAP ID: 35119 questionable: large ribosomal subunit
           mRNA sequence
          Length = 378

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 301 tccttctccttgaacttctcagtc 324
           ||||||||||||||||||||||||
Sbjct: 183 tccttctccttgaacttctcagtc 160

---

>emb|AJ251828.1|PSA251828 Pisum sativum partial mRNA for putative cysteine protease (plp
           gene)
          Length = 1155

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 301 tccttctccttgaacttctcagtcagacccttgactgtaaggcaacactcaataaagtta 360
           |||||||||||||| || ||||| || ||||| || || || ||||||||||| || || 
Sbjct: 812 tccttctccttgaatttgtcagttagtcccttcacggtgagacaacactcaatgaaattg 753

                   
Query: 361 tcatattc 368
           ||||||||
Sbjct: 752 tcatattc 745

---

>emb|CR718554.2|CNS0GHDS Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 299 tgtccttctccttgaacttctca 321
           |||||||||||||||||||||||
Sbjct: 86  tgtccttctccttgaacttctca 64

---

>emb|CR716203.2|CNS0GFKK Tetraodon nigroviridis full-length cDNA
          Length = 1207

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 299 tgtccttctccttgaacttctca 321
           |||||||||||||||||||||||
Sbjct: 501 tgtccttctccttgaacttctca 479

---

>emb|CR710713.2|CNS0GBC5 Tetraodon nigroviridis full-length cDNA
          Length = 586

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 299 tgtccttctccttgaacttctca 321
           |||||||||||||||||||||||
Sbjct: 435 tgtccttctccttgaacttctca 413

---

>emb|CR706457.2|CNS0G81X Tetraodon nigroviridis full-length cDNA
          Length = 498

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 299 tgtccttctccttgaacttctca 321
           |||||||||||||||||||||||
Sbjct: 86  tgtccttctccttgaacttctca 64

---

>emb|CR684420.2|CNS0FR1S Tetraodon nigroviridis full-length cDNA
          Length = 1160

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 299 tgtccttctccttgaacttctca 321
           |||||||||||||||||||||||
Sbjct: 464 tgtccttctccttgaacttctca 442

---

>gb|AC009400.4|ATAC009400 Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence,
             complete sequence
          Length = 87937

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 295   gccgtgtccttctccttgaacttctc 320
             ||||| ||||||||||||||||||||
Sbjct: 42765 gccgtatccttctccttgaacttctc 42790

---

>emb|CR704396.2|CNS0G6GO Tetraodon nigroviridis full-length cDNA
          Length = 1054

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 321 tgtccttctccttgaacttctc 300

---

>emb|CR702313.2|CNS0G4UT Tetraodon nigroviridis full-length cDNA
          Length = 1183

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 441 tgtccttctccttgaacttctc 420

---

>emb|CR701693.1|CNS0G4DL Tetraodon nigroviridis full-length cDNA
          Length = 1212

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 482 tgtccttctccttgaacttctc 461

---

>emb|CR701182.2|CNS0G3ZE Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 499 tgtccttctccttgaacttctc 478

---

>emb|CR700340.1|CNS0G3C0 Tetraodon nigroviridis full-length cDNA
          Length = 1181

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 440 tgtccttctccttgaacttctc 419

---

>emb|CR696556.2|CNS0G0EW Tetraodon nigroviridis full-length cDNA
          Length = 1234

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 489 tgtccttctccttgaacttctc 468

---

>emb|CR694535.1|CNS0FYUR Tetraodon nigroviridis full-length cDNA
          Length = 1204

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 487 tgtccttctccttgaacttctc 466

---

>emb|CR692906.2|CNS0FXLI Tetraodon nigroviridis full-length cDNA
          Length = 1236

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 498 tgtccttctccttgaacttctc 477

---

>emb|CR692493.2|CNS0FXA1 Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 491 tgtccttctccttgaacttctc 470

---

>emb|CR691997.2|CNS0FWW9 Tetraodon nigroviridis full-length cDNA
          Length = 1014

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 264 tgtccttctccttgaacttctc 243

---

>emb|CR688852.2|CNS0FUGW Tetraodon nigroviridis full-length cDNA
          Length = 1195

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 442 tgtccttctccttgaacttctc 421

---

>emb|CR684360.2|CNS0FR04 Tetraodon nigroviridis full-length cDNA
          Length = 1193

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 443 tgtccttctccttgaacttctc 422

---

>emb|CR679151.2|CNS0FMZF Tetraodon nigroviridis full-length cDNA
          Length = 557

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 122 tgtccttctccttgaacttctc 101

---

>emb|CR671534.2|CNS0FH4K Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 448 tgtccttctccttgaacttctc 427

---

>emb|CR670949.1|CNS0FGOB Tetraodon nigroviridis full-length cDNA
          Length = 1187

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 449 tgtccttctccttgaacttctc 428

---

>emb|CR669089.2|CNS0FF8N Tetraodon nigroviridis full-length cDNA
          Length = 556

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 299 tgtccttctccttgaacttctc 320
           ||||||||||||||||||||||
Sbjct: 121 tgtccttctccttgaacttctc 100

---

>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 299     tgtccttctccttgaacttctc 320
               ||||||||||||||||||||||
Sbjct: 1087856 tgtccttctccttgaacttctc 1087835

---

>emb|AL591793.1|SME591793 Sinorhizobium meliloti 1021 complete chromosome; segment 12/12
          Length = 273785

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   cacttcggtcacggtcaaacc 511
             |||||||||||||||||||||
Sbjct: 90989 cacttcggtcacggtcaaacc 90969

---

>emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chromosome 6 Contains the
             3' end of the FLJ14440 gene for thrombospondin, complete
             sequence
          Length = 135507

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 233   tgatgaaagggagcacagtcaacat 257
             |||||||| ||||||||||||||||
Sbjct: 16107 tgatgaaatggagcacagtcaacat 16083

---

>gb|AC154341.2| Mus musculus BAC clone RP23-240C2 from 16, complete sequence
          Length = 163871

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 400    aatttagacacgagcaagtct 420
              |||||||||||||||||||||
Sbjct: 125281 aatttagacacgagcaagtct 125261

---

>emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chromosome 6, complete
             sequence
          Length = 51956

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 233   tgatgaaagggagcacagtcaacat 257
             |||||||| ||||||||||||||||
Sbjct: 14218 tgatgaaatggagcacagtcaacat 14194

---

>gb|AF009663.1|HSTCRB75A Homo sapiens T cell receptor beta locus, TCRBV8S5P to TCRBV21S2A2
             region
          Length = 136975

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   cccagactgagaagagcatc 464
             ||||||||||||||||||||
Sbjct: 22737 cccagactgagaagagcatc 22718

---

>gb|AY513883.1| Homo sapiens T-cell receptor beta mRNA, partial cds
          Length = 720

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 445 cccagactgagaagagcatc 464
           ||||||||||||||||||||
Sbjct: 78  cccagactgagaagagcatc 59

---

>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8
           mRNA sequence
          Length = 1079

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 868 tccttctccttgaacttctc 849

---

>gb|AF009662.1|HSTCRBB27 Homo sapiens T cell receptor beta locus, TCRBV13S1 to TCRBV6S9 region
          Length = 36337

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   cccagactgagaagagcatc 464
             ||||||||||||||||||||
Sbjct: 18516 cccagactgagaagagcatc 18497

---

>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA,
           complete cds
          Length = 786

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 776 tccttctccttgaacttctc 757

---

>ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) on chromosome 7
          Length = 684973

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 445    cccagactgagaagagcatc 464
              ||||||||||||||||||||
Sbjct: 278088 cccagactgagaagagcatc 278069

---

>gb|AF289077.4| Homo sapiens chromosome 8 clone CTD-2003M15 map p23.2, complete
             sequence
          Length = 145170

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   atgaatgcctcgtaactgaa 275
             ||||||||||||||||||||
Sbjct: 23291 atgaatgcctcgtaactgaa 23310

---

>gb|AY464739.1| Uncultured archaeon clone AF02 16S ribosomal RNA gene, partial
           sequence
          Length = 913

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 258 gaatgcctcgtaactgaaagttgc 281
           ||||||||| ||||||||||||||
Sbjct: 170 gaatgcctcctaactgaaagttgc 193

---

>gb|BC071724.1| Homo sapiens cDNA clone IMAGE:5212614, **** WARNING: chimeric clone
           ****
          Length = 1381

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 445 cccagactgagaagagcatc 464
           ||||||||||||||||||||
Sbjct: 295 cccagactgagaagagcatc 276

---

>emb|AL591472.7| Human DNA sequence from clone RP11-438A6 on chromosome 6 Contains two
             CpG islands, complete sequence
          Length = 80601

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   agtcagacccttgactgtaa 340
             ||||||||||||||||||||
Sbjct: 49908 agtcagacccttgactgtaa 49927

---

>emb|AL137801.11| Human DNA sequence from clone RP4-609B14 on chromosome 1q42.11-42.3
             Contains the gene for a novel protein (DKFZp547B1713), the
             5' end of the GNPAT gene for glyceronephosphate
             O-acyltransferase and a CpG island, complete sequence
          Length = 54486

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   aacatcactcaaattcaaac 137
             ||||||||||||||||||||
Sbjct: 42621 aacatcactcaaattcaaac 42602

---

>emb|BX072100.1|CNS09RSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 196 tccttctccttgaacttctc 215

---

>emb|BX072099.1|CNS09RSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 847 tccttctccttgaacttctc 828

---

>emb|BX071992.1|CNS09RPO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 236 tccttctccttgaacttctc 255

---

>emb|BX071991.1|CNS09RPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 866 tccttctccttgaacttctc 847

---

>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 233 tccttctccttgaacttctc 252

---

>emb|BX071469.1|CNS09RB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 856 tccttctccttgaacttctc 837

---

>emb|BX071376.1|CNS09R8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 217 tccttctccttgaacttctc 236

---

>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 233 tccttctccttgaacttctc 252

---

>emb|BX071011.1|CNS09QYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 849 tccttctccttgaacttctc 830

---

>emb|BX070723.1|CNS09QQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 217 tccttctccttgaacttctc 236

---

>emb|BX070722.1|CNS09QQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 859 tccttctccttgaacttctc 840

---

>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 218 tccttctccttgaacttctc 237

---

>emb|BX069681.1|CNS09PXH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 224 tccttctccttgaacttctc 243

---

>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 207 tccttctccttgaacttctc 226

---

>emb|BX060948.1|CNS09J6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 419

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX060936.1|CNS09J6K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 204 tccttctccttgaacttctc 223

---

>emb|BX060935.1|CNS09J6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 837 tccttctccttgaacttctc 818

---

>emb|BX069234.1|CNS09PL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 225 tccttctccttgaacttctc 244

---

>emb|BX068985.1|CNS09PE5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 260 tccttctccttgaacttctc 279

---

>emb|BX068984.1|CNS09PE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 866 tccttctccttgaacttctc 847

---

>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 237 tccttctccttgaacttctc 256

---

>emb|BX068768.1|CNS09P84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 863 tccttctccttgaacttctc 844

---

>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX067647.1|CNS09OCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 846 tccttctccttgaacttctc 827

---

>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 225 tccttctccttgaacttctc 244

---

>emb|BX067519.1|CNS09O9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 846 tccttctccttgaacttctc 827

---

>emb|BX067280.1|CNS09O2S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 240 tccttctccttgaacttctc 259

---

>emb|BX067279.1|CNS09O2R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 856 tccttctccttgaacttctc 837

---

>emb|BX067196.1|CNS09O0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 401

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 214 tccttctccttgaacttctc 233

---

>emb|BX066817.1|CNS09NPX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 212 tccttctccttgaacttctc 231

---

>emb|BX066816.1|CNS09NPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 849 tccttctccttgaacttctc 830

---

>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 226 tccttctccttgaacttctc 245

---

>emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 862 tccttctccttgaacttctc 843

---

>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 227 tccttctccttgaacttctc 246

---

>emb|BX066543.1|CNS09NIB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 851 tccttctccttgaacttctc 832

---

>emb|BX066504.1|CNS09NH8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 188 tccttctccttgaacttctc 207

---

>emb|BX066033.1|CNS09N45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 227 tccttctccttgaacttctc 246

---

>emb|BX066032.1|CNS09N44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 854 tccttctccttgaacttctc 835

---

>emb|BX065783.1|CNS09MX7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 208 tccttctccttgaacttctc 189

---

>emb|BX065536.1|CNS09MQC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 220 tccttctccttgaacttctc 239

---

>emb|BX065162.1|CNS09MFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 227 tccttctccttgaacttctc 246

---

>emb|BX065161.1|CNS09MFX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 864 tccttctccttgaacttctc 845

---

>emb|BX064927.1|CNS09M9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 579

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 214 tccttctccttgaacttctc 233

---

>emb|BX064863.1|CNS09M7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 850 tccttctccttgaacttctc 831

---

>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 219 tccttctccttgaacttctc 238

---

>emb|BX064324.1|CNS09LSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 228 tccttctccttgaacttctc 247

---

>emb|BX064323.1|CNS09LSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 844 tccttctccttgaacttctc 825

---

>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 226 tccttctccttgaacttctc 245

---

>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 237 tccttctccttgaacttctc 256

---

>emb|BX063826.1|CNS09LEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1072

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 855 tccttctccttgaacttctc 836

---

>emb|BX063741.1|CNS09LCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 234 tccttctccttgaacttctc 253

---

>emb|BX063740.1|CNS09LCG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 875 tccttctccttgaacttctc 856

---

>emb|BX063296.1|CNS09L04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 224 tccttctccttgaacttctc 243

---

>emb|BX063295.1|CNS09L03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 845 tccttctccttgaacttctc 826

---

>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 217 tccttctccttgaacttctc 236

---

>emb|BX063244.1|CNS09KYO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 702 tccttctccttgaacttctc 683

---

>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 233 tccttctccttgaacttctc 252

---

>emb|BX063170.1|CNS09KWM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 832 tccttctccttgaacttctc 813

---

>emb|BX062638.1|CNS09KHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 230 tccttctccttgaacttctc 249

---

>emb|BX062637.1|CNS09KHT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 859 tccttctccttgaacttctc 840

---

>emb|BX062521.1|CNS09KEL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 236 tccttctccttgaacttctc 255

---

>emb|BX062520.1|CNS09KEK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 837 tccttctccttgaacttctc 818

---

>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 215 tccttctccttgaacttctc 234

---

>emb|BX062317.1|CNS09K8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 702 tccttctccttgaacttctc 683

---

>emb|BX062059.1|CNS09K1R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 386

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 186 tccttctccttgaacttctc 205

---

>emb|BX062058.1|CNS09K1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 848 tccttctccttgaacttctc 829

---

>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 158 tccttctccttgaacttctc 177

---

>emb|BX062037.1|CNS09K15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 841 tccttctccttgaacttctc 822

---

>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 864 tccttctccttgaacttctc 845

---

>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 231 tccttctccttgaacttctc 250

---

>emb|BX061502.1|CNS09JMA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 865 tccttctccttgaacttctc 846

---

>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 185 tccttctccttgaacttctc 204

---

>emb|BX061237.1|CNS09JEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 822 tccttctccttgaacttctc 803

---

>emb|BX061207.1|CNS09JE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 228 tccttctccttgaacttctc 247

---

>emb|BX061125.1|CNS09JBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 820 tccttctccttgaacttctc 801

---

>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX060723.1|CNS09J0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 839 tccttctccttgaacttctc 820

---

>emb|BX060569.1|CNS09IWD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 291

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 205 tccttctccttgaacttctc 224

---

>emb|BX059883.1|CNS09IDB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 388

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 214 tccttctccttgaacttctc 233

---

>emb|BX059882.1|CNS09IDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 865 tccttctccttgaacttctc 846

---

>emb|BX059853.1|CNS09ICH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 212 tccttctccttgaacttctc 231

---

>emb|BX059852.1|CNS09ICG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 846 tccttctccttgaacttctc 827

---

>emb|BX059824.1|CNS09IBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 220 tccttctccttgaacttctc 239

---

>emb|BX059823.1|CNS09IBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 841 tccttctccttgaacttctc 822

---

>emb|BX059792.1|CNS09IAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 217 tccttctccttgaacttctc 236

---

>emb|BX059791.1|CNS09IAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 756 tccttctccttgaacttctc 737

---

>emb|BX059612.1|CNS09I5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 356

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 225 tccttctccttgaacttctc 244

---

>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 239 tccttctccttgaacttctc 258

---

>emb|BX059266.1|CNS09HW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 869 tccttctccttgaacttctc 850

---

>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 218 tccttctccttgaacttctc 237

---

>emb|BX059234.1|CNS09HVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 847 tccttctccttgaacttctc 828

---

>emb|BX059042.1|CNS09HPY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 844 tccttctccttgaacttctc 825

---

>emb|BX058790.1|CNS09HIY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 216 tccttctccttgaacttctc 235

---

>emb|BX058355.1|CNS09H6V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 400

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 245 tccttctccttgaacttctc 264

---

>emb|BX056726.1|CNS09FXM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 256 tccttctccttgaacttctc 275

---

>emb|BX056725.1|CNS09FXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 872 tccttctccttgaacttctc 853

---

>emb|BX057699.1|CNS09GON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 367

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 239 tccttctccttgaacttctc 258

---

>emb|BX057210.1|CNS09GB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 263 tccttctccttgaacttctc 282

---

>emb|BX057196.1|CNS09GAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 250 tccttctccttgaacttctc 269

---

>emb|BX057158.1|CNS09G9M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 443

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 235 tccttctccttgaacttctc 254

---

>emb|BX057093.1|CNS09G7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 237 tccttctccttgaacttctc 256

---

>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 229 tccttctccttgaacttctc 248

---

>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 238 tccttctccttgaacttctc 257

---

>emb|BX056409.1|CNS09FOT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 248 tccttctccttgaacttctc 267

---

>emb|BX055358.1|CNS09EVM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 402

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 218 tccttctccttgaacttctc 237

---

>emb|BX055357.1|CNS09EVL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 849 tccttctccttgaacttctc 830

---

>emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 233 tccttctccttgaacttctc 252

---

>emb|BX055194.1|CNS09ER2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 762 tccttctccttgaacttctc 743

---

>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 227 tccttctccttgaacttctc 246

---

>emb|BX055188.1|CNS09EQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 822 tccttctccttgaacttctc 803

---

>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 223 tccttctccttgaacttctc 242

---

>emb|BX054842.1|CNS09EHA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 869 tccttctccttgaacttctc 850

---

>emb|BX054817.1|CNS09EGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 240 tccttctccttgaacttctc 259

---

>emb|BX054816.1|CNS09EGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 868 tccttctccttgaacttctc 849

---

>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 213 tccttctccttgaacttctc 232

---

>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 837 tccttctccttgaacttctc 818

---

>emb|BX053073.1|CNS09D45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 127 tccttctccttgaacttctc 146

---

>emb|BX053072.1|CNS09D44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 798 tccttctccttgaacttctc 779

---

>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 150 tccttctccttgaacttctc 169

---

>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 125 tccttctccttgaacttctc 144

---

>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 867 tccttctccttgaacttctc 848

---

>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 226 tccttctccttgaacttctc 245

---

>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 231 tccttctccttgaacttctc 250

---

>emb|BX054107.1|CNS09DWV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 851 tccttctccttgaacttctc 832

---

>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 239 tccttctccttgaacttctc 258

---

>emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 870 tccttctccttgaacttctc 851

---

>emb|BX053757.1|CNS09DN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 811 tccttctccttgaacttctc 792

---

>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 239 tccttctccttgaacttctc 258

---

>emb|BX053554.1|CNS09DHI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 856 tccttctccttgaacttctc 837

---

>emb|BX052869.1|CNS09CYH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 240 tccttctccttgaacttctc 259

---

>emb|BX052868.1|CNS09CYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 864 tccttctccttgaacttctc 845

---

>emb|BX052583.1|CNS09CQJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 232 tccttctccttgaacttctc 251

---

>emb|BX052582.1|CNS09CQI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 850 tccttctccttgaacttctc 831

---

>emb|BX052554.1|CNS09CPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 224 tccttctccttgaacttctc 243

---

>emb|BX052553.1|CNS09CPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 838 tccttctccttgaacttctc 819

---

>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 234 tccttctccttgaacttctc 253

---

>emb|BX052539.1|CNS09CPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 850 tccttctccttgaacttctc 831

---

>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 234 tccttctccttgaacttctc 253

---

>emb|BX052272.1|CNS09CHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 228 tccttctccttgaacttctc 247

---

>emb|BX052271.1|CNS09CHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 859 tccttctccttgaacttctc 840

---

>emb|BX052222.1|CNS09CGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 242 tccttctccttgaacttctc 261

---

>emb|BX052221.1|CNS09CGH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 852 tccttctccttgaacttctc 833

---

>emb|BX051688.1|CNS09C1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 452

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 247 tccttctccttgaacttctc 266

---

>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 242 tccttctccttgaacttctc 261

---

>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 231 tccttctccttgaacttctc 250

---

>emb|BX051422.1|CNS09BUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 837 tccttctccttgaacttctc 818

---

>emb|BX051408.1|CNS09BTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 838 tccttctccttgaacttctc 819

---

>emb|BX051372.1|CNS09BSW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 240 tccttctccttgaacttctc 259

---

>emb|BX051371.1|CNS09BSV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 864 tccttctccttgaacttctc 845

---

>emb|BX050253.1|CNS09AXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 218 tccttctccttgaacttctc 237

---

>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 221 tccttctccttgaacttctc 240

---

>emb|BX050089.1|CNS09AT9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 212 tccttctccttgaacttctc 231

---

>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 229 tccttctccttgaacttctc 248

---

>emb|BX050809.1|CNS09BD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 858 tccttctccttgaacttctc 839

---

>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 211 tccttctccttgaacttctc 230

---

>emb|BX031018.1|CNS08W3I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 228 tccttctccttgaacttctc 247

---

>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 237 tccttctccttgaacttctc 256

---

>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 222 tccttctccttgaacttctc 241

---

>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 221 tccttctccttgaacttctc 240

---

>emb|BX046433.1|CNS097ZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 840 tccttctccttgaacttctc 821

---

>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 213 tccttctccttgaacttctc 232

---

>emb|BX046385.1|CNS097YD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 668 tccttctccttgaacttctc 649

---

>emb|BX048281.1|CNS099F1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 221

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 167 tccttctccttgaacttctc 186

---

>emb|BX048280.1|CNS099F0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 875 tccttctccttgaacttctc 856

---

>emb|BX048092.1|CNS0999S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 260 tccttctccttgaacttctc 279

---

>emb|BX047771.1|CNS0990V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 222 tccttctccttgaacttctc 241

---

>emb|BX047770.1|CNS0990U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 846 tccttctccttgaacttctc 827

---

>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 243 tccttctccttgaacttctc 262

---

>emb|BX047424.1|CNS098R8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 867 tccttctccttgaacttctc 848

---

>emb|BX047421.1|CNS098R5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 217 tccttctccttgaacttctc 236

---

>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 241 tccttctccttgaacttctc 260

---

>emb|BX047144.1|CNS098JG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 861 tccttctccttgaacttctc 842

---

>emb|BX045784.1|CNS097HO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 228 tccttctccttgaacttctc 247

---

>emb|BX045783.1|CNS097HN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 855 tccttctccttgaacttctc 836

---

>emb|BX045690.1|CNS097F2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 159

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 tccttctccttgaacttctc 320
           ||||||||||||||||||||
Sbjct: 80  tccttctccttgaacttctc 99


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,166,497
Number of Sequences: 3902068
Number of extensions: 5166497
Number of successful extensions: 95190
Number of sequences better than 10.0: 570
Number of HSP's better than 10.0 without gapping: 570
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94436
Number of HSP's gapped (non-prelim): 754
length of query: 542
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 519
effective length of database: 17,143,297,704
effective search space: 8897371508376
effective search space used: 8897371508376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---