>gb|AC129337.4| Mus musculus BAC clone RP23-123I14 from 1, complete sequence
          Length = 184705

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    tatatgctgggtcttgaggta 105
             |||||||||||||||||||||
Sbjct: 94479 tatatgctgggtcttgaggta 94499

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 118     gtaagtgctacaggggatgat 138
               |||||||||||||||||||||
Sbjct: 1984028 gtaagtgctacaggggatgat 1984008

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 63       atgatatgggcttcagaatatatat 87
                ||||||||| |||||||||||||||
Sbjct: 18690520 atgatatggtcttcagaatatatat 18690544

>dbj|AP005177.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0055I24
          Length = 155872

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 63    atgatatgggcttcagaatatatat 87
             ||||||||| |||||||||||||||
Sbjct: 22808 atgatatggtcttcagaatatatat 22832

>gb|AC101783.12| Mus musculus chromosome 1, clone RP24-136B19, complete sequence
          Length = 169909

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    tatatgctgggtcttgaggta 105
             |||||||||||||||||||||
Sbjct: 44915 tatatgctgggtcttgaggta 44935

>gb|AC141328.4| Mus musculus BAC clone RP23-204P22 from 6, complete sequence
          Length = 194430

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 85    tatatgctgggtcttgaggta 105
             |||||||||||||||||||||
Sbjct: 83509 tatatgctgggtcttgaggta 83489

>ref|XM_841423.1| Trypanosoma brucei TREU927 phospholipase A1 (Tb927.1.4830) partial
           mRNA
          Length = 903

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 30  ataacataattaattacctc 49
           ||||||||||||||||||||
Sbjct: 530 ataacataattaattacctc 511

>gb|AC157572.4| Mus musculus BAC clone RP23-79O10 from chromosome 14, complete sequence
          Length = 242759

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   ctccctggggctggggatta 202
             ||||||||||||||||||||
Sbjct: 86975 ctccctggggctggggatta 86994

>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29
          Length = 311000

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    cggccgacctgctcggggag 236
              ||||||||||||||||||||
Sbjct: 231411 cggccgacctgctcggggag 231392

>gb|AC159323.3| Mus musculus BAC clone RP23-6I8 from chromosome 14, complete sequence
          Length = 223640

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   ctccctggggctggggatta 202
             ||||||||||||||||||||
Sbjct: 51221 ctccctggggctggggatta 51202

>emb|AJ716154.1| Trypanosoma brucei PLA1 gene for phospholipase A1, strain 427
          Length = 903

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 30  ataacataattaattacctc 49
           ||||||||||||||||||||
Sbjct: 530 ataacataattaattacctc 511

>gb|U15756.1|TBU15756 Trypanosoma brucei cDNA clone SL-1A-3
          Length = 515

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 30  ataacataattaattacctc 49
           ||||||||||||||||||||
Sbjct: 384 ataacataattaattacctc 403


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,655,839
Number of Sequences: 3902068
Number of extensions: 2655839
Number of successful extensions: 44484
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44449
Number of HSP's gapped (non-prelim): 35
length of query: 239
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 217
effective length of database: 17,147,199,772
effective search space: 3720942350524
effective search space used: 3720942350524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)