>gb|AC133456.11| Mus musculus chromosome 5, clone RP24-465G18, complete sequence
          Length = 162210

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    acaggatatcctagagagca 88
             ||||||||||||||||||||
Sbjct: 10459 acaggatatcctagagagca 10440

>gb|AC161225.14| Mus musculus chromosome 5, clone RP23-37G13, complete sequence
          Length = 165525

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     acaggatatcctagagagca 88
              ||||||||||||||||||||
Sbjct: 160237 acaggatatcctagagagca 160218

>emb|AL627129.8| Zebrafish DNA sequence from clone RP71-1F1 in linkage group 24 Contains
             a novel gene for a protein similar to acyl-CoA thioester
             hydrolases, a novel gene similar to human SAT
             (spermidine/spermine N1-acetyltransferase), two novel
             genes, three novel genes for proteins similar to arylamine
             N-acetyltransferases, a novel gene similar to human ASP
             (AKAP-associated sperm protein), the 3' part of the dap1a
             gene for death associated protein 1a and a CpG island,
             complete sequence
          Length = 141894

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    tagaaacaggatatcctaga 83
             ||||||||||||||||||||
Sbjct: 73250 tagaaacaggatatcctaga 73269

>gb|AC093206.2| Homo sapiens chromosome 5 clone CTC-448D22, complete sequence
          Length = 161754

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    gaaacaggatatcctagaga 85
             ||||||||||||||||||||
Sbjct: 49467 gaaacaggatatcctagaga 49486

>emb|AL080248.7|HSBA19D2 Human DNA sequence from clone RP11-19D2 on chromosome 20 Contains the a
             novel gene and the 5' end of a novel gene, complete
             sequence
          Length = 166913

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    agaaacaggatatcctaga 83
             |||||||||||||||||||
Sbjct: 67214 agaaacaggatatcctaga 67232

>emb|AL590627.25| Human DNA sequence from clone RP13-467E5 on chromosome 9 Contains a
            pseudogene similar to part of SET translocation (myeloid
            leukemia-associated) (SET), the 5' end of the gene for
            euchromatic histone methyltransferase 1 (FLJ12879,
            KIAA1876) (Eu-HMTase1) and two CpG islands, complete
            sequence
          Length = 166141

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 20   cattcaactaaaggaaacg 38
            |||||||||||||||||||
Sbjct: 6303 cattcaactaaaggaaacg 6285

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 10      ctgaattcagcattcaact 28
               |||||||||||||||||||
Sbjct: 1342128 ctgaattcagcattcaact 1342110

>emb|AL354793.11| Human DNA sequence from clone RP11-431N15 on chromosome Xp11.1-11.22
             Contains the UBQLN2 gene for ubiquilin 2, a novel gene and
             a CpG island, complete sequence
          Length = 180504

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 2     acaacactctgaattcagcattc 24
             |||||||||||| ||||||||||
Sbjct: 73122 acaacactctgatttcagcattc 73144

>emb|AL109752.14|HSJ321O10 Human DNA sequence from clone RP1-321O10 on chromosome Xq13.1-21.2
             Contains the 5' end of the DACH2 gene for dachshund
             homolog 2 (Drosophila), aeukaryotic translation elongation
             factor 1 alpha 1 (EEF1A1) pseudogene and a CpG island,
             complete sequence
          Length = 79562

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 11    tgaattcagcattcaacta 29
             |||||||||||||||||||
Sbjct: 74902 tgaattcagcattcaacta 74884

>gb|AC096564.3| Homo sapiens BAC clone RP11-286E11 from 4, complete sequence
          Length = 163317

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ttatattgtacaggatgta 65
              |||||||||||||||||||
Sbjct: 143409 ttatattgtacaggatgta 143391

>gb|AC055120.5| Homo sapiens BAC clone RP11-336N6 from 4, complete sequence
          Length = 178524

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1     aacaacactctgaattcagcatt 23
             |||||||||||||||| ||||||
Sbjct: 30426 aacaacactctgaatttagcatt 30404

>gb|AC008102.18| Homo sapiens chromosome 11 clone bac41i21 map 11q13, complete sequence
          Length = 126787

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    caggatgtagaaacaggat 75
             |||||||||||||||||||
Sbjct: 89470 caggatgtagaaacaggat 89488

>dbj|AP001836.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-693I21, complete
             sequence
          Length = 145782

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    attgtacaggatgtagaaa 69
             |||||||||||||||||||
Sbjct: 74453 attgtacaggatgtagaaa 74471

>dbj|AP006287.2| Homo sapiens genomic DNA, chromosome 11 clone:RP11-1167A19, complete
              sequence
          Length = 208726

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     caggatgtagaaacaggat 75
              |||||||||||||||||||
Sbjct: 196894 caggatgtagaaacaggat 196876

>emb|AL833786.8| Mouse DNA sequence from clone RP23-220D12 on chromosome 2, complete
              sequence
          Length = 194536

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 97     tacctctgcatcataatat 115
              |||||||||||||||||||
Sbjct: 154591 tacctctgcatcataatat 154609


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,033,044
Number of Sequences: 3902068
Number of extensions: 1033044
Number of successful extensions: 62433
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62413
Number of HSP's gapped (non-prelim): 20
length of query: 120
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 99
effective length of database: 17,151,101,840
effective search space: 1697959082160
effective search space used: 1697959082160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)