ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart26f07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_632758.1| Dictyostelium discoideum hypothetical protein (... 40 0.89
2gb|AY544779.1| Leccinum talamancae 18S ribosomal RNA gene, parti... 40 0.89
3gb|AY210802.1| Danio rerio nuclear receptor coactivator (tif2) g... 40 0.89
4emb|BX950199.14| Zebrafish DNA sequence from clone CH211-215A11 ... 40 0.89
5gb|AC129093.34| Mus musculus strain C57BL/6J clone rp23-198m10 m... 38 3.5
6gb|AC164292.4| Mus musculus BAC clone RP24-177C20 from chromosom... 38 3.5
7gb|AC103380.13| Mus musculus chromosome 1, clone RP24-263A16, co... 38 3.5
8gb|AF454588.1| Leccinum carpini from Netherlands 18S ribosomal R... 38 3.5
9gb|AC121899.3| Mus musculus BAC clone RP24-166J12 from chromosom... 38 3.5
10gb|AC124523.5| Mus musculus BAC clone RP23-399P19 from chromosom... 38 3.5
11gb|AC161761.3| Mus musculus BAC clone RP23-379E17 from chromosom... 38 3.5
12dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 38 3.5
13gb|AC010478.5|AC010478 Homo sapiens chromosome 5 clone CTD-2314G... 38 3.5
14dbj|AP003960.2| Oryza sativa (japonica cultivar-group) genomic D... 38 3.5
15gb|AY656926.1| Uncultured mycorrhizal fungus BOLETE2 18S ribosom... 38 3.5
16gb|AC138106.9| Mus musculus chromosome 1, clone RP23-278C19, com... 38 3.5

>ref|XM_632758.1| Dictyostelium discoideum hypothetical protein (DDB0186922), partial
            mRNA
          Length = 4422

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 12   cagaccatgctgtggttgataatt 35
            |||||||||| |||||||||||||
Sbjct: 2275 cagaccatgcagtggttgataatt 2252



to top

>gb|AY544779.1| Leccinum talamancae 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 653

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 23  gtggttgataattaaatgac 42
           ||||||||||||||||||||
Sbjct: 388 gtggttgataattaaatgac 369



to top

>gb|AY210802.1| Danio rerio nuclear receptor coactivator (tif2) gene, complete cds
          Length = 90209

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 61    acatactaataaccatactaacaa 84
             |||||||||||| |||||||||||
Sbjct: 70070 acatactaataaacatactaacaa 70047



to top

>emb|BX950199.14| Zebrafish DNA sequence from clone CH211-215A11 in linkage group 24,
             complete sequence
          Length = 213091

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 61    acatactaataaccatactaacaa 84
             |||||||||||| |||||||||||
Sbjct: 56989 acatactaataaacatactaacaa 56966



to top

>gb|AC129093.34| Mus musculus strain C57BL/6J clone rp23-198m10 map 19, complete
             sequence
          Length = 190697

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    atactaataaccatactaa 81
             |||||||||||||||||||
Sbjct: 69062 atactaataaccatactaa 69080



to top

>gb|AC164292.4| Mus musculus BAC clone RP24-177C20 from chromosome 3, complete sequence
          Length = 185822

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     acactcatcaccagataca 63
              |||||||||||||||||||
Sbjct: 172453 acactcatcaccagataca 172471



to top

>gb|AC103380.13| Mus musculus chromosome 1, clone RP24-263A16, complete sequence
          Length = 173136

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 63   atactaataaccatactaa 81
            |||||||||||||||||||
Sbjct: 2758 atactaataaccatactaa 2776



to top

>gb|AF454588.1| Leccinum carpini from Netherlands 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 916

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  tggttgataattaaatgac 42
           |||||||||||||||||||
Sbjct: 354 tggttgataattaaatgac 336



to top

>gb|AC121899.3| Mus musculus BAC clone RP24-166J12 from chromosome 6, complete
            sequence
          Length = 129975

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 8    tatacagaccatgctgtggttga 30
            |||||||||| ||||||||||||
Sbjct: 5735 tatacagaccttgctgtggttga 5757



to top

>gb|AC124523.5| Mus musculus BAC clone RP23-399P19 from chromosome 6, complete sequence
          Length = 188084

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 8     tatacagaccatgctgtggttga 30
             |||||||||| ||||||||||||
Sbjct: 86694 tatacagaccttgctgtggttga 86716



to top

>gb|AC161761.3| Mus musculus BAC clone RP23-379E17 from chromosome 3, complete sequence
          Length = 205852

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    acactcatcaccagataca 63
             |||||||||||||||||||
Sbjct: 27024 acactcatcaccagataca 27042



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 56       cagatacatactaataacc 74
                |||||||||||||||||||
Sbjct: 21636060 cagatacatactaataacc 21636078



to top

>gb|AC010478.5|AC010478 Homo sapiens chromosome 5 clone CTD-2314G24, complete sequence
          Length = 126852

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    catgctgtggttgataatt 35
             |||||||||||||||||||
Sbjct: 85595 catgctgtggttgataatt 85577



to top

>dbj|AP003960.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1612_A04
          Length = 124833

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    cagatacatactaataacc 74
             |||||||||||||||||||
Sbjct: 66516 cagatacatactaataacc 66534



to top

>gb|AY656926.1| Uncultured mycorrhizal fungus BOLETE2 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 782

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  tggttgataattaaatgac 42
           |||||||||||||||||||
Sbjct: 430 tggttgataattaaatgac 412



to top

>gb|AC138106.9| Mus musculus chromosome 1, clone RP23-278C19, complete sequence
          Length = 173026

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    atactaataaccatactaa 81
             |||||||||||||||||||
Sbjct: 90087 atactaataaccatactaa 90105


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 688,690
Number of Sequences: 3902068
Number of extensions: 688690
Number of successful extensions: 46549
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46517
Number of HSP's gapped (non-prelim): 32
length of query: 84
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 63
effective length of database: 17,151,101,840
effective search space: 1080519415920
effective search space used: 1080519415920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top