ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart26f06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_479089.1| Oryza sativa (japonica cultivar-group), mRNA 192 7e-46
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 192 7e-46
3dbj|AP005175.4| Oryza sativa (japonica cultivar-group) genomic D... 192 7e-46
4dbj|AK061294.1| Oryza sativa (japonica cultivar-group) cDNA clon... 192 7e-46
5emb|Y18626.1|TAE18626 Triticum aestivum mRNA for reversibly glyc... 92 2e-15
6emb|AJ292078.1|GHI292078 Gossypium hirsutum mRNA for reversibly ... 90 7e-15
7ref|NM_194076.2| Oryza sativa (japonica cultivar-group), mRNA 80 7e-12
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 80 7e-12
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
10gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic ... 80 7e-12
11gb|AF294725.1|AF294725 Oryza sativa reversibly glycosylated poly... 80 7e-12
12emb|Y18624.1|OSA18624 Oryza sativa mRNA for reversibly glycosyla... 80 7e-12
13dbj|AK098933.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
14dbj|AK061813.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
15emb|AJ011078.1|OSA011078 Oryza sativa mRNA for RGP1 protein 76 1e-10
16ref|NM_121569.2| Arabidopsis thaliana RGP2; alpha-1,4-glucan-pro... 70 7e-09
17emb|AL391144.1|ATF14F8 Arabidopsis thaliana DNA chromosome 5, BA... 70 7e-09
18gb|AY120691.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, com... 70 7e-09
19gb|AY039846.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, com... 70 7e-09
20emb|BX831174.1|CNS09ZDG Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
21emb|BX830856.1|CNS09ZF4 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
22emb|BX830946.1|CNS09YLX Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
23gb|AY087476.1| Arabidopsis thaliana clone 35863 mRNA, complete s... 70 7e-09
24gb|AF013628.1|AF013628 Arabidopsis thaliana reversibly glycosyla... 70 7e-09
25gb|DQ207853.1| Solanum tuberosum clone 075G08 UDP-glucose:protei... 66 1e-07
26emb|AJ310910.1|STU310910 Solanum tuberosum mRNA for UDP-Glucose:... 66 1e-07
27gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence 64 4e-07
28gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence 64 4e-07
29gb|AF005279.1|AF005279 Vigna unguiculata type IIIa membrane prot... 64 4e-07
30gb|AF286271.1|AF286271 Lycopersicon esculentum putative Golgi-as... 62 2e-06
31ref|NM_111090.2| Arabidopsis thaliana RGP1 (REVERSIBLY GLYCOSYLA... 60 6e-06
32gb|BT017085.1| Zea mays clone EL01N0360E12.c mRNA sequence 60 6e-06
33gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC... 60 6e-06
34gb|BT008841.1| Arabidopsis thaliana At3g02230 mRNA, complete cds 60 6e-06
35gb|BT002409.1| Arabidopsis thaliana reversibly glycosylated poly... 60 6e-06
36gb|AY111237.1| Zea mays CL1948_1 mRNA sequence 60 6e-06
37gb|AF013627.1|AF013627 Arabidopsis thaliana reversibly glycosyla... 60 6e-06
38gb|U89897.1|ZMU89897 Zea mays golgi associated protein se-wap41 ... 60 6e-06
39gb|AY112484.1| Zea mays CL1948_2 mRNA sequence 56 1e-04
40gb|AY341443.1| Phaseolus vulgaris cultivar Sprite BAC 78L17, par... 54 4e-04
41emb|AJ843986.1| Plantago major partial mRNA for hypothetical pro... 54 4e-04
42gb|AY622990.1| Lycopersicon esculentum UDP-glucose:protein trans... 48 0.025
43gb|BT012716.1| Lycopersicon esculentum clone 113599F, mRNA sequence 48 0.025
44emb|AJ538673.1|NTA538673 Nicotiana tabacum cDNA-AFLP-fragment BC... 48 0.025
45emb|AJ223252.2|SOT223252 Solanum tuberosum mRNA for UDP-glucose:... 48 0.025
46ref|NM_111271.2| Arabidopsis thaliana oxidoreductase AT3G04000 m... 46 0.097
47gb|AC011698.6|ATAC011698 Arabidopsis thaliana chromosome III BAC... 46 0.097
48gb|AY045807.1| Arabidopsis thaliana putative short-chain type de... 46 0.097
49gb|BT002321.1| Arabidopsis thaliana clone C105461 putative short... 46 0.097
50gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence 44 0.38
51ref|NM_204435.1| Gallus gallus asparagine-linked glycosylation 6... 42 1.5
52gb|AC162035.5| Mus musculus chromosome 18, clone RP23-434N7, com... 42 1.5
53emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on ch... 42 1.5
54emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chr... 42 1.5
55emb|AJ719772.1| Gallus gallus mRNA for hypothetical protein, clo... 42 1.5
56gb|AF308281.1| Zonotrichia atricapilla isolate 11 mitochondrial ... 42 1.5
57gb|AF308280.1| Zonotrichia atricapilla isolate 10 mitochondrial ... 42 1.5
58gb|AF308279.1| Zonotrichia atricapilla isolate 9 mitochondrial c... 42 1.5
59gb|AF308278.1| Zonotrichia atricapilla isolate 8 mitochondrial c... 42 1.5
60gb|AF308277.1| Zonotrichia atricapilla isolate 7 mitochondrial c... 42 1.5
61gb|AF308276.1| Zonotrichia atricapilla isolate 6AK mitochondrial... 42 1.5
62gb|AF308275.1| Zonotrichia atricapilla isolate 5AK mitochondrial... 42 1.5
63gb|AF308274.1| Zonotrichia atricapilla isolate 6CA mitochondrial... 42 1.5
64gb|AF308273.1| Zonotrichia atricapilla isolate 5CA mitochondrial... 42 1.5
65gb|AF308272.1| Zonotrichia atricapilla isolate 4 mitochondrial c... 42 1.5
66gb|AF308271.1| Zonotrichia atricapilla isolate 3 mitochondrial c... 42 1.5
67gb|AF308270.1| Zonotrichia atricapilla isolate 2 mitochondrial c... 42 1.5
68gb|AF308269.1| Zonotrichia atricapilla isolate 1 mitochondrial c... 42 1.5
69gb|AF308268.1| Zonotrichia leucophrys isolate 47 mitochondrial c... 42 1.5
70gb|AF308267.1| Zonotrichia leucophrys isolate 46 mitochondrial c... 42 1.5
71gb|AF308266.1| Zonotrichia leucophrys isolate 45 mitochondrial c... 42 1.5
72gb|AF308265.1| Zonotrichia leucophrys isolate 44 mitochondrial c... 42 1.5
73gb|AF308264.1| Zonotrichia leucophrys isolate 43 mitochondrial c... 42 1.5
74gb|AF308263.1| Zonotrichia leucophrys isolate 42 mitochondrial c... 42 1.5
75gb|AF308262.1| Zonotrichia leucophrys isolate 41 mitochondrial c... 42 1.5
76gb|AF308261.1| Zonotrichia leucophrys isolate 40 mitochondrial c... 42 1.5
77gb|AF308260.1| Zonotrichia leucophrys isolate 39 mitochondrial c... 42 1.5
78gb|AF308259.1| Zonotrichia leucophrys isolate 38 mitochondrial c... 42 1.5
79gb|AF308258.1| Zonotrichia leucophrys isolate 36 mitochondrial c... 42 1.5
80gb|AF308257.1| Zonotrichia leucophrys isolate 29 mitochondrial c... 42 1.5
81gb|AF308256.1| Zonotrichia leucophrys isolate 25 mitochondrial c... 42 1.5
82gb|AF308255.1| Zonotrichia leucophrys isolate 24 mitochondrial c... 42 1.5
83gb|AF308254.1| Zonotrichia leucophrys isolate 23 mitochondrial c... 42 1.5
84gb|AF308253.1| Zonotrichia leucophrys isolate 22 mitochondrial c... 42 1.5
85gb|AF308252.1| Zonotrichia leucophrys isolate 6 mitochondrial co... 42 1.5
86gb|AF308251.1| Zonotrichia leucophrys isolate 5 mitochondrial co... 42 1.5
87gb|AF308250.1| Zonotrichia leucophrys isolate 4 mitochondrial co... 42 1.5
88gb|AF308249.1| Zonotrichia leucophrys isolate 3 mitochondrial co... 42 1.5
89gb|AF308248.1| Zonotrichia leucophrys isolate 2 mitochondrial co... 42 1.5
90gb|AF308247.1| Zonotrichia leucophrys isolate 1 mitochondrial co... 42 1.5
91gb|AF308246.1| Zonotrichia albicollis isolate 1 mitochondrial co... 42 1.5
92gb|AF308245.1| Zonotrichia querula isolate 2 mitochondrial contr... 42 1.5
93emb|AJ535824.1|GGA535824 Gallus gallus mRNA for alpha 3 glucosyl... 42 1.5
94gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 6.0
95ref|XM_957559.1| Neurospora crassa OR74A hypothetical protein ( ... 40 6.0
96ref|XM_328687.1| Neurospora crassa OR74A hypothetical protein ( ... 40 6.0
97gb|AC140478.2| Mus musculus BAC clone RP24-149A3 from chromosome... 40 6.0
98gb|AC123823.3| Mus musculus BAC clone RP24-63C11 from chromosome... 40 6.0
99gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome... 40 6.0
100emb|AL590453.10| Human DNA sequence from clone RP11-294K17 on ch... 40 6.0
101emb|AL139322.13| Human DNA sequence from clone RP11-196P14 on ch... 40 6.0
102emb|BX842644.1| Mycoplasma mycoides subsp. mycoides SC genomic D... 40 6.0
103emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 40 6.0
104gb|AC161890.4| Mus musculus 6 BAC RP23-356P12 (Roswell Park Canc... 40 6.0
105gb|AC073372.9| Homo sapiens chromosome 11 clone RP11-500D4, comp... 40 6.0
106dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 40 6.0
107gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 40 6.0
108gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 40 6.0
109gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 40 6.0
110gb|AC156567.3| Mus musculus BAC clone RP23-333F2 from chromosome... 40 6.0
111gb|AC112140.4| Homo sapiens BAC clone RP11-131H21 from 4, comple... 40 6.0
112gb|AC025949.4| Staphylococcus aureus clone sabac-114, complete s... 40 6.0
113gb|AC084724.6| Homo sapiens BAC clone RP11-613O14 from 4, comple... 40 6.0
114dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 40 6.0
115dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 40 6.0
116gb|AC108805.15| Mus musculus chromosome 9, clone RP23-226G13, co... 40 6.0
117emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 40 6.0
118dbj|AP003036.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.0
119gb|AC127698.5| Mus musculus BAC clone RP24-113N24 from 3, comple... 40 6.0
120gb|AC134571.4| Mus musculus BAC clone RP23-435E17 from 3, comple... 40 6.0 
>ref|XM_479089.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1407

 Score =  192 bits (97), Expect = 7e-46
 Identities = 136/149 (91%)
 Strand = Plus / Minus

                                                                        
Query: 286  ccctttggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagc 345
            |||||||||||||| ||||  ||||||||||| ||||||||||||||||  || || |||
Sbjct: 1111 ccctttggtgggttcagctgatcccaggcctcaatccatgtgaccatggagtcggcgagc 1052

                                                                        
Query: 346  ttgttgaagtagccatccaccttgccgagcttcgccttcacttgcttggccagctcaagg 405
            ||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 1051 ttgttgaagtagccatcgaccttcccgagcttcgccctcacttgcttggccagctcaagg 992

                                         
Query: 406  taacacttctggacagtggtggcctcctt 434
            ||||||||||||||||||  |||||||||
Sbjct: 991  taacacttctggacagtgtcggcctcctt 963
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  192 bits (97), Expect = 7e-46
 Identities = 136/149 (91%)
 Strand = Plus / Minus

                                                                            
Query: 286      ccctttggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagc 345
                |||||||||||||| ||||  ||||||||||| ||||||||||||||||  || || |||
Sbjct: 24722643 ccctttggtgggttcagctgatcccaggcctcaatccatgtgaccatggagtcggcgagc 24722584

                                                                            
Query: 346      ttgttgaagtagccatccaccttgccgagcttcgccttcacttgcttggccagctcaagg 405
                ||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 24722583 ttgttgaagtagccatcgaccttcccgagcttcgccctcacttgcttggccagctcaagg 24722524

                                             
Query: 406      taacacttctggacagtggtggcctcctt 434
                ||||||||||||||||||  |||||||||
Sbjct: 24722523 taacacttctggacagtgtcggcctcctt 24722495
to top
>dbj|AP005175.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0040H10
          Length = 132919

 Score =  192 bits (97), Expect = 7e-46
 Identities = 136/149 (91%)
 Strand = Plus / Minus

                                                                         
Query: 286   ccctttggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagc 345
             |||||||||||||| ||||  ||||||||||| ||||||||||||||||  || || |||
Sbjct: 78580 ccctttggtgggttcagctgatcccaggcctcaatccatgtgaccatggagtcggcgagc 78521

                                                                         
Query: 346   ttgttgaagtagccatccaccttgccgagcttcgccttcacttgcttggccagctcaagg 405
             ||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 78520 ttgttgaagtagccatcgaccttcccgagcttcgccctcacttgcttggccagctcaagg 78461

                                          
Query: 406   taacacttctggacagtggtggcctcctt 434
             ||||||||||||||||||  |||||||||
Sbjct: 78460 taacacttctggacagtgtcggcctcctt 78432
to top
>dbj|AK061294.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D01, full
            insert sequence
          Length = 1407

 Score =  192 bits (97), Expect = 7e-46
 Identities = 136/149 (91%)
 Strand = Plus / Minus

                                                                        
Query: 286  ccctttggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagc 345
            |||||||||||||| ||||  ||||||||||| ||||||||||||||||  || || |||
Sbjct: 1111 ccctttggtgggttcagctgatcccaggcctcaatccatgtgaccatggagtcggcgagc 1052

                                                                        
Query: 346  ttgttgaagtagccatccaccttgccgagcttcgccttcacttgcttggccagctcaagg 405
            ||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 1051 ttgttgaagtagccatcgaccttcccgagcttcgccctcacttgcttggccagctcaagg 992

                                         
Query: 406  taacacttctggacagtggtggcctcctt 434
            ||||||||||||||||||  |||||||||
Sbjct: 991  taacacttctggacagtgtcggcctcctt 963
to top
>emb|Y18626.1|TAE18626 Triticum aestivum mRNA for reversibly glycosylated polypeptide
          Length = 1393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 52/54 (96%)
 Strand = Plus / Minus

                                                                  
Query: 294  tgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagctt 347
            |||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1137 tgggttcagctcgtcccaggcctcgatccaggtgaccatggcatcagcaagctt 1084
to top
>emb|AJ292078.1|GHI292078 Gossypium hirsutum mRNA for reversibly glycosylated polypeptide (rgp1
            gene)
          Length = 1331

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                        
Query: 294  tgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
            |||||| || || ||||| || || |||||||| ||||| ||||| || ||||| |||||
Sbjct: 1085 tgggttcagttcatcccaagcttcaatccatgtcaccatagcatccgccagcttattgaa 1026

                                                     
Query: 354  gtagccatccaccttgccgagcttcgccttcacttgcttgg 394
            |||| |||| ||||||||||| |||||||||||||||||||
Sbjct: 1025 gtagtcatcgaccttgccgagtttcgccttcacttgcttgg 985
to top
>ref|NM_194076.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1519

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 1147 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 1088

                                    
Query: 355  tagccatccaccttgccgagcttc 378
            |||   || | |||||||||||||
Sbjct: 1087 taggggtcgatcttgccgagcttc 1064
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                            
Query: 295      gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
                ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 22189573 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 22189632

                                        
Query: 355      tagccatccaccttgccgagcttc 378
                |||   || | |||||||||||||
Sbjct: 22189633 taggggtcgatcttgccgagcttc 22189656
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                            
Query: 295      gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
                ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 22182602 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 22182661

                                        
Query: 355      tagccatccaccttgccgagcttc 378
                |||   || | |||||||||||||
Sbjct: 22182662 taggggtcgatcttgccgagcttc 22182685
to top
>gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete
             sequence
          Length = 132987

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                         
Query: 295   gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
             ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 35289 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 35230

                                     
Query: 355   tagccatccaccttgccgagcttc 378
             |||   || | |||||||||||||
Sbjct: 35229 taggggtcgatcttgccgagcttc 35206
to top
>gb|AF294725.1|AF294725 Oryza sativa reversibly glycosylated polypeptide mRNA, complete cds
          Length = 1136

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 1082 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 1023

                                    
Query: 355  tagccatccaccttgccgagcttc 378
            |||   || | |||||||||||||
Sbjct: 1022 taggggtcgatcttgccgagcttc 999
to top
>emb|Y18624.1|OSA18624 Oryza sativa mRNA for reversibly glycosylated polypeptide
          Length = 1384

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 1131 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 1072

                                    
Query: 355  tagccatccaccttgccgagcttc 378
            |||   || | |||||||||||||
Sbjct: 1071 taggggtcgatcttgccgagcttc 1048
to top
>dbj|AK098933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029G13, full
            insert sequence
          Length = 1492

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 1151 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 1092

                                    
Query: 355  tagccatccaccttgccgagcttc 378
            |||   || | |||||||||||||
Sbjct: 1091 taggggtcgatcttgccgagcttc 1068
to top
>dbj|AK061813.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-B03, full
            insert sequence
          Length = 1509

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||  ||||
Sbjct: 1150 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttgacgaag 1091

                                    
Query: 355  tagccatccaccttgccgagcttc 378
            |||   || | |||||||||||||
Sbjct: 1090 taggggtcgatcttgccgagcttc 1067
to top
>emb|AJ011078.1|OSA011078 Oryza sativa mRNA for RGP1 protein
          Length = 1310

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                  
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttg 348
            ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 1136 gggttcagctcatcccaggcctcgatccaggtgaccatggcatcggcaagcttg 1083
to top
>ref|NM_121569.2| Arabidopsis thaliana RGP2; alpha-1,4-glucan-protein synthase
            (UDP-forming) AT5G15650 (RGP2) mRNA, complete cds
          Length = 1530

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1108 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1050
to top
>emb|AL391144.1|ATF14F8 Arabidopsis thaliana DNA chromosome 5, BAC clone F14F8 (ESSA project)
          Length = 96892

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 9674 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 9616
to top
>gb|AY120691.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds
          Length = 1083

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1062 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1004
to top
>gb|AY039846.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds
          Length = 1411

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1109 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1051
to top
>emb|BX831174.1|CNS09ZDG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS64ZH06 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1341

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1096 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1038
to top
>emb|BX830856.1|CNS09ZF4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS31ZC08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1348

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1086 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1028
to top
>emb|BX830946.1|CNS09YLX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS40ZH01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1351

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1092 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1034
to top
>gb|AY087476.1| Arabidopsis thaliana clone 35863 mRNA, complete sequence
          Length = 1396

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1110 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1052
to top
>gb|AF013628.1|AF013628 Arabidopsis thaliana reversibly glycosylated polypeptide-2 (AtRGP)
            mRNA, complete cds
          Length = 1401

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291  tggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            ||||||||||||||| ||||| || || |||||||| ||||||||||| ||||||||||
Sbjct: 1083 tggtgggttaagctcatcccaagcttcaatccatgtaaccatggcatctgcaagcttgt 1025
to top
>gb|DQ207853.1| Solanum tuberosum clone 075G08 UDP-glucose:protein
            transglucosylase-like mRNA, complete cds
          Length = 1244

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 301  agctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
            ||||| |||||||| || ||||||||||||||||||||||| |||||| ||||
Sbjct: 1057 agctcatcccaggcttcaatccatgtgaccatggcatcagctagcttggtgaa 1005
to top
>emb|AJ310910.1|STU310910 Solanum tuberosum mRNA for UDP-Glucose:protein transglucosylase
            (uptg2 gene)
          Length = 1303

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 301  agctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
            ||||| |||||||| || ||||||||||||||||||||||| |||||| ||||
Sbjct: 1068 agctcatcccaggcttcaatccatgtgaccatggcatcagctagcttggtgaa 1016
to top
>gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence
          Length = 146078

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 294   tgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
             |||||||||||| ||||| |||||||||||||||||||| || || | ||||||||
Sbjct: 22599 tgggttaagctcatcccaagcctcgatccatgtgaccatagcttctgaaagcttgt 22544
to top
>gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence
          Length = 141360

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                        
Query: 294  tgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
            |||||||||||||||||| || |||||||| ||||||||||| || |  ||||||| |||
Sbjct: 4618 tgggttaagctcgtcccaagcttcgatccaagtgaccatggcctctgacagcttgtcgaa 4559

                
Query: 354  gtag 357
            ||||
Sbjct: 4558 gtag 4555
to top
>gb|AF005279.1|AF005279 Vigna unguiculata type IIIa membrane protein cp-wap13 mRNA, complete
            cds
          Length = 1275

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 297  gttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaagta 356
            |||||| || ||||| || || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 1119 gttaagttcatcccaagcttcaatccaagtgaccatggcatctgcaagcttgttgaagta 1060
to top
>gb|AF286271.1|AF286271 Lycopersicon esculentum putative Golgi-associated protein mRNA,
           partial cds
          Length = 439

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 295 gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
           ||||| ||||| |||||||| || |||||||| |||||||||||||| |||||| ||||
Sbjct: 202 gggttgagctcatcccaggcttcaatccatgtcaccatggcatcagccagcttggtgaa 144
to top
>ref|NM_111090.2| Arabidopsis thaliana RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1)
            AT3G02230 (RGP1) mRNA, complete cds
          Length = 1385

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 292  ggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 1129 ggtgggttaagctcatcccaagcttcaatccaagtgaccatagcatctgcaagcttgt 1072
to top
>gb|BT017085.1| Zea mays clone EL01N0360E12.c mRNA sequence
          Length = 1383

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttg 348
            ||||| ||||| ||||||||||||||||| ||||||||||| ||| | ||||||
Sbjct: 1132 gggttcagctcatcccaggcctcgatccaggtgaccatggcgtcaccgagcttg 1079
to top
>gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC F14P3 genomic sequence,
             complete sequence
          Length = 94369

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 292   ggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
             |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 57590 ggtgggttaagctcatcccaagcttcaatccaagtgaccatagcatctgcaagcttgt 57647
to top
>gb|BT008841.1| Arabidopsis thaliana At3g02230 mRNA, complete cds
          Length = 1074

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 292  ggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 1061 ggtgggttaagctcatcccaagcttcaatccaagtgaccatagcatctgcaagcttgt 1004
to top
>gb|BT002409.1| Arabidopsis thaliana reversibly glycosylated polypeptide-1
            (At3g02230) mRNA, complete cds
          Length = 1374

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 292  ggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 1132 ggtgggttaagctcatcccaagcttcaatccaagtgaccatagcatctgcaagcttgt 1075
to top
>gb|AY111237.1| Zea mays CL1948_1 mRNA sequence
          Length = 1481

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttg 348
            ||||| ||||| ||||||||||||||||| ||||||||||| ||| | ||||||
Sbjct: 1139 gggttcagctcatcccaggcctcgatccaggtgaccatggcgtcaccgagcttg 1086
to top
>gb|AF013627.1|AF013627 Arabidopsis thaliana reversibly glycosylated polypeptide-1 (AtRGP)
            mRNA, complete cds
          Length = 1393

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 292  ggtgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgt 349
            |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 1132 ggtgggttaagctcatcccaagcttcaatccaagtgaccatagcatctgcaagcttgt 1075
to top
>gb|U89897.1|ZMU89897 Zea mays golgi associated protein se-wap41 mRNA, complete cds
          Length = 1480

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttg 348
            ||||| ||||| ||||||||||||||||| ||||||||||| ||| | ||||||
Sbjct: 1168 gggttcagctcatcccaggcctcgatccaggtgaccatggcgtcaccgagcttg 1115
to top
>gb|AY112484.1| Zea mays CL1948_2 mRNA sequence
          Length = 758

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 301 agctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttg 348
           ||||| ||||||||||||||||| ||||||||||| ||| | ||||||
Sbjct: 411 agctcatcccaggcctcgatccaggtgaccatggcgtcaccgagcttg 364
to top
>gb|AY341443.1| Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence
          Length = 106592

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                         
Query: 295   gggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaag 354
             ||||||||||| ||||| || || ||||| |||||||||||||| || | |||||  |||
Sbjct: 48076 gggttaagctcatcccaagcttcaatccaagtgaccatggcatctgccaacttgtcaaag 48135

                                                                         
Query: 355   tagccatccaccttgccgagcttcgccttcacttgcttggccagctcaaggtaacacttc 414
             ||   ||| | ||||   |||||  |||| ||||||||||| ||| ||| ||| ||||||
Sbjct: 48136 taaggatctatcttggaaagcttttccttgacttgcttggcaagcacaatgtagcacttc 48195

                        
Query: 415   tggacagtggt 425
             || ||||||||
Sbjct: 48196 tgaacagtggt 48206
to top
>emb|AJ843986.1| Plantago major partial mRNA for hypothetical protein
          Length = 877

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 294 tgggttaagctcgtcccaggcctcgatccatgtgaccatggcatcagcaagcttgttgaa 353
           |||||| ||||||||||| || || ||||| |||||||| |||||| ||||||| | |||
Sbjct: 613 tgggttgagctcgtcccatgcttcaatccaggtgaccatagcatcaccaagcttctcgaa 554

              
Query: 354 gta 356
           |||
Sbjct: 553 gta 551
to top
>gb|AY622990.1| Lycopersicon esculentum UDP-glucose:protein transglucosylase-like
            protein SlUPTG1 mRNA, complete cds
          Length = 1398

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatc 338
            ||||||||||| ||||| || |||||||| |||||||| |||||
Sbjct: 1065 gggttaagctcatcccaagcttcgatccacgtgaccatagcatc 1022
to top
>gb|BT012716.1| Lycopersicon esculentum clone 113599F, mRNA sequence
          Length = 1413

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 295  gggttaagctcgtcccaggcctcgatccatgtgaccatggcatc 338
            ||||||||||| ||||| || |||||||| |||||||| |||||
Sbjct: 1083 gggttaagctcatcccaagcttcgatccacgtgaccatagcatc 1040
to top
>emb|AJ538673.1|NTA538673 Nicotiana tabacum cDNA-AFLP-fragment BC4-M12-032
          Length = 182

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 295 gggttaagctcgtcccaggcctcgatccatgtgaccatggcatc 338
           ||||| ||||| |||||||| || |||||||| |||||||||||
Sbjct: 47  gggttgagctcatcccaggcttcaatccatgtaaccatggcatc 4
to top
>emb|AJ223252.2|SOT223252 Solanum tuberosum mRNA for UDP-glucose:protein transglucosylase
            (uptg1 gene)
          Length = 1392

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 296  ggttaagctcgtcccaggcctcgatccatgtgaccatggc 335
            |||| ||||| ||||| || ||||||||||||||||||||
Sbjct: 1058 ggttgagctcatcccaagcttcgatccatgtgaccatggc 1019
to top
>ref|NM_111271.2| Arabidopsis thaliana oxidoreductase AT3G04000 mRNA, complete cds
          Length = 1056

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 355 tagccatccaccttgccgagctt 377
           |||||||||||||||||||||||
Sbjct: 95  tagccatccaccttgccgagctt 117
to top
>gb|AC011698.6|ATAC011698 Arabidopsis thaliana chromosome III BAC T11I18 genomic sequence,
             complete sequence
          Length = 63654

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 355   tagccatccaccttgccgagctt 377
             |||||||||||||||||||||||
Sbjct: 32235 tagccatccaccttgccgagctt 32257
to top
>gb|AY045807.1| Arabidopsis thaliana putative short-chain type
           dehydrogenase/reductase (At3g04000) mRNA, partial cds
          Length = 994

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 355 tagccatccaccttgccgagctt 377
           |||||||||||||||||||||||
Sbjct: 16  tagccatccaccttgccgagctt 38
to top
>gb|BT002321.1| Arabidopsis thaliana clone C105461 putative short-chain type
           dehydrogenase/reductase (At3g04000) mRNA, complete cds
          Length = 850

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 355 tagccatccaccttgccgagctt 377
           |||||||||||||||||||||||
Sbjct: 95  tagccatccaccttgccgagctt 117
to top
>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence
          Length = 132380

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 295   gggttaagctcgtcccaggcctcgatccatgtgaccat 332
             ||||||||||||||||| || | |||||| ||||||||
Sbjct: 27571 gggttaagctcgtcccatgcttggatccaagtgaccat 27534
to top
>ref|NM_204435.1| Gallus gallus asparagine-linked glycosylation 6 homolog (S.
           cerevisiae, alpha-1,3-glucosyltransferase) (ALG6), mRNA
          Length = 1813

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 416 ggacagtggtggcctcctttg 436
           |||||||||||||||||||||
Sbjct: 792 ggacagtggtggcctcctttg 812
to top
>gb|AC162035.5| Mus musculus chromosome 18, clone RP23-434N7, complete sequence
          Length = 200472

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 332    tggcatcagcaagcttgttga 352
              |||||||||||||||||||||
Sbjct: 124913 tggcatcagcaagcttgttga 124933
to top
>emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on chromosome 10 Contains the
              3' end of the gene for a novel protein (LOC220929)
              (FLJ32761), a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
              10 (RNA helicase) (DDH10) pseudogene and a CpG island,
              complete sequence
          Length = 179798

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    aagaaggtaaattttaagtta 137
              |||||||||||||||||||||
Sbjct: 129219 aagaaggtaaattttaagtta 129239
to top
>emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chromosome 11 Contains two
              novel genes, the AI503894 gene for expressed sequence
              AI503894, a laminin receptor 1 (ribosomal protein
              SA)(Lamr1) pseudogene and a CpG island, complete sequence
          Length = 201664

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 64     caacacaagcaaaaatgtaaa 84
              |||||||||||||||||||||
Sbjct: 102548 caacacaagcaaaaatgtaaa 102568
to top
>emb|AJ719772.1| Gallus gallus mRNA for hypothetical protein, clone 6f21
          Length = 1873

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 416 ggacagtggtggcctcctttg 436
           |||||||||||||||||||||
Sbjct: 774 ggacagtggtggcctcctttg 794
to top
>gb|AF308281.1| Zonotrichia atricapilla isolate 11 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308280.1| Zonotrichia atricapilla isolate 10 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308279.1| Zonotrichia atricapilla isolate 9 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308278.1| Zonotrichia atricapilla isolate 8 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308277.1| Zonotrichia atricapilla isolate 7 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308276.1| Zonotrichia atricapilla isolate 6AK mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308275.1| Zonotrichia atricapilla isolate 5AK mitochondrial control region,
           partial sequence
          Length = 344

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 57  cctctcacttgctcttcacag 77
to top
>gb|AF308274.1| Zonotrichia atricapilla isolate 6CA mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308273.1| Zonotrichia atricapilla isolate 5CA mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308272.1| Zonotrichia atricapilla isolate 4 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308271.1| Zonotrichia atricapilla isolate 3 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308270.1| Zonotrichia atricapilla isolate 2 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308269.1| Zonotrichia atricapilla isolate 1 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308268.1| Zonotrichia leucophrys isolate 47 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308267.1| Zonotrichia leucophrys isolate 46 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308266.1| Zonotrichia leucophrys isolate 45 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308265.1| Zonotrichia leucophrys isolate 44 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308264.1| Zonotrichia leucophrys isolate 43 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308263.1| Zonotrichia leucophrys isolate 42 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308262.1| Zonotrichia leucophrys isolate 41 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308261.1| Zonotrichia leucophrys isolate 40 mitochondrial control region,
           partial sequence
          Length = 344

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 57  cctctcacttgctcttcacag 77
to top
>gb|AF308260.1| Zonotrichia leucophrys isolate 39 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308259.1| Zonotrichia leucophrys isolate 38 mitochondrial control region,
           partial sequence
          Length = 343

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 56  cctctcacttgctcttcacag 76
to top
>gb|AF308258.1| Zonotrichia leucophrys isolate 36 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308257.1| Zonotrichia leucophrys isolate 29 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308256.1| Zonotrichia leucophrys isolate 25 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308255.1| Zonotrichia leucophrys isolate 24 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308254.1| Zonotrichia leucophrys isolate 23 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308253.1| Zonotrichia leucophrys isolate 22 mitochondrial control region,
           partial sequence
          Length = 344

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 57  cctctcacttgctcttcacag 77
to top
>gb|AF308252.1| Zonotrichia leucophrys isolate 6 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308251.1| Zonotrichia leucophrys isolate 5 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308250.1| Zonotrichia leucophrys isolate 4 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308249.1| Zonotrichia leucophrys isolate 3 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308248.1| Zonotrichia leucophrys isolate 2 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308247.1| Zonotrichia leucophrys isolate 1 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308246.1| Zonotrichia albicollis isolate 1 mitochondrial control region,
           partial sequence
          Length = 345

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>gb|AF308245.1| Zonotrichia querula isolate 2 mitochondrial control region, partial
           sequence
          Length = 327

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 239 cctctcacttgctcttcacag 259
           |||||||||||||||||||||
Sbjct: 58  cctctcacttgctcttcacag 78
to top
>emb|AJ535824.1|GGA535824 Gallus gallus mRNA for alpha 3 glucosyltransferase (ALG6 gene)
          Length = 1813

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 416 ggacagtggtggcctcctttg 436
           |||||||||||||||||||||
Sbjct: 792 ggacagtggtggcctcctttg 812
to top
>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     tttgaaggtgtgatcccatt 45
              ||||||||||||||||||||
Sbjct: 494453 tttgaaggtgtgatcccatt 494472
to top
>ref|XM_957559.1| Neurospora crassa OR74A hypothetical protein ( (AF013601)
            acetolactate synthase [Magnaporthe grisea] ) (NCU07982.1)
            partial mRNA
          Length = 1833

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 329  ccatggcatcagcaagcttg 348
            ||||||||||||||||||||
Sbjct: 1600 ccatggcatcagcaagcttg 1581
to top
>ref|XM_328687.1| Neurospora crassa OR74A hypothetical protein ( (AF013601)
            acetolactate synthase [Magnaporthe grisea] ) (NCU07982.1)
            partial mRNA
          Length = 1833

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 329  ccatggcatcagcaagcttg 348
            ||||||||||||||||||||
Sbjct: 1600 ccatggcatcagcaagcttg 1581
to top
>gb|AC140478.2| Mus musculus BAC clone RP24-149A3 from chromosome 6, complete sequence
          Length = 162440

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    tcagtatgggtagctcacat 208
              ||||||||||||||||||||
Sbjct: 154109 tcagtatgggtagctcacat 154128
to top
>gb|AC123823.3| Mus musculus BAC clone RP24-63C11 from chromosome 7, complete sequence
          Length = 185494

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     aaaaatgtaaattccctaaa 93
              ||||||||||||||||||||
Sbjct: 111126 aaaaatgtaaattccctaaa 111145
to top
>gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome 9, complete
            sequence
          Length = 171723

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 397  agctcaaggtaacacttctg 416
            ||||||||||||||||||||
Sbjct: 9964 agctcaaggtaacacttctg 9983
to top
>emb|AL590453.10| Human DNA sequence from clone RP11-294K17 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 187461

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 218    aactgtatatgtatgctact 237
              ||||||||||||||||||||
Sbjct: 147090 aactgtatatgtatgctact 147071
to top
>emb|AL139322.13| Human DNA sequence from clone RP11-196P14 on chromosome 13 Contains the
              ITM2B gene for integral membrane protein 2B (BRI FBD E25B
              E3-16) and a CpG island, complete sequence
          Length = 120773

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     aaaatgtaaattccctaaaa 94
              ||||||||||||||||||||
Sbjct: 102568 aaaatgtaaattccctaaaa 102587
to top
>emb|BX842644.1| Mycoplasma mycoides subsp. mycoides SC genomic DNA, complete sequence;
              segment 3/4
          Length = 349402

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 53     tacaactgttccaacacaagcaaa 76
              ||||||||||||||||| ||||||
Sbjct: 180850 tacaactgttccaacaccagcaaa 180873
to top
>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 77184 aaaaatgtaaattccctaaa 77203
to top
>gb|AC161890.4| Mus musculus 6 BAC RP23-356P12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 243990

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    tcagtatgggtagctcacat 208
              ||||||||||||||||||||
Sbjct: 132941 tcagtatgggtagctcacat 132960
to top
>gb|AC073372.9| Homo sapiens chromosome 11 clone RP11-500D4, complete sequence
          Length = 180504

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    aacacgagtatttcagtatg 196
              ||||||||||||||||||||
Sbjct: 148109 aacacgagtatttcagtatg 148090
to top
>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 99878 aaaaatgtaaattccctaaa 99897
to top
>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 85459 aaaaatgtaaattccctaaa 85478
to top
>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 51527 aaaaatgtaaattccctaaa 51546
to top
>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     aaaaatgtaaattccctaaa 93
              ||||||||||||||||||||
Sbjct: 106265 aaaaatgtaaattccctaaa 106284
to top
>gb|AC156567.3| Mus musculus BAC clone RP23-333F2 from chromosome 13, complete sequence
          Length = 204778

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 240    ctctcacttgctcttcacag 259
              ||||||||||||||||||||
Sbjct: 105670 ctctcacttgctcttcacag 105651
to top
>gb|AC112140.4| Homo sapiens BAC clone RP11-131H21 from 4, complete sequence
          Length = 99369

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 74    aaaaatgtaaattccctaaaacca 97
             |||||| |||||||||||||||||
Sbjct: 19160 aaaaatttaaattccctaaaacca 19137
to top
>gb|AC025949.4| Staphylococcus aureus clone sabac-114, complete sequence
          Length = 28142

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 27518 aaaaatgtaaattccctaaa 27499
to top
>gb|AC084724.6| Homo sapiens BAC clone RP11-613O14 from 4, complete sequence
          Length = 172647

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     acacaagcaaaaatgtaaat 85
              ||||||||||||||||||||
Sbjct: 148485 acacaagcaaaaatgtaaat 148504
to top
>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome,
             strain:MW2
          Length = 2820462

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 78477 aaaaatgtaaattccctaaa 78496
to top
>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    aaaaatgtaaattccctaaa 93
             ||||||||||||||||||||
Sbjct: 99917 aaaaatgtaaattccctaaa 99936
to top
>gb|AC108805.15| Mus musculus chromosome 9, clone RP23-226G13, complete sequence
          Length = 242531

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 397    agctcaaggtaacacttctg 416
              ||||||||||||||||||||
Sbjct: 119125 agctcaaggtaacacttctg 119106
to top
>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     aaaaatgtaaattccctaaa 93
              ||||||||||||||||||||
Sbjct: 106793 aaaaatgtaaattccctaaa 106812
to top
>dbj|AP003036.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-600E1, complete
             sequence
          Length = 55000

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   aacacgagtatttcagtatg 196
             ||||||||||||||||||||
Sbjct: 22771 aacacgagtatttcagtatg 22790
to top
>gb|AC127698.5| Mus musculus BAC clone RP24-113N24 from 3, complete sequence
          Length = 174669

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 agctcgtcccaggcctcgat 320
           ||||||||||||||||||||
Sbjct: 399 agctcgtcccaggcctcgat 380
to top
>gb|AC134571.4| Mus musculus BAC clone RP23-435E17 from 3, complete sequence
          Length = 198578

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    agctcgtcccaggcctcgat 320
              ||||||||||||||||||||
Sbjct: 136278 agctcgtcccaggcctcgat 136297


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,369,043
Number of Sequences: 3902068
Number of extensions: 4369043
Number of successful extensions: 85066
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 120
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84752
Number of HSP's gapped (non-prelim): 314
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top